Chap.2 : La synthèse des protéines - SOS

Commentaires

Transcription

Chap.2 : La synthèse des protéines - SOS
Chap.2 : La synthèse des protéines
Intro : Protéine = molécule séquencée en acides aminés & ADN : molécule séquencée en
nucléotides.
Quelle relation existe-t-il entre ces 2 molécules séquencées ?
I. La relation entre gène et protéine.
A. Un gène détermine une protéine.
Rappel 2nd : Une molécule d’ADN est composée de deux
longues chaînes polynucléotidiques appelées brins d’ADN.
Chacun de ces brins est composé de 4 types de nucléotides (A,
C, T et G) et les 2 brins sont reliés entre eux par des liaisons
hydrogènes situées entre les bases des nucléotides.. (A-T et C-G).
L’ADN est enroulé sous forme d’une double hélice.
Un chromosome comprend une seule et très longue molécule
d’ADN associé à des protéines qui replient et empaquettent cet
ADN en une structure plus compacte et plus dense.
Un nucléotide à Adénine.
Exemple de la drépanocytose, analyse d’électrophorèse. (ci-après)
Un gène est une séquence de nucléotides de la molécule d’ADN déterminant la séquence d’un polypeptide
donné. Les phénotypes alternatifs sont dus à des différences dans les protéines concernés qui peuvent être
dues à une différence dans le gène concerné.
Résultats d’électrophorèse de Hb.
Les individus 4, 7 et 8 sont drépanocytaires.
GTGCACCTGACTCCTGAGGAGAAGTCT (HbA)
GTGCACCTGACTCCTGTGGAGAAGTCT (HbS)
Extrait de la séquence nucléotidique du gène codant pour
l’Hb, gène sain, gène muté.
B. . Un intermédiaire entre ADN et protéine.
Dans les cellules eucaryotes, l’information héréditaire passe des gènes aux protéines
synthétisées dans le cytoplasme. Les étapes de la synthèse protéique se déroulent donc dans 2
compartiments différents : noyau et cytoplasme. Comment l’information est-elle transmise
du noyau au cytoplasme ? Hypothèses ?
X 2000, Bordas 1ère S.
Ceci implique la synthèse d’un intermédiaire : l’ARN messager = ARNm.
II. De l’ADN à l’ARNmessager : la transcription.
MISE EN PLACE DU SCHEMA-BILAN :
LA SYNTHESE DES PROTEINES.
A. Les caractéristiques de l’ARNm.
Etude de documents sur la molécule d’ARNm.
Caractéristiques
ADN
ARNm
Nature chimique de
la molécule
acide nucléique
acide nucléique
Sucre des nucléotides
désoxyribose
ribose
Bases des nucléotides
A se liant avec T
G se liant avec C
A se liant avec U.
G se liant avec C
Structure des
molécules
2 brins en double hélice
simple brin.
Comment transcrire l’ADN en ARN en maintenant l’information ?
B. La synthèse de l’ARNm.
TP : boîte modèle ADN, ARNm + visualisation animation.
La transcription repose sur l’appariement des bases complémentaires. Les 2 brins de la double
hélice se sépare localement et l’un des deux brins sert de matrice, c’est le brin transcrit.
Ce processus est catalysé par l’ARN polymérase qui se fixe et se déplace le long de l’ADN en
ajoutant des nucléotides à l’ARNm. L’ARN est donc une « empreinte du brin matrice, il a
donc la même séquence que le brin non transcrit ou brin codant.
CONSTRUCTION DU SCHEMA-BILAN.
III. De l’ARNm aux protéines : la traduction.
A. Comparaison entre séquence d’acides aminés
nucléotides.
et de
L’ocytocine
Puis en aa :
TGCTACATCCAGAACTGCCCCCTGGGC
UGCUACAUCCAGAACUGCCCCCUGGGC
Cys Tyr Ile Gln Asn Cys Pro Leu Gly
La comparaison des séquences nucléotidiques et des séquences d’acides aminés, semblent
indiquer qu’un acide aminé correspond à un triplet de nucléotides, que l’on appelle : un
codon.
B. Un traducteur : le code génétique.
Etude et utilisation du code génétique.
Le code de correspondance, clef du décryptage du message entre les codons et les acides
aminés , est le code génétique. Il est universel.
Un codon code pour un acide aminé sauf les 3 codons suivants qui sont des « codons
STOP » : UAA, UAG, et UGA.
Un même acide aminé peut être codé par plusieurs codons différents : on dit que le code
génétique est redondant ou dégénéré.
C. Le mécanisme de la traduction.
La traduction se réalise dans le cytoplasme. Ce sont des organites qui sont les « ateliers
d’assemblage » des protéines. La traduction se déroule en 3 étapes :
•
•
•
L’initiation : fixation d’un ribosome au codon initiateur AUG correspondant à l’acide
aminé méthionine.
L’élongation : le ribosome se déplace un nouvel acide aminé vient se placer en face
du codon correspondant rencontré par le ribosome. Une liaison peptidique s’établit
entre chaque acide aminé.
La terminaison : le ribosome arrive à un codon STOP, il se dissocie donc de l’ARNm
et c’est la fin de la synthèse protéique.
Rque : un même ARNm peut être traduit simultanément par plusieurs ribosomes.
FIN DU SCHEMA-BILAN.