La synthèse des protéines - transcription

Commentaires

Transcription

La synthèse des protéines - transcription
CEC André-Chavanne
BIO 3 OS
La synthèse des protéines
transcription – code génétique – traduction
I. La « Transcription » : de l’ADN à l’ARNm.
L'adresse suivante permet d’accéder à une ANIMATION sur la TRANSCRIPTION.
A.Ouvrir le lien : http://www.biologieenflash.net/sommaire.html
Double cliquer sur “ biologie ” / cliquer sur “biologie cellulaire” / aller à la page 2 /
ouvrir le lien sur “La transcription de l'ADN en ARN messager” / cliquer sur “légendes”
Regarder l'animation une 1ère fois, puis complétez les phrases en la
regardant une 2nd fois ( n'hésitez pas à utiliser la fonction « pause » et
« retour en arrière » )
a) La transcription de l'ADN en ARNm se réalise dans .
.
.
.
.
.
.
.
.
.
.
b) Un promoteur c'est .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
c) Un signal de terminaison c'est .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
d) l'ARNpolymérase, se lie à l'ADN au niveau de .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
e) Les 3 fonctions de l'ARNpolymérase sont :
1) .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
2) .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
3) .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
- page 1/6 -
f) L'ARNm ( = ARN messager) c'est .
.
.
.
.
.
g) Le sens de lecture du brin transcrit d'ADN est de
.
.
vers
vers .
.
h) L'ARNm est synthétisé dans le sens .
I. Ouvrir le lien
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
http://www.snv.jussieu.fr/vie/dossiers/ADN_Prot/ADN_ARN/ADN_ARN2.html
Cliquez sur « ANIMATION COMPLETE » complétez les phrases et
répondez aux questions
a) On sait que le .
.
.
.
.
.
.
.
.
.
.
b) L'information doit.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
e) Le phénotype c'est
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
d) Le génotype c'est
.
.
.
c) Il faut pour cela .
.
.
.
.
.
f) A l’aide de l’animation représentez le fragment de gène proposé (écrivez la séquence à
l’aide des lettres ATCG).
g) Pourquoi la transcription est-elle nécessaire ?
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
- page 2/6 -
CEC André-Chavanne
BIO 3 OS
h) À l’aide de l’animation, représentez le brin transcrit et la séquence d’ARNm, résultat
de la transcription.
i) Les nucléotides de l’ADN et de l’ARNm présentent deux différences importantes.
A l’aide de l’animation dessinez le sucre ( et donnez son nom ) de l'ADN et celui de
L'ARN, puis les lettres représentant les bases identiques et différentes.
ADN ARN
- Sucres
- Bases identiques :
- Bases différentes :
j) Quel est l’intérêt du brin transcrit ?
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
k) Pour résumer, et en utilisant l’animation, quelle est l’intérêt de la transcription et que
deviendra l’ARNm ?
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
- page 3/6 -
II. Le “ Code génétique ” : Une correspondance entre un
“ codon ” et un “ acide animé ”
A.Lisez le texte ci dessous, puis soulignez le plus important
L'information génétique est conservée par la cellule au niveau de son ADN. Cette
information est transcrite en ARNm, puis traduite en protéines. Ce sont ces protéines
fonctionnelles qui sont l'expression de l'information génétique. Une étape clé dans
l'expression de l'information génétique est donc la traduction de l'information sous forme
nucléotidique en une forme protéique. Cette traduction est réalisée par groupe de 3
nucléotides appelé « codon » : 3 nucléotides codent pour un des 20 acides aminés
naturels. Cette correspondance « codon - acide aminé » est le « code génétique ».
B.Ouvrir le lien http://www.snv.jussieu.fr/vie/documents/codegenet/index.htm
Cette adresse permet d’accéder à un DOCUMENT sur le CODE GENETIQUE
Complétez les phrases et répondez aux questions
a) Les trois propriétés du code génétique sont :
1) .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
2) .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
3) .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
b) Quel est l’intérêt des trois codons « non sens » ?
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
c) A l’aide du lien permettant d’accéder à l’animation vous pouvez vérifiez deux de ces
propriétés : lesquelles ?
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
- page 4/6 -
.
.
.
.
.
.
.
.
.
.
.
.
.
CEC André-Chavanne
BIO 3 OS
III. La « Traduction » : de l’ARNm à la protéine.
A.Ouvrir le lien : http://www.biologieenflash.net/sommaire.html
Double cliquer sur “ biologie ” / cliquer sur “biologie cellulaire” / aller à la page 2 /
ouvrir le lien sur “La traduction de l'ARN messager en protéines.” / cliquer sur
“légendes”
Regarder l'animation une 1ère fois, puis complétez les phrases en la
regardant une 2nd fois ( n'hésitez pas à utiliser la fonction « pause » et
« retour en arrière » )
La traduction de l'ARNm en protéine se réalise dans .
.
.
.
.
.
.
.
.
.
.
.
1) Phase d'initiation :
Faites un schéma légendé de cette étape en appuyant sur pause.
ARNm
CAAGCCAUGUGCUACUACAUCCACCAAGUACCCCCUUGGUAGUUUUUA
2) Phase d'élongation :
Expliquez clairement étape par étape ce qui se passe au cours de cette phase.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
- page 5/6 -
Phase de terminaison
Faites un schéma légendé de cette étape en appuyant sur pause.
ARNm
CAAGCCAUGUGCUACUACAUCCACCAAGUACCCCCUUGGUAGUUUUUA
B.Ouvrir le lien :
http://www.geniebio.ac-aix-marseille.fr/biomol/docs/tradu.html
a) Démarrez la synthèse des protéines (traduction). Recopiez la séquence de l’ARNm
proposée, prévoyez la séquence d’acides aminés et vérifiez à l’aide de l’animation.
b) Recopiez la séquence d’ARNm, puis schématisez et légendez les trois phases de la
seconde étape ?
- page 6/6 -

Documents pareils