canadian young scientist journal canadian young scientist journal

Transcription

ISSN 1913-1925
1.2011
XXXDZTKPVSOBMDB
project reports
rapports de projet
case studies
études de cas
science book reviews
critiques de livres scientifiques
CANADIAN
REVUE
YOUNG SCIENTIST
CANADIENNE DES JEUNES
JOURNAL
SCIENTIFIQUES
j%FTJHOJOH%ZF4FOTJUJWF5J024PMBS$FMMT
j&OIBODFE4BMU5PMFSBODFJO-&"(FOFT
j)PX(SFFO*T:PVS4BMFT3FDFJQU
j$BSCPO/BOPUVCFT5PYJDJUZUP%BQIOB
j/VUSJUJPOBOE4USFTT
j4ZTU·NFEFDBQUBUJPOEV$02
j4MPX*U%PXOUP4QFFE*U6Q
"'PSVNGPSUIF/FYU(FOFSBUJPOPG$BOBEJBO5IJOLFST
6O'PSVNQPVSMB1SPDIBJOF(¸O¸SBUJPOEF1FOTFVST$BOBEJFOT
Teaching
Resources
Inside !
HmsT HONOURS MATHEMATICS, SCIENCE AND TECHNOLOGY
http://schools.tdsb.on.ca/northviewheights
http://cyberarts-northview.ca
Northview Heights Secondary School
550 Finch Avenue West, North York, Ontario, M2R 1N6
416-395-3290
ISSN 1913-1925
1.2011
project reports • case studies • science book reviews
rapports de projet • études de cas • critiques de livres scientifiques
CANADIAN
REVUE
YOUNG SCIENTIST
CANADIENNE DES JEUNES
JOURNAL
SCIENTIFIQUES
Non Profit Multidisciplinary Peer-reviewed Publication • Publication Multidisciplinaire à But Non Lucratif Évaluée par des Pairs
Physics, Mathematics, Chemistry • Informatics, Computer Engineering and Science • Business, Social Sciences, Pedagogy • Life Sciences, Biology, Environmental Studies
Physique, Mathématiques, Chimie • Informatique, Génie Informatique • Affaires, Sciences Sociales, Pédagogie • Sciences de la Vie, Biologie, Études Environnementales
Make your Ideas Known
Faites vos Idees Connues
Editor-in-Chief
Student Editorial Board
Teacher Editorial Board
Webmaster
Communications
Cover Page Art
Back Cover Page Art
Layout and Design
Alexandre Noukhovitch PhD, OCT
Kelly Wong, Janine Abuluyan, Dmitri Naoumov, Yogesh Verma, bilingual
connection by Norman Atagu, Fatema Chowdhury and Michael Noukhovitch
Daniel Muttiah, Judi Symes, Deborah Kupperman
Wayne Loo
Evguenia Noukhovitch
Yana Pozarin (CyberArts Program Northview Heights SS)
Parya Vahdat (CyberArts Program Northview Heights SS)
Kiril Nikolaev and Evguenia Noukhovitch
A Forum for the Next Generation of Canadian Thinkers
Un Forum Pour la Prochaine Génération de Penseurs Canadiens
www.cysjournal.ca
[email protected]
Northview
Special thanks to the devoted staff and administration of Northview Heights Secondary School, and particularly to
extraordinary teachers Daniel Muttiah ACL, A. Y. Jackson CI ,Judi Symes, Deborah Kupperman, for their generous
support and involvement.
Also we extend our gratitude to Margaret Belisle ACL, Cyber Arts Program at Northview Heights SS and Martin Gordon
who organized design competitions for cover art.
We are grateful to Reni Barlow, Executive Director of the Youth Science Canada for his vision, leadership and guidance
in inspiring a new generation of Canadian scientific elite.
We express our sincere gratitude to the Canadian scientists: Dr. Dennis McCormac, Director, Platform Development, Ontario
Genomics Institute, Dr. Franco Gaspari, Assistant Professor, Faculty of Science, UOIT, Ryan Herszkowicz, HBSc, MHSc, Dr.
Christian R. Marshall, Genetic Analysis Facility, The Centre for Applied Genomics, Dr. Peter McCourt, Department of Cell & Systems
Biology, University of Toronto, Dr. Isla Ogilvie PhD, Senior research application associate, BioMedCom Consultants Inc
Copyright © 2011 Canadian Young Scientist Journal
Contents
Foreword
Howard Kaplan, Trustee, Ward 5, York Centre, Toronto District School Board
Forge On! . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
Editorial
Alexandre Noukhovitch, Ph.D., OCT, Editor-in-Chief, Northview Heights Secondary School,
Toronto District School Board
Education Online and the Modern Intellectual Apprenticeship . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
Physics
Paul W. Chen
Design and Study of Dye Sensitized Titanium Dioxide Solar Cells . . . . . . . . . . . . . . . . . . . . . . . . 7
Reviewed by: Franco Gaspari, Ph.D., Assistant Professor, UOIT, Faculty of Science . . . . . . . . . . . . 12
Life and Health Sciences
Samantha Wong
Nutrition and Stress . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Reviewed by: Ryan Herszkowicz, HBSc, MHSc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
Adelina Corina Cozma
Slow It Down to Speed It Up: Breaking Through the Window of Autism . . . . . . . . . . . . . . . . . . 21
Reviewed by: Christian R. Marshall, Ph.D., Research Associate, Genetic Analysis Facility,
The Centre for Applied Genomics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Chemistry
Joël Filion
Système de captation du CO2: Rentabiliser le Développement Vert . . . . . . . . . . . . . . . . . . . . . . 30
Commentaire par: Isla Ogilvie, Ph.D., Senior research application associate, BioMedCom
Consultants Inc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
Environmental Sciences
David A. Gobbi
How Green is Your Sales Receipt? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
Reviewed by: Peter Baltais, Environmental Regulatory Advisor, Petroleum Products . . . . . . . . . . . . 42
Edward Kim
Toxicity of Carbon Nanotubes in Daphnia Magna . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
Reviewed by: Bruce M. Greenberg, Ph.D., Professor, Department of Biology, University of
Waterloo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
2
Genomics and Biotech
Yun (Jessica) Zou, Shuanglin (Linda) Zhu, Surya Kant, and Steven Rothstein
Engineering of LEA genes to Investigate Enhanced Salt Tolerance . . . . . . . . . . . . . . . . . . . . . . 48
Reviewed by: Peter McCourt, Ph.D., Department of Cell & Systems Biology, University of Toronto . . . . . 56
Teacher Resources
Judy Letourneau, Canadian Science Publishing, Ottawa, Ontario
NRC Research Press Back Files: Now Open Access for Canadians . . . . . . . . . . . . . . . . . . . . . . 57
Modus Operandi
Dr. Greg Lewis, Associate Professor of Mathematics, UOIT
A Career in Applied Mathematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
Pathways
Michael Kasperovich, Computer Science Student, York University
My Life is FIT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
Dear Reader, please speak with your librarian and consider subscribing to the Canadian Young Scientist Journal
(http://cysjournal.ca/pages/membership)
We are pleased to provide a free a copy to every secondary school in Canada. However, your membership is critical
to maintain publication and distribution of students’ original research work.
In addition, enjoy the benefits of membership such as access to the online archive of publications, research co-op
opportunities, and much more.
3
CANADIAN YOUNG SCIENTIST JOURNAL · LA REVUE CANADIENNE DE JEUNES SCIENTIFIQUES #1.2011
Foreword
Forge On!
Howard Kaplan
Trustee, Ward 5, York Centre, Toronto District School Board
Ever since I began to read I’ve been interested
in how the world works. I always asked questions,
and I always questioned the answers. Occasionally this got me in trouble with my teachers
who often couldn’t answer my queries: “Why is
the sky blue?” “Where does the water go
when the blackboard dries?” “What happens
when an animal dies?” “Where do we go when we
die?”.
Fundamental questions for a child in Grade 1 or 2.
Also questions asked since the beginning of human
thought.
The first answers were likely simple. Things
happen because they just do. Perhaps the various
spirits that inhabit Nature cause them to happen. And so the people continued doing what they
do and very little changed. It wasn’t until some
people began to question accepted beliefs, asking: “How can we change things?” “How can we
influence what is going on in and around our
lives?” that people began to look for answers to
the questions of Nature. This led to investigation
of Nature, the compiling of theories and testing of
them, questioning the answers, re-investigating, and
so on.
And, of course, there were those who questioned
the questioners. “Why are you upsetting things?”
“This is the way it is!” “Don’t try to change things!”
“The gods will punish us!”.
But, of course, they didn’t. It was the established
order which punished the questioners. Among the
scientists of old we have these:
• Ulugh Beg (Mīrzā Mohammad Tāraghay bin Shāh
Rokh), the XV Century Sultan of Uzbekistan
and grandson of Tamurlane was also an accomplished scientist, astronomer and mathematician.
After he was murdered by his son, his observatory near Samarkand was torn apart by religious
zealots.
4
• Giordano Bruno was burned at the stake after
suggesting that the universe was infinite, that the
stars were like our own sun, each with planets in
orbit around them.
• Kopernikus’ heliocentric theory was condemned
by the Church.
• Galileo was threatened with torture and placed under house arrest for publishing what he observed
in his telescopes.
• Charles Darwin held off publishing his “On the Origin of Species” for twenty years out of fear of the
reaction from “official” science.
These and other great thinkers were considered threats to the existing order. But this didn’t
stop people’s curiosities from pursuing knowledge,
no matter how threatening it was to the establishment.
Even today, in 2011, we see attacks on the
scientific method, on investigation, on peer reviews, and the growth and development of
knowledge. Powerful interests continue to deny
the facts of global warming, or deny any human causes. Religious zealots continue to deny
scientifically established evolution. Racists, homophobics and others who fear the “other”
deny the genetically proven unity and diversity of humankind.
Scientific investigation has shown us that we are
but a part of the interrelationships that exist in Nature;
that the food we eat is dependent not only on what
we put into the ground, but also on factors as diverse
as the effects of water diversion, forest management,
mining methods, and waste disposal choices; the list
goes on and on and on.
But we must forge ahead! The human mind is
limitless. We can never know everything, for if we
Howard Kaplan FORGE ON!
do, then there is nothing left to know. The pursuit of
scientific knowledge has demonstrated for us the
evidence of global warming, and given us the tools
for slowing it down, even halting it. It has given us
the tools to refute those who seek to gain short-term
profit at the cost of long-term climate stability.
Yes, forge on! Continue on your limitless search
for scientific knowledge. Review each other’s findings and theories. Criticize each other. Ask questions
of each other. All in the pursuit of advancing our understanding of the world – nay – the universe in which
we live, and of each other as living, loving and caring
inhabitants of Planet Earth, and sharing it in harmony
with all other living things.
Canadian Young Scientist Journal is an excellent
tool in this pursuit. I congratulate CYSJ in providing
an outlet for the expansion of our knowledge of ourselves.
5
Editorial
Education Online and the Modern Intellectual
Apprenticeship
As with previous volumes, this year’s first issue falls
in the middle of the academic year, marking the peak of
Canadian Young Scientist Journal associated activity.
This time, we are expanding the peer-review process of student research papers into classrooms and
extracurricular programs regardless of geographical
location. We have created an online mechanism of
participation in the paper selection for publication
process, accessible to teachers and interested students. It is available as a resource for classroom assignments, critical analyses, examinations of format,
originality of ideas investigations, and the introduction to the process of scientific publication.
This Article Review opportunity is accessible from
the Teaching Resources page of our website (http://
www.cysjournal.ca/pages/teaching). To recognize students and school input, as well as to protect copyright
materials of articles under review, this mechanism is
based on teacher registration and representation of
the reviews that are done under their supervision.
We have also released a Beta version of the Research Co-op Program, piloted last academic year by
the Journal in partnership with Ontario universities.
This program allows high school students to reach
ahead into knowledge-based professions by being
placed in the role of on-line research assistants with
aerospace and business, biomed and alternative energy, sustainable development, ICT and civil rights
R&D ventures at universities. Implemented in the
form of a grade 11 or 12 co-op credit, this program
is an excellent fit into the busy timetable of a general
high school curriculum or Specialist High Skills Major
student and creates a skills set necessary for post
secondary education.
The program employs an e-format (http://www.cysjournal.ca/pages/coop) for student - professor communication, creating a work environment representative of the modern industry on-line job search, service
reporting and professional interaction. The program
stimulates students’ idea generation and innovation.
It is also motivates individual learning and active
contribution to the research groups they become part of,
during the program and afterwards. The true virtual environment of the program serves to improve both skills
for independent work and efficient team cooperation.
What we are trying to accomplish with this program can be dubbed the “21st century intellectual apprenticeship”. The key here is in a different nature of
mentorship and skills acquired. A professor who provides on-line research direction represents only part
of the mentorship. Most of it is the free expert knowledge distributed and acquired by the student over the
Internet. It comes in the form of on-line lectures on
the subject of thev student’s research that are made
available by leading universities like Stanford, Princeton, MIT, Harvard (http://internet-tv-search-engineswicki.eurekster.com/online+lectures/?=lectures). It
exists in various subject-specific websites and forums, so a student learns from various examples and
sources forming his/her own style and perception.
Skills transfer in the intellectual apprenticeship
does not take place in a traditional way either; it is
not the result of some form of adaptation or replication of a mentor’s practices. The focus is made on
individual student or group attempts to apply natural
analytical abilities to a complex task and its smaller
sub-problems. As a result, students come to identify
their analytical strengths and pick up the problem
solving techniques most suitable for them.
Overall, the Research Co-op Program has the goal
of forming a school of innovation. It is quite different
from existing centers of innovation as the end result
that we are after is not business, technical, scientific
or social innovations themselves. What we want is to
foster a cohort of young people capable of imagining
and implementing these innovations.
The online accessible Beta version of the Research
Co-op and Article Review opportunity are the Journal’s
newest and most promising initiatives to involve an even
greater number of students and teachers in the academic environment. We eagerly look forward to seeing the
benefits of these new initiatives over the upcoming year.
Editor-in-Chief Alexandre Noukhovitch, Ph.D.
6
Paul W. Chen DESIGN AND STUDY OF DYE SENSITIZED TITANIUM DIOXIDE SOLAR CELLS
Physics
Design and Study of Dye Sensitized Titanium
Dioxide Solar Cells
Paul W. Chen
Grade 11, Sir Winston Churchill C. & V.I., Thunder Bay, Ontario
Paul W. Chen is a Grade 12 student at Sir Winston Churchill C. &
V.I., Thunder Bay. Due to the inspiration from his father, a chemistry professor, Chen has always
been fascinated with new science
and technology. Since Grade 7,
he has competed in several engineering and science competitions.
For instance, his team designed
and built the strongest spaghetti
bridge that won first place in the
Lakehead University Engineering
Challenge competition in 2006.
Chen participated in the Northwestern Ontario Regional Science Fair where he won several
prizes. In 2010, he was selected
to attend the National Science
Fair in Peterborough, Ontario.
Chen also worked at the Superior
Science Summer Camp program
as a junior instructor where he
inspired kids and adolescents to
consider a career in science and
technology.
In our world today, global warming is a major issue that establishes a concern for keeping a
healthy environment. Healing the
Earth first begins with preventing
further harm, which is why new
green energy sources need to be
introduced. Solar energy is one
of the best solutions as photovoltaic cells can generate electricity
simply by harnessing the sun’s
In this paper, dye sensitized solar cells were studied and methods of improving their efficiency were explored. Several functional solar cells were fabricated using titanium dioxide (TiO2)
nanoparticles and different natural dyes extracted from fruits
including raspberry, blackberry, orange and grape. The TiO2
nanoparticles were characterized using a scanning electron
microscope and energy dispersive x-ray spectroscopy to determine the composition and morphology. Because of its large
band gap (~3.18eV), titanium dioxide mainly responds to ultraviolet light. The dyes were used to facilitate the absorption
of visible light to improve the efficiency of the solar cell as the
largest proportion of sunlight is visible light. The current and
voltage generated by the fabricated solar cells were measured
individually using a multimeter to determine their efficiency,
showing that the raspberry dye worked the best overall. Ultraviolet visible spectroscopic studies revealed that the raspberry
dye had the highest visible light absorption among the four
dyes. In addition, an optical device was used to intensify the
sunlight illuminated on the solar cell to further increase the
power production, demonstrating that increasing the focus of
light on the cell is also essential for improving the efficiency.
Dans cet article, colorant les cellules solaires sensibilisées
ont été étudiés et les méthodes de l’amélioration de leur efficacité ont été explorées. Plusieurs fonctionnelle des cellules
solaires ont été fabriqués en utilisant du dioxyde de titane
(TiO2) nanoparticules et différents colorants naturels extraits
de fruits, y compris framboise, mûre, orange et le raisin. Les
nanoparticules de TiO2 ont été caractérisés en utilisant un microscope électronique à balayage et spectroscopie à dispersion d’énergie des rayons X pour déterminer la composition
et la morphologie. En raison de sa grande largeur de bande
(~ 3.18eV), dioxyde de titane répond principalement à la lumière ultraviolette. Les colorants ont été utilisés pour faciliter
l’absorption de la lumière visible pour améliorer l’efficacité de
la cellule solaire la plus grande proportion de la lumière du
7
energy. However, the main problem is that their efficiency is still
too low to be considered a practical resource. The objective of
Chen’s project is to develop a
more efficient solar cell.
soleil est la lumière visible. Le courant et la tension générée
par les cellules solaires fabriquées ont été mesurés individuellement à l’aide d’un multimètre pour déterminer leur efficacité,
montrant que le colorant framboise travaillé le meilleur ensemble. Ultraviolet visible études spectroscopiques ont révélé
que le colorant de framboise, le plus élevé d’absorption de la
lumière visible parmi les quatre colorants. En outre, un dispositif optique a été utilisé pour intensifier la lumière du so
leil lumineux de la cellule solaire pour augmenter encore la production d’énergie, ce qui démontre que
l’augmentation du foyer de lumière sur la cellule est également essentiel pour améliorer l’efficacité.
Background
Nanocrystalline dye sensitized solar cells are photo-electrochemical cells that function differently when
compared to regular solar cells[1,2]. They work similarly to natural photo-synthesis in two ways. First, they
use an organic dye to absorb light and produce an
electron circuit (flow of electrons). Second, they use
multiple layers of semiconductors to enhance light
absorption and electron collection efficiency. These
cells go beyond microelectronic technology and end
up in the world of nanotechnology.
Titanium dioxide is found in nature as the minerals
rutile and anatase. It is one of the best photocatalysts
commercially available. However, its energy band
gap is over 3eV; and it only responses to ultraviolet light[3,4]. This creates problems in the solar cell’s
performance because sunlight is mostly comprised
of visible light. There are two approaches to addressing this issue. One is doping an impurity such as nitrogen, carbon or fluorine into the titanium dioxide to
lower its energy band gap. The other approach is to
stain the TiO2 with a visible light absorbing dye.
Nanocrystalline solar cells can be created by coating a uniform layer of titanium dioxide onto a piece of
tin dioxide (SnO2) coated glass. The TiO2 film must
then be dried and heated on the glass to create the
proper surface, which looks similar to a thin layer of
sponge or membrane. The TiO2 thin film must then be
soaked in a dye solution which helps it absorb light,
similar to the way chlorophyll functions. A high-performance natural dye should have carbonyl (C=O)
or hydroxyl (–OH) groups capable of complexing to
the Ti (IV) sites on the TiO2 surface[1]. Also the dye
must have the proper position for electron injection
and sensitization in its energy levels. When the dye
is added to the TiO2, it adsorbs to its surface and
helps absorb light. A drop of an electrolyte containing
8
iodide is then required to percolate into the pores of
the film. The system also needs a counter-electrode
composed of conductive glass with a thin layer of
carbon. The two electrodes are then sandwiched together and can be connected to an external circuit.
This cell has yet to be perfected and there is room for
improving its efficiency and effectiveness.
Objectives
In our world today, we are facing many environmental issues. Dye sensitized solar cells are promising because they are made from low-cost materials
and do not require elaborate apparatus to manufacture[5]. They are also significantly cheaper than older
solid-state cell designs. The objectives of this study
are two-fold: (i) to compare the effect of different natural organic dyes on the efficiency of the fabricated
TiO2 solar cells; and (ii) to design better external accessories to increase light intensity.
Procedure
To create this type of solar cell, a uniform layer of
titanium dioxide was coated on tin dioxide conductive
glass. Titanium dioxide was commercially bought in
its best photocatalyst form as P-25. P-25 powder (2g)
was mixed together with acetic acid solution (3mL)
and a surfactant (TitronX100) into a paint-like substance. Conductive glass was taped down and a thin
uniform layer of the mixture was applied to it. The
coated glass was then heated for half an hour at 450ºC
in an oven. After the TiO2 coated glass cooled, it was
submerged in a fruit dye until the white TiO2 changed
colour. The dyes used were all extracted directly from
different fruits including raspberry, blackberry, orange
and grape. A carbon thin film was formed on another
piece of conductive glass by burning it over a candle
to create a uniform layer of soot. The two pieces of
conductive glass were then sandwiched together and
held in place with two binder clips. A few drops of
iodide solution (KI3) were added at the edges of the
glass and distributed evenly over the rest of the cell.
The cell was then added to an external circuit and
tested under sunlight.
Four similar solar cells were constructed, each
with a different organic dye. These cells were then
connected to a multimeter so the voltage and the
current of the cell could be measured. They were all
tested under the same conditions: first indoors in a
controlled environment under a light bulb, and then
outside under the sun to compare real world situations. To ensure there were minimal experimental errors, all constants considered were enforced.
Results and Discussion
A scanning electron microscope (SEM) and an energy dispersive x-ray spectroscopy (EDX) were employed to study the conductive glass coated with TiO2
nanoparticles. As shown in Figure 1, the fabricated
surface has a porous structure which is beneficial for
light absorption.
Figure 2 presents the energy dispersive x-ray
spectrum, revealing the surface is composed of titanium, oxygen and tin. The tin element is derived from
the conductive glass substrate, whereas the titanium
element originates from the TiO2 photocatalyst.
The performance of the fabricated solar cells was
first tested under a controlled environment using a
65 watt light bulb. Figure 3 shows the number of volts
and amps produced by each cell. It can be seen that
the cells dyed with raspberry and blackberry have
significantly higher current produced. This is consistent with our observations throughout the experiments. The colour change of the TiO2 thin film was
more noticeable when stained with the raspberry and
blackberry dyes compared to the orange and grape
dyes.
The experiment was then performed outdoors with
the sun as the light source to observe real life scenarios. Figure 4 presents the current and voltage produced by each cell under the illumination of sunlight.
Interestingly, all the voltages are maxed out to about
0.5 volts, which is the maximum potential of the solar
cell. In contrast, the trend of the current produced is
consistent with Figure 3, but with a much higher value. This demonstrates that the raspberry dye had the
best performance among the four dyes used in this
study. The overall power produced by the solar cells
under the sun was far greater than with the light bulb.
Figure 1. Scanning Electron Microscopic image of
titanium dioxide film coated on the conductive glass.
Figure 2. Energy Dispersive X-ray Spectrum of the
titanium dioxide film coated on the conductive glass.
Figure 3. Current and Voltage produced by each solar cell under the illumination of a 65 watt light bulb.
9
Figure 4. Current and Voltage produced by each cell
under sunlight.
In order to understand why the raspberry dye
functioned better than others, ultraviolet visible spectroscopy was used to study the light absorption of
the dyes. As shown in Figure 5, the raspberry and
blackberry dyes responded to a greater visible light
absorption at around 500 nm. The grape and the orange, on the other hand, displayed no notable peaks
in the visible light region. The level of light absorption
each dye processed is very similar to the amount of
current the solar cell produced. Therefore, the current each solar cell produced is dependent on the
absorption its dye processed. The raspberry dye exposed the solar cell to a wider range of visible light,
allowing a higher amount of light absorption. This is
why the raspberry stained solar cell produced the
highest current.
The greatest power is achieved from the raspberry
dye which has the highest light absorption. To further
improve the efficiency of these solar cells, mirrors
can be added to intensify and concentrate the sunlight. Various optical devices were tried in this study
to enhance the light intensity. The simple design, as
shown in Figure 6, proved to be the most beneficial.
The optical device consisted of three mirrors which
could be easily angled and adjusted around the solar
cell to maximize the intensity of sunlight illuminated
on the solar cell.
The current and voltage of the solar cells with the
aid of the optical device were measured and presented in Figure 7. Again, the volts produced were all
similar in value because the solar cell cannot surpass
its maximum voltage. The current also followed the
same trend as seen in Figure 3 but with much higher
values. Comparison of Figure 4 and Figure 7 shows
10
Figure 5. Ultraviolet-visible Spectra of the four fruit
dyes.
Figure 6. Optical device used to enhance and intensify the sunlight on the surface of the solar cell.
that the optical device increased the current threefold. It concentrated the solar rays resulting in a
higher intensity on the surface of the solar cells,
thus allowing more light absorption. A simple
engineering approach as illustrated in Figure 6 demonstrates the significant improvement of the solar cell
efficiency.
The power in watts for each solar cell was calculated by multiplying the current by the voltage. Figure
8 compares the power produced by the solar cells
with and without the aid of the optical device. It can
be seen that when the optical device was used, the
power increased substantially (approximately threefold).
Conclusion and Future Work
In summary, four TiO2 based solar cells were
fabricated with different natural dyes, extracted
from raspberry, blackberry, orange and grape. Their
Figure 7. Current and Voltage produced by each cell
under the sun with the aid of the optical device.
adding an optical device which intensifies the sunlight illumination.
In the future, to further improve the efficiency of the
TiO2 based solar cells, the core of the titanium dioxide can be modified to enhance light absorption. Pure
titanium dioxide has virtually no response to visible
light and is only affected by a small proportion of UV
light in sunlight. It has been reported that doping TiO2
with nitrogen can lower the energy band gap, thus
improving its visible response[6]. It would be interesting to test solar cells fabricated with nitrogen doped
TiO2 nanoparticles. Dye sensitized titanium dioxide
solar cells are a clean, renewable energy source that
will benefit the future of mankind. The possibilities of
creating a cleaner and environmentally friendly future
are endless.
Acknowledgements
I would like to thank Dr. Guosheng Wu for his help
in teaching me how to take scanning electron microscopic images of the surface of the solar cell. I would
also like to thank Lakehead University for allowing
me to use their facilities.
Keywords
Photo-electrochemistry, Nanoparticles, Photocatalyst, Semi-conductor, Doping
References
Figure 8. Power produced by each cell under the
sun, with and without the aid of the optical device.
performance was tested under both indoor and outdoor environments. This study has shown that the
solar cells became more efficient and effective when
enhanced with better light absorption materials. It
has also shown that the raspberry dye had the best
light absorption which produced the most power.
Furthermore, this study has shown that the efficiency
of the solar cells can be significantly enhanced by
[1] Fanis, Linda. “Nanocrystalline Solar Cell Kit – Recreating Photosynthesis” Wisconsin, ICE, The Institute for Chemical Education Publication (2008)
[2] Jefferis, David. “Science Frontiers – Green power – Eco-energy without pollution” New York, Crabtree (2006)
[3] Naff, Clay Farris. “Fuelling the Future – Solar Power” New
York, Green Haven Press (2007)
[4] Saunders, Nigel; Chapman, Steven. “Energy Essentials – Renewable Energy” Chicago, IL, Raintree (2006)
[5] Susan, Jones. “Solar Power of the Future: New Ways of Turning Sunlight into Energy” New York, Rosen Publisher Group
(2003)
[6] Asahi R, Morikawa T, Ohwaki T, Aoki K, Taga Y. “Visible-light
photocatalysis in nitrogen-doped titanium oxides”, Science
293 (2001): 269-271
11
Review of Design and Study of Dye Sensitized
Titanium Dioxide Solar Cells
This is a good paper which starts with an appropriate review of the basics of DSSC. The project examines
the effect of different dyes (taken from fruits) on the efficiency of the cell. The project is a good illustration of
the main parameters in solar cells.
Some changes and clarifications are needed as follows:
1. The SEM image is not numbered, and it should be specified whether it was taken from one of the author’s
samples or from literature.
2. In the result and discussions, the author shows very well the trends and discusses the differences due to
dyes. However, some parts are incorrect: for example, page 4, line 4; “The raspberry dye stained the TiO2
and exposed it ...”. The dye does not expose the TiO2 to sunlight, the dye “absorbs” over a greater range
and passes the electron to the circuit. The same is true for page 5, third line of the Conclusions section.
3. The author notes correctly that under sun illumination, with or without mirrors, the Voltage is constant, having reached saturation. This is not true for exposure to the bulb light. In fact, the different spectrum absorption of the dyes can explain this phenomenon. A comment in this sense would have been useful for the
general reader.
Overall, a very good paper.
Franco Gaspari, Ph.D., Assistant Professor, UOIT, Faculty of Science
12
Samantha Wong NUTRITION AND STRESS
Nutrition and Stress
Samantha Wong
Grade 12, Pretty River Academy, Collingwood, Ontario
Samantha Wong is a curious person by nature and with that the
passion for science and search
for knowledge comes naturally.
Though she believes that her
older brother is the “researcher”
in the family, she has obviously
inherited some of those “researcher genes”. To Wong, the
most appealing aspect of science and research is its influence on the general public. Specifically, her research on proper
nutrition is largely relevant today
because it’s a constant topic of
discussion and observation. It
affects everyone from individuals to the world. The goal of her
research is to dispel the numerous misconceptions about health
and to educate people on the importance of proper nutrition and
how it affects them in their daily
lives.
As healthy nutrition declines in our society, public awareness
must increase in relation to the benefits of proper nutrition and
its effects on stress. It was hypothesized that nutrition has a
strong influence on the level of stress an individual experiences. If such an important topic is ignored, the public’s general
health could be negatively affected. After studying current research conducted by universities and sourced through nutritional books/guides, the validity of this hypothesis was determined.
Given the support by current studies, an experiment using individuals aged 14-18 was conducted on two distinct groups.
Both competitive and non-competitive swimmers were documented for nutrition and analyzed using an online food journal,
to detect any nutrient deficiencies. Vital stress indicators, such
as blood pressure, heart rate and body temperature were also
recorded and analyzed at two separate times (on an undisclosed day and after the survey was completed). With the two
separate vital readings, the individuals’ average vital measurements along with a survey indicating stress levels were compared to their recorded nutrition.
There was a correlation between nutrition and stress within
the sample studied. However, the correlation was not strong
enough to consider blood pressure and stress surveys accurate measurements of stress.
Avec le déclin de la nutrition dans notre société, la sensibilisation du public au sujet des avantages
d’une bonne nutrition et ses effets sur le stress, doit augmenter. On a émis une hypothèse que la nutrition a une grande influence sur le niveau de stress qu’on ressent. Si les gens ignorent ce sujet important, leur état de santé pourrait être affecté négativement. Après avoir étudié des nouvelles recherches
faites par des universités avec des livres sur la nutrition et des guides alimentaires, la validité de cette
hypothèse était vérifiée.
Avec le support des études en cours, une expérience était faite avec deux groupes différents composés
de personnes qui avaient 14 ans jusqu’à 18 ans. Des nageurs de compétition et des nageurs non-concurrence étaient étudié au sujet de la nutrition et ils étaient analysés avec un journal alimentaire en ligne
pour détecter les carences en éléments nutritifs. Des indicateurs de stress comme la pression sanguine,
le rythme cardiaque, et la température du corps étaient enregistrés et analysés à deux moments différents. Avec les deux analyses différentes, la moyenne des mesures essentielles de chaque personne,
accompagnée d’un sondage indiquant les niveaux de stress était comparés à leur nutrition enregistrée.
13
Une corrélation était trouvée entre la nutrition et le stress parmi les gens qui étaient étudiés. Cependant, cette corrélation n’était pas assez forte pour considérer la pression sanguine et les sondages de
stress comme des mesures précises de stress.
Background
In the current state of the world, lack of job offers, family obligations, and time restrictions, it is rare
to find an individual who is devoid of stress[1]. Stress
is an inevitable, and unavoidable aspect of life for
many people. It can be defined as a reaction to a
“physical, mental or emotional stimulus that upsets
the body’s natural balance”[2]. In scientific nutritional
studies conducted by universities and independent
nutritional professionals (dietitians), it has been deduced that proper nutrition plays a vital role in moderating both mental and physical stress levels. Using recent studies, an experiment comparing stress
and nutrition levels of competitive swimmers to that
of non-competitive swimmers was designed. Vital
stress indicators (blood pressure, heart rate and
body temperature) were measured to provide a nonsubjective measure of stress[2,4]. Using this juxtaposition, a correlation between both nutrition and stress
was researched.
Purpose
The purpose of this experiment was to compile data
and determine whether nutrition and stress can be
correlated between competitive swimmers and noncompetitive swimmers ranging in age from 14 to 18.
pressure, heart rate and temperature) were recorded
on an undisclosed day. Participants were required to
keep a food journal and complete a survey to determine their perceived stress levels. Stress indicators
were measured a second time. Food journals were
input on EATracker to calculate nutrition (vitamins,
minerals, caloric intake, etc.). Data gathered was recorded and analyzed. The lab report was then revised.
Results and Observations
Graph 1. This graph compares the average caloric
intake of competitive and non-competitive swimmers.
(F-female, M-male, CS-competitive swimmer, NCSnon-competitive swimmer).
Hypothesis
Since nutrition and stress are related, it was conjectured that an improper diet will directly result in a
higher level of stress in individuals. It was speculated
that the sample of competitive swimmers would experience a lower level of stress and lower vital indicators, as a result of the emphasis on healthy diets and
regular exercise for peak performance.
Procedure
After legal consent was obtained from parents/
guardians, 22 participants ranging in age from 14
to 18 were selected. Two groups of six females and
five males were randomly chosen from The Collingwood Clippers Swim Club to represent competitive
swimmers and Pretty River Academy to represent
non-competitive swimmers. Stress indicators (blood
14
Graph 2. This graph shows the average daily percentage intake of stress-linked nutrients (as well as
sodium) in both competitive and non-competitive
swimmers.
Graph 3. This graph shows the daily percentage intake of the three macronutrients (protein, fat and carbohydrates) in both competitive and non-competitive
swimmers.
Graph 4. This graph shows the frequency of systolic
pressure in both competitive and non-competitive
swimmers at rest.
Graph 5. This graph shows the frequency of diastolic
pressure in both competitive and non-competitive
swimmers at rest.
Conclusion
Using the Internet and nutritional books, research
was gathered that emphasizes the importance of
nutrition, and its affect on the body. From the tables
extracted from the nutritional study, Food consumption frequency and perceived stress and depressive
symptoms among students in three European countries [16], it was evident that products from the five
food groups result in a lower perceived stress score.
Through another source, a multitude of vitamins and
minerals were recognized as “stress reducing” [3,17].
An experiment was designed to support the studies previously reviewed. In most cases, an individual
with an overall nutrition score of 50% or less of the
stress-linked nutrients calculated using EATracker
experienced high or moderate levels of stress. With
an overall score of 60% or higher, the individual experienced low or moderate symptoms based on the
stress survey.
In all areas, vital statistics were found to be higher
in competitive swimmers. Total consumption (caloric
intake), food consumed (food groups) and daily fitness could be the cause of this result. Temperature
and heart rate remained constant and normal in both
competitive and non-competitive swimmers; therefore, it was not used in stress measurements. Many
of the non-competitive swimmers did not consume
the minimum requirement of calories or nutrients,
which resulted in lower vital measurements and supported the fact that without proper nutrition, the human body does not function at an optimal level, and
this puts stress on the body.
Female athletes did not have as healthy a nutrition score as the male athletes studied. Portions and
overall quantity of food were not controlled during
evaluation, which could have aided in the males’ more
ideal nutrition levels. In this sample, there were four
participants who scored low on the stress survey, and
the remaining subjects scored moderate. The low
scores of competitive swimmers was expected due
to their increased activity and higher consumption of
the recommended daily intake of all three macronutrients: fat, carbohydrates and protein. The same individuals also had lower blood pressures.
Nutrition levels in the non-competitive swimmers
were not as diverse as that of the competitive swimmers. In this category, gender did not play a role in
the level of nutrition or quantity of food consumed
over a 24 hour period. The stress surveys of the noncompetitive swimmers provided a range of measurements. There were three individuals who scored
15
Denmark
Food Groupa
Poland
Belgium
Female
N= 394
Male
N= 302
Female
N= 351
Male
N= 138
Female
N= 449
Male
N= 205
Mean (SD)
Mean (SD)
Mean (SD)
Mean (SD)
Mean (SD)
Mean (SD)
Sweets
3.3 (1.0)
3.0 (1.0)
3.1 (0.9)
3.1 (0.8)
3.6 (0.9)
3.4 (0.9)
Cakes/cookies
2.3 (0.6)
2.2 (0.6)
2.8 (0.8)
2.7 (0.8)
3.1 (0.9)
3.0 (0.9)
Snacks
2.1 (0.7)
2.3 (0.7)
2.1 (0.8)
2.2 (0.9)
2.8 (0.9)
2.7 (0.8)
Fast Food
2.2 (0.6)
2.4 (0.6)
1.8 (0.7)
2.0 (0.8)
3.1 (1.0)
3.5 (0.9)
Fresh Fruits
3.5 (0.9)
3.2 (0.9)
3.3 (0.9)
3.0 (0.9)
3.6 (0.9)
3.3 (0.8)
Salad
3.3 (0.8)
3.1 (0.8)
3.1 (0.9)
3.0 (0.8)
3.7 (0.9)
3.4 (0.8)
Cooked Vegetables
3.1 (0.8)
3.0 (0.8)
2.7 (0.9)
2.6 (0.9)
3.0 (0.9)
3.1 (0.9)
Soft Drinks
2.5 (1.1)
2.9 (1.0)
2.9 (1.1)
3.1 (0.9)
2.9 (1.2)
3.3 (1.1)
Meat
3.0 (1.0)
3.6 (0.9)
3.3 (0.9)
3.6 (0.9)
3.1 (1.0)
3.7 (0.9)
Fish
2.0 ( 0.7)
2.2 (0.8)
2.2 (0.7)
2.3 (0.7)
2.3 (0.7)
2.5 (0.8)
Milk Products
3.9 (0.9)
3.9 (0.9)
3.2 (1.0)
3.2 (1.0)
3.8 (0.8)
3.7 (0.9)
Cereal/cereal products
3.9 (0.9)
3.6 (1.1)
3.5 (1.1)
3.5 (1.1)
3.5 (1.1)
3.8 (1.1)
M-BDI b
28.1 (15.6)
25.2 (14.7)
33.6 (18.4)
27.6 (15.2)
33.6 (15.4)
29.9 (13.6)
PSS
25.2 (8.1)
22.9 (8.0)
29.3 (7.5)
25.0 (6.9)
26.5 (7.5)
23.8 (7.3)
Mental health Indicators
c
Table 1. Food consumption and mental health indicators by country and gender.
a
Mean of the consumption frequency scale from 1 = never to 5 = several times per day. b Mean Modified Beck Depression Index, higher
scores indicate stronger depressive symptoms. c Mean Perceived Stress Scale by Cohen, higher scores indicate higher perceived stress.
Rafael T Mikolajczyk1, Walid El Ansari and Annette E Maxwell Nutrition Journal 2009 8:31 doi:10.1186/1475-2891-8-31
Perceived Stress score (PSS)
Female
Male
Depressive Symptoms score (M-BDI)
Female
Male
Food Group
P-value
Estimate* P-value
Estimate* P-value
Estimate* P-value
Estimate*
Sweets
0.04
0.54
-0.31
0.59
-1.11
0.37
0.27
0.10
Cookies
0.13
0.48
0.46
-0.30
0.79
0.17
0.27
-0.89
Snacks
0.04
0.66
0.92
0.04
0.33
0.62
0.34
-0.76
Fast Food
0.07
0.55
0.04
0.84
0.57
0.34
0.02
1.85
Fruits
<0.001
-1.17
0.37
-0.32
0.002
-1.69
0.53
-0.45
Salads
<0.001
-1.21
0.23
-0.48
<0.001
-2.55
0.25
-0.88
Vegetables
0.003
-0.82
0.97
-0.01
0.003
-1.62
0.29
0.77
Soft Drinks
0.52
-0.14
0.60
0.17
0.05
-0.90
0.55
-0.36
Meat
0.03
-0.52
0.80
0.09
0.003
-1.47
0.24
-0.78
Fish
<0.001
-1.32
0.75
-0.13
0.02
-1.60
0.90
0.10
Milk Products
0.009
-0.72
0.34
-0.34
0.06
-1.07
0.08
-1.18
Cereal Products
0.17
-0.33
0.17
-0.41
0.17
-0.67
0.07
-1.02
Table 2. Associations between food consumption and perceived stress and depressive symptoms (each food
group adjusted solely for country, separate models for males and females and for both mental health indicators).
* Change in the corresponding score (PSS or M-BDI) per one unit of the food group frequency scale.
Mikolajczyk et al. Nutrition Journal 2009 8:31 doi:10.1186/1475-2891-8-31
16
Perceived Stress score (PSS)
Female
Female
Male
Estimate* P-value
Estimate* P-value
Estimate* P-value
Estimate*
Sweets/Cookies/ 0.03
Snacks/Fast food**
0.72
0.29
-0.46
0.15
0.96
0.30
-0.89
Fruits/Vegetables+ <0.01
-1.17
0.43
-0.40
<0.01
-2.37
0.94
-0.07
Soft Drinks
0.83
-0.05
0.23
0.40
0.16
-0.64
0.64
0.29
Meat
0.11
-0.40
0.91
0.04
0.01
-1.38
0.34
-0.66
Fish
0.06
-0.69
0.83
-0.09
0.95
-0.05
0.71
0.31
Milk Products
0.12
-0.44
0.49
-0.26
0.23
-0.72
0.22
-0.87
Cereal Products
0.99
0.00
0.38
-0.28
0.61
-0.26
0.17
-0.79
Food Group or
Scale
P-value
Male
Depressive Symptoms score (M-BDI)
Table 3. Associations between food consumption and perceived stress and depressive symptoms (multivariable analysis adjusted for country and for all other variables in the table, separate models for males and females and for both mental health indicators).
* Change in the corresponding score (PSS or M-BDI) per one unit of the food group frequency scale
** Sweets/cookies/Snacks/Fast food subscale: mean of four items (sweets, cakes/cookies, snacks, fast food)
+
Fruits/Vegetables subscale: mean of three items (fresh fruits, salads, cooked vegetables)
Mikolajczyk et al. Nutrition Journal 2009 8:31 doi:10.1186/1475-2891-8-31
Vitamin/Mineral
Functions in the body
Which foods contain the vitamin/mineral
Vitamin A
- FS
• Antioxidant
• Immune system support
• Growth and tissue healing
Carrots, parsley, spinach, broccoli
Vitamin B1 (Thiamin)
- WS
• Vital for nerve function
Wheat, rice, oats
Vitamin B2
(Riboflavin)
-WS
• Aids in cell respiration
• Promotes normal cell growth
• Recycles glutathione (antioxidant)
Organ meats, milk products
Vitamin B3
(Niacin)
-WS
• More than 50 metabolic functions
• Formation of red blood cells
• Stimulates circulation
Meat, fish, peanuts
Vitamin B5
(Pantothenic acid)
-WS
• Controls the adrenal glands; which Yeast, liver, eggs, fish, chicken
play a part in stress response
• Protects against most physical and
mental stresses
• The “antistress vitamin”
Vitamin B6
(Pyridoxine)
-WS
• Essential for the production of sero- Yeast, sunflower seeds, wheat germ,
tonin (mood enhancing brain chemical) soya beans
• Activates many enzymatic processes
• Involved in many metabolic processes
Vitamin B12
(Cobalamin)
-WS
• Responsible for the health of the en- Beef, eggs, cheese, chicken, milk
tire nervous system
• The “energy vitamin”
Vitamin C
(Absorbic acid)
-WS
• Involved in the functions of all glands Lemon, lime, orange, papaya
and organs
17
Vitamin E
- FS
•
•
•
•
Antioxidant
Eggs, butter, raw or sprouted seeds,
Stabilize blood fats
grains
Protects body from free radicals
Anticlotting properties (protects cells
from oxidative damage)
Calcium
•
•
•
•
•
Development of bones and teeth
Milk, milk products, green vegetables
Vital for normal heart and all muscle activity
Speeds all healing processes
Nerve transmission
Immune function
Choline
• Prevents accumulation of fat in the liver Egg yolk, wheat germ, nuts
Chronium
• Increases effectiveness of insulin
• Prevention of high blood pressure
Magnesium
•
•
•
•
Potassium
• Regulates water balance and acid- Bananas, potato, squash
base balance in the blood and tissues
• Regulates blood pressure
Selenium
• Antioxidant
• Protects cell membranes
Wheat germ, barley, whole wheat bread
Zinc
• Supports immune function
• Promotes normal insulin activity
• Anti inflammatory
Cereals, nuts, oilseeds
Keeps nerves relaxed
Promotes relaxation in muscles
Natural tranquilizer
“Antistress mineral”
Betel leaves, arecanut, nuts
Green vegetables, nuts, soya beans,
apples
Table 4. Vitamins and minerals that aid in reducing stress levels.
Haas, 2006
*FS- Fat soluble, WS- water-soluble
External
•
•
•
•
•
•
•
•
•
•
•
•
•
Pollution
Hydrogenated fats
Smoking
Drinking alcohol
Excessive exposure
to the sun
Heavy workload
Emotional problems
Bereavement
Divorce/separation
Demands of the
workplace
New acquaintances
Financial state
Weather/climate
Internal
Physical indicators
Behavioural indicators
• Food allergies and
intolerances
• Auto immune disease
• Metabolic waste
• High cholesterol
• Blood sugar imbalances
• Diabetes
• Hormonal imbalances
• Nutrient deficiencies
• Depression caused
from a chemical imbalance
• Attitude towards self
• Emotional challenges
• Illnesses
• Immune system suppressio (recurring colds
and flu)
• Weight loss
• Skin irritation
•
•
•
•
•
•
Table 5. External and Internal stressors.
The Food Doctor – Vicki Edgson Dip ION & Ian Marber Dip ION
Staying Healthy with Nutrition – Elson M. Haas, MD with Buck Levin, PhD, RD
18
Food cravings
Constant fatigue
Loss of appetite
Mood swings
Depression
Anxiety
Table 6. Stress symptoms.
The Food Doctor – Vicki Edgson Dip ION & Ian Marber Dip ION
high on the stress scale, and one individual scored
low. The remainder of the participants scored moderate stress levels, which was the expected response.
Participants who scored high on the survey also had
lower caloric intakes and therefore insufficient vitamin and mineral intake. This then led to lower vital
measures, due to lack of nutrition.
In both categories, there were individuals who exhibited stress levels higher than their nutrition would
suggest. In some cases, the minimum daily percentage intake of the three macronutrients was not
met; these occurrences could lead to an increase
in blood pressure and stress on the body’s system. A deficiency in any of the three macronutrients
can lead to the production of the “stress hormone”
called cortisol[10]. The sample of competitive swimmers should have had more protein than suggested by EATracker as athletes generally
require more protein to replenish their muscles.
Non-competitive swimmers/athletes should at least
meet the recommended dose, although it is not
necessary for performance. In both cases, failure to meet minimum requirements adds stress to
the body[3,14].
Sodium intake also played a major role in the
measures of stress. Through research, it became
evident that individuals respond to salt intake
differently (sensitivity to sodium resulting in higher
blood pressure). Potassium levels have been known
to counter the negative affects sodium has on the
body. With smaller sodium to potassium ratios, blood
pressure can be controlled. In some cases, this
ratio did not have an affect on the level of blood
pressure[15].
Although there is a correlation between nutrition and stress (determined by blood pressure and
a stress survey), it is not substantial enough to
support blood pressure as an indicator of stress.
Nor is the survey an accurate measure, due to
the fact that surveys, as a whole, are subjective. With more testing, a greater understanding of
the variables tested, and a longer testing period, a
stronger, more concrete correlation could be revealed.
Acknowledgements
Thank you to my mother, Karen Wong, for her
support and patience. Thank you to Alicia Marshall,
BASc, R.D, who donated her time to help me find a
method to determine nutrient deficiencies. Also, thank
you to Dr. Brian Marshall, for discussing with me the
variables in my experiment. Thank you to my teachers, Ms. Kawamura, Mrs. Isbister and Ms. Homes
for their support and direction during my high school
experience. Finally, thank you to Tamberly BlackMcCarl (Park Signs, Digital Imaging) for printing
my display.
References
[1] Balch J.F. and Balch P.A., 1990, Prescription for Nutritional
Healing, Avery Publishing Group, Garden City Park, New York,
pp.1-600
[2] Edgson V. and Marber I., 1999, The Food Doctor: Healing
foods for mind and body, Sterling Publishing Co., United States
and Canada, pp.1-160.
[3] Haas E.M., 2006, Staying Healthy with Nutrition: The complete
guide to diet and nutritional medicine, Ten Speed Press, an
imprint of the Crown Publishing Group, a division of Random
House, Inc., New York, pp. 1-927.
[4] Brewer. S, Dr., 2008, overcoming high blood pressure: the
complete complementary health program, Duncan Baird Publishers, London, pp.6-175.
[5] Ministry of Health, Ontario: What you need to know about Vitamin A, 2010. Retrieved February 3, 2010 from http://www.
eatrightontario.ca/en/ViewDocument.aspx?id=294
[6] Vorvick L., Zieve D., 1997-2010, Medicine Plus: Vitamin E. Retrieved February 3, 2010 from http://www.nlm.nih.gov/medlineplus/ency/article/002406.htm
[7] Vegetarian Society: Zinc. Retrieved February 3, 2010 from
http://www.vegsoc.org/info/zinc.html
[8] Ministry of Health, Ontario: The Scoop On Selenium, 2010.
Retrieved February 3, 2010 from http://www.eatrightontario.
ca/en/ViewDocument.aspx?id=293
[9] Ministry of Health, Ontario: Magnificent Magnesium, 2010. Retrieved February 3 2010 from http://www.eatrightontario.ca/en/
viewdocument.aspx?id=67
[10]Scott E., 2007, About.com: Stress Management. Stress and
Nutrition: The Link between Stress and Nutrition Deficiencies.
Retrieved February 3, 2010 from http://stress.about.com/od/
dietandsuppliments/a/stressnutrition.htm
[11]Larson D.E, M.D, 1990, MAYO CLINIC: Family Health Book,
William Morrow and Company, Inc., New York, 1378 p.
[12]G. Blair, 2005, What’s behind runner’s high? Is it endorphins,
adrenaline or simple a sense of accomplishment? Here ,we explain the chemical link between exercise and good mood, Bnet:
CBS Business Network. Retrieved April 26, 2010 from http://
findarticles.com/p/articles/mi_m0846/is_6_24/ai_n9481984/
[13]Peptide Guide, 2007-2010, Amino Acids. Retrieved April 26,
2010 from http://www.peptideguide.com/amino-acids/index.
html
[14]L. K. Caffery, How Much Protein Do Athletes Need?, Vanderbilt
University. Retrieved April 25, 2010 from http://www.vanderbilt.
edu/ans/psychology/health_psychology/Protein.htm
[15]Sohn E., 2009, Los Angeles Times: Study: Sodium-to-potassium ratio a key to heart health. Retrieved April 28, 2010 from
http://articles.latimes.com/2009/feb/23/health/he-sodium23
[16]Mikolajczyk R.T., Ansari W.E. and Maxwell A.E., 2009. Food
consumption frequency and perceived stress and depressive
symptoms among students in three European countries. Nutrition Journal, 8:31. Retrieved February 2, 2010 from http://
www.nutritionj.com/content/8/1/31
[17]Vitamin Diary.com, Vitamins that Help Reduce Stress. Retrieved February 2, 2010 from http://www.vitaminsdiary.com/
relieve-symptoms/stress.htm
[18]Dietitians of Canada, EATracker.ca, 1997-2010. Retrieved
April 7, 2010 from http://www.dietitians.ca/public/content/eat_
well_live_well/english/eatracker/
19
Review of Nutrition and Stress
This study’s main goal was to determine the influence nutrition has on an individual’s stress. An experiment
was designed using 2 groups: competitive swimmers and non-competitive swimmers. Nutrition was recorded
using a food journal and analyzed as were some vital statistics including blood pressure, heart rate, and body
temperature. It was hypothesized that good nutrition would result in lower stress levels and a higher vital
score. Although the study didn’t find a significant difference between the two groups (P values not given), there
seemed to be some interesting results found that showed some promise that a connection between nutrition
and stress may be established in the future. In the final paragraph of the discussion section some biases in
the study were discussed. I was glad to see this as it demonstrated to me that the researcher had a good
understanding of the topic and the study and how to improve her research in the future.
The abstract and background sections were well written. The hypothesis seemed to be a bit confused. The
hypothesis stated that “an improper diet will directly result in a higher level of stress in individuals” but, at the
end of the paragraph a new variable exercise was included in the hypothesis. Since you were not measuring
exercise and its effects on stress in this experiment, it should have been left out of this section and instead
maybe mentioned as a source of experimental bias. The Procedure section was poorly written. I was impressed with the use of EATracker to analyze the food journal so that nutritional levels could be determined.
There was a lot of information left out or not expanded on enough here though including: the difference between competitive swimmers and non-competitive swimmers (training differences, diet plans?), expanding on
how the food journal was recorded (how many days?), who took the vital statistics ( especially blood pressure),
how long apart were vital statistics taken? How was body temperature recorded? How were the vital scores
that made up positive or negative scores determined? Some of the vital statistics measured were vague considering the age group of the studies participants, 14-18 years old. Finding more specific variables may have
helped the study find a connection between stress and nutrition. For the most part, 14 to 18 year old teens
do not have many problems with their heart rates and/or blood pressures at resting levels. The result section
was missing text to describe the figures. Also a figure or table on stress levels between competitive and non
competitive swimmers should have been included. The discussion section needs to be re-organized. There
was a lot of good information found in the discussion section. I particularly enjoyed your beginning to expand
on the nutrition, cortisol and stress relationship. The problem was that first, there was no flow between the
paragraphs of the discussion section and what was presented in the result section. References to the results
section were completely missing and many of the study’s findings that were discussed were never presented
in the result section. I found that the paper got a bit confused in this section with information that belonged in
the procedure and results sections being found here. Also, the purpose of the experiment became a bit lost
when reading the discussions. The paper should be re-edited for body text errors. Finally, the paper was well
documented but in the future try to use more primary sources.
Although the study found no significant correlation between nutrition and stress in competitive and noncompetitive swimmers, the researcher’s chosen topic is an extremely important issue. This is an ever growing
topic discussed between many holistic professionals, naturopathic doctors, doctors and fitness professionals.
Because of young researchers like you, one day we will be able to save and change many lives. Don’t be discouraged with your results - use this experiment as a platform to grow from and aid you in your research.
Ryan Herszkowicz, HBSc, MHSc
20
Adelina Corina Cozma SLOW IT DOWN TO SPEED IT UP: BREAKING THROUGH THE WINDOW OF AUTISM
Slow It Down to Speed It Up: Breaking Through
the Window of Autism
Adelina Corina Cozma
Grade 10, Bayview Secondary School, Richmond Hill, Ontario
Adelina Cozma’s interest in neuropsychology began from her observations of the diverse personalities, cultural experiences, and
values of the people around her.
Growing up, she had early experiences with autistic children in elementary school and as a result
she’s chosen to do research on
autism. The primary focus of the
research is to discover methods
that will improve student learning
habits and behaviour as well as
overall mental and emotional wellbeing. Her constant attraction to
the topic of autism and the motivation behind her research lies in
the uniqueness of individuals with
autism and the possibility that, by
developing and implementing effective strategies, individuals with
autism may reach their full potential. She strongly believes that the
future of autism research lies in
finding these strategies that will
use the strengths that autistic
individuals already possess and
developing these strengths to improve their weaknesses.
Through her continued research
and dedication in coming up with
solutions to current problems
Cozma aims to make a difference
in the world and contribute to society. Also, by conducting research
and applying science, she hopes
to inspire and encourage people
Recent magnetoencephalographic studies suggest that auditory processing deficits are key in the communication and socialization problems observed in autism. The present research
investigates whether artificially modified speech, using the latest digital audio-video technology, can improve the temporal
processing deficit that occurs in autistic children. Thirteen highfunctioning autistic children and thirteen age-matched controls
completed emotional and non-emotional auditory processing
tasks incorporated in three innovatively developed software
program games. The accuracy and response times of the two
groups were compared when consonant-vowel syllable pairs
were slowed down or sped up.
Time-stretching of syllables improved processing of auditory
information in all participants, especially in the autistic volunteers. The autistic children demonstrated a left ear preference
and right brain hemispheric lateralization tendency for nonemotional auditory processing, which is a reversed ear preference and hemispheric dominance in comparison with the
controls. Both groups processed emotional approach-related
stimuli better than withdrawal-related stimuli. This finding indicates a left brain lateralization tendency for emotional auditory
processing in both autistic and typically developing children.
Establishing each subject’s optimal artificially time-stretched
speech rate of auditory processing led to the development of
an innovative educational system, personalized for each individual’s specific needs, based on a world-class real-time and
file-based media encoding system. Time-stretching technology can not only improve the lives of people with autism and
other learning disabilities, but also those of typically developing individuals and foreign language learners.
De récentes études suggèrent que les déficits magnétoencéphalographiques traitement des informations auditives sont
la clé dans la socialisation et les problèmes de communication observés dans l’autisme. La présente étude cherche à
déterminer si artificiellement modifié la parole, en utilisant la
21
to help others, so that they may
encourage and inspire others in
their turn.
dernière technologie audio-vidéo numérique, peut améliorer
le déficit de traitement temporel qui se produit chez les enfants autistes. Treize haute fonctionnement des enfants autistes et treize témoins de même âge complété émotionnelles
et non-émotionnelle des tâches de traitement auditif incorporé
dans trois innovante développé des jeux logiciel. Le temps de réponse et la précision des deux groupes
ont été comparés lors de voyelle-consonne syllabe paires ont été ralentis ou accélérés. Time-stretching
de syllabes amélioration du traitement des informations auditives chez tous les participants, en particulier
chez les volontaires autistes. Les enfants autistes ont démontré une préférence oreille gauche et à droite
tendance latéralisation cérébrale hémisphérique pour le traitement auditif non-émotionnel, qui est une
préférence oreille inversée et dominance hémisphérique en comparaison avec les contrôles. Les deux
groupes traités émotionnelle des stimuli liés à l’approche meilleure que les stimuli liés au sevrage. Ce
résultat indique une latéralisation du cerveau tendance de gauche pour le traitement auditif émotionnelle
dans les deux autistes et les enfants au développement. Établir sujet optimale chaque étiré discours
taux horaire artificiellement de traitement auditif conduit à l’élaboration d’un système éducatif innovant,
personnalisé pour les besoins spécifiques individuels chacune, basé sur un monde-classe en temps réel
et basé sur des fichiers système d’encodage des médias. Time-stretching technologie peut non seulement améliorer la vie des personnes atteintes d’autisme et autres troubles d’apprentissage, mais aussi
ceux des personnes généralement en développement et les apprenants de langue étrangère.
Background
For many years Autism Spectrum Disorder[1], which
falls into the broader category of Pervasive Developmental Disorders, was rare; however, since the early
1990s the rate of autism has increased exponentially worldwide from a prevalence of 1 in 2, 000 to
at least 1 in 500 people[2]. Autism is now recognized
as the most common neurological disorder affecting
children. Recent epidemiological studies show that
in Canada during the past decade there has been a
150% increase in the number of reported cases, resulting in the current prevalence of autism nationwide
of 1 in 200 people and 1 in 165 children[3].
One out of every 150 individuals in the United
States is diagnosed with autism, making it more common than paediatric cancer, diabetes and AIDS combined. The average cost of caring for one person with
autism over his or her lifetime is $3.2 million US[4].
Canada’s provinces/territories are cumulatively spending about $4.6 billion each year on autism services, and that cost is projected to double
by 2017, due to the growing population of those
affected[5]. The lifetime costs of assisting a person
with autism can be reduced if he/she receives
an early diagnosis and family support. The value
of autism research is that it can benefit autistic persons tremendously, because without effective treatments, this disease may continue as a severely
22
incapacitating lifelong disability, leading to a life of
dependency and/or institutional care. Recent magnetoencephalographic studies support the view that a deficit in auditory processing is
a key factor in autism[6], with implications for speech,
language, communication, behaviour and socialization. Furthermore, researchers state that problems
in auditory processing for autistic individuals do not
necessarily result from hearing deficits, but rather are
due to an inability of the brain receptive and cognitive powers to identify correctly the rapidly changing
components of speech[7]. Comparison between agematched autistic and typically developing children reveal delays in the autistic children’s brains of 50 ms
in processing sounds and 35 to 50 ms in detecting
a change in sound. In addition, these delays were
more pronounced in the mid-range of normal human
speech between 300 and 5000 Hz and in autistic
children with existing language impairments[8]. This
indicates that auditory processing is abnormal in autistic children, and may lead to a cascade of delays
and overload in further processing of sounds and
speech.
Purpose
The present research investigates the benefits
of artificially modifying speech using the latest digital audio-video technology to diagnose and improve
the temporal processing deficit that occurs in autistic children when phonemes are presented at various element durations. The aim of the experiment
was to examine and compare the performances of
age-matched typically developing children and highfunctioning autistic children on various auditory processing tasks incorporated in three innovatively developed software program games. Establishing each
subject’s optimal artificially time-stretched speech
rate of auditory processing led to the development
of an innovative educational system personalized
for each individual’s specific needs based on a
world-class real-time and file-based media encoding
system.
Hypothesis
Overarching goals: A. Behavioural hypothesis:
Autistic children will show processing deficits for both
emotional and non-emotional information. B. Neurocognitive hypothesis: The previously documented
differences in hemispheric specialization between
typically developing children and high-functioning
autistic children will be reflected in perceptual processing biases (left vs. right ear advantage) and in
processing of approach- versus withdrawal-related
emotions. (Approach-related emotions refer to anger
and happiness stimuli and withdrawal-related emotions refer to sadness-related stimuli).
1. Mono-Channel Auditory Processing – I hypothesized that slowing down phonemes electronically
by multiple fractions of a second without changing
the pitch increases the intelligibility of the consonant-vowel syllable pairs, leading to greater accuracy of responses and faster response rates in
all subjects, but especially in the high-functioning
autistic children.
I based my hypothesis on previous research which
showed that children with listening “windows” that
are slower than 25 ms long, as it is the case of
autistic children, tend to ignore speech or tune out
when they are spoken to[9].
2. Left vs. Right Ear Auditory Processing – I hypothesized that: (a) high-functioning autistic children
show a left ear preference and right brain lateralization tendency for auditory processing of nonemotional information, which is a reversed ear
preference and hemispheric dominance in comparison with typically developing children; (b) left
vs. right ear auditory processing is improved when
the consonant-vowel syllable pairs are presented
at a slower rate.
I based my hypothesis on research which reveals
that both the structure and function of the brain
areas involved in auditory processing are atypical
in individuals with autism in several ways[10]. Unusual hemispheric activation pattern for speech
sounds has been found: greater activation in the
right hemisphere among autistic individuals and in
the left hemisphere among disorder-free people[11].
It is suggested that verbal functions develop in the
right hemisphere of children with autism, as they
do not seem to show the characteristic right ear
preference of disorder-free children[12].
3. Emotional Prosodic Processing – I hypothesized
that: (a) typically developing children process the
emotional content embedded in consonant-vowel
syllable pairs better than high-functioning autistic
children, though all will benefit from time-stretching of the phonemes; (b) there is a correlation between brain lateralization tendency for processing
non-emotional information and emotional prosodic
processing. The typically developing children are
hypothesized to process approach-related content
(typically processed in the left hemisphere) better.
The autistic children are hypothesized to process
withdrawal-related content (typically processed in
the right hemisphere) better.
I based my hypotheses on studies which demonstrate that autistic children have difficulty interpreting rapid changes in pitch, rate and prosody[13],
and process emotions differently than others[14].
Procedure
Thirteen verbal high-functioning autistic children
with absence of hearing impairments (age range:
12-14 years; mean: 13.0 years) and 13 age-matched
typically developing children (age range: 12-14 years;
mean: 13.0 years) were evaluated. Participants were
asked to play three interactive games.
Independent
Variable (What
I changed)
Dependent
Variable (What
I observed)
Controlled Variables (What I
kept the same)
Syllable Dura- Accuracy of Re- Laptop, mouse,
tions with or sponses and h e a d p h o n e s ,
without
Pitch Response times games, the orChanges
der and numb
er of trials per
game, ages and
number of participants in each
group
23
Figure 1. Graphic User Interface of Emotional Prosodic Processing Game.
Figure 2. Graphic User Interface of Mono-Channel
Auditory Processing Game.
In all games, syllables of various durations were
presented through headphones and heard in both
ears when tested for mono-channel auditory processing and emotional prosodic processing, and in
individual ears when tested for left vs. right ear auditory processing. The goal of the mono-channel and
left vs. right ear auditory processing games was to
match the target syllable (first syllable heard) with the
second or third syllable heard, and to click on a corresponding icon on the computer screen. The goal
of the emotional prosodic processing game was to
match syllables with emotional embedded content
to corresponding icons representing the five international emotional expressions. Accuracy of responses
and response times were evaluated as well as the
optimal values used in the development of the innovative educational system.
Results
1. Mono-Channel Auditory Processing Results
High-Functioning Autistic
Participants
0.45
0.40
Response Times (s)
0.35
0.30
0.25
0.20
0.15
0.10
0.05
1.136
1.186
1.369
1.534
1.716
1.879
2.116
2.286
2.570
SD
0.216
0.247
0.287
0.306
0.299
0.312
0.431
0.429
0.432
88.46
94.23
92.31
90.38
88.46
86.54
80.77
75.00
40.38
16.51
14.98
18.78
16.26
19.41
24.19
29.14
22.82
29.82
0.15
0.10
0.05
Typically Developed
Participants
24
Syllables’ Lengths (s)
0.45
0.40
Average
0.654
0.654
0.701
SD
0.121
0.111
0.123
100
100
100
0.00
0.00
0.00
Accuracy of Responses Average
(%)
SD
Table 1.1
Average
(%)
SD
Response Times (s)
Using analysis of variance and repeated measures
testing, the results show that:
Across all participants, there is a linear increase in
accuracy with increasingly longer phoneme presentation times, F(1, 24) = 43.87, p < .001. This effect is
stronger in the autistic group compared to the control
group, F (1, 24) = 9.20, p < .01. (Table 1.1)
Across all participants, there is a linear increase
in reaction times with increasingly shorter phoneme
presentation times, F(1, 24) = 226.41, p < .001. This
effect is stronger in the autistic group compared to the
control group, F(1,24) = 105.58, p < .001. (Table 1.2)
0.35
0.30
0.25
0.20
0.791
0.913
1.020
1.166
1.232
1.421
0.121
0.133
0.118
0.108
0.107
0.121
100
100
96.15
94.23
92.31
86.54
0.00
0.00
9.39
14.98
12.01
21.93
Order of Syllables Presented
Response
Times (s)
High-Functioning Autistic Partici- Typically Developed Participants
pants
Average
SD
Accuracy of Re- Average
sponses (%)
SD
ba-ba-da
ba-da-ba
ba-ba-da
ba-da-ba
1.710
1.799
0.904
1.028
0.282
0.288
0.122
0.112
84.19
79.06
97.86
94.87
18.68
16.84
3.61
5.30
Table 1.2
Both groups had faster response rates and more
accurate responses when the syllables were pre-
sented in the order ‘ba-ba-da’ than when the syllables
were presented in the order ‘ba-da-ba’. (Table 1.2)
2. Left vs. Right Ear Auditory Processing Results
High-Functioning Autistic
Participants
Response Times (s)
0.45
0.40
0.35
0.30
0.25
0.20
0.15
0.10
0.05
Average
1.139
1.263
1.440
1.611
1.769
1.975
2.147
2.398
2.642
SD
0.330
0.401
0.418
0.532
0.568
0.607
0.611
0.691
0.665
80.77
82.69
75.00
80.77
73.08
75.00
65.38
65.38
44.23
14.98
21.37
22.82
20.80
23.85
25.00
26.10
29.82
29.14
(%)
SD
Typically Developed
Participants
Response Times (s)
0.45
0.40
0.35
0.30
0.25
0.20
0.15
0.10
0.05
Average
0.710
0.715
0.741
0.840
0.933
1.067
1.224
1.336
1.493
SD
0.130
0.122
0.126
0.112
0.114
0.114
0.098
0.096
0.106
(%)
SD
100
100
100
96.20
98.10
100
92.31
86.54
86.54
0.00
0.00
0.00
9.39
6.93
0.00
12.01
16.51
19.41
Table 2.1
Order of ‘Ba’ Syllables Presented
High-Functioning Autistic Partici- Typically Developed Participants
pants
R-R
Average of Accuracy of Responses (%) for Matching Syllables Presented in Same or Different Ears
Accuracy of Re- Average
sponses (%)
SD
R-L
65.00
L-R
L-L
78.69
R-R
R-L
99.11
L-R
L-L
91.50
66.31
63.69
84.92
72.46
100
98.23
90.23
92.77
33.64
35.37
14.81
39.71
0.00
6.38
12.21
8.92
Table 2.2
Using a Paired-Samples T-test (performed separately for each group), the results show that:
Autistic children responded faster, although with no significant difference in accuracy, when the phoneme is presented to the left ear rather than the right ear, suggesting a
right hemisphere lateralization tendency for non-emotional auditory processing, t(12) =- 3.08, p < .01. (Table 2.1)
Typically developing children performed more
accurately, t(12) = 2.92, p < .05, and faster, t(12) =
-37.08, p < .001, when the phoneme is presented to
the right ear rather than the left ear, suggesting a left
hemisphere lateralization tendency for non-emotional auditory processing. (Table 2.2)
25
Figure 3. Graphic User Interface of Left vs. Right Ear
Auditory Processing Game.
3. Emotional Prosodic Processing Results
Using Analysis of Variance testing, the results show
that:
The typically developing participants processed
the emotional information better than the autistic participants. Time-stretching of syllables improved pro-
cessing of emotional information in all participants,
especially for the autistic individuals. Both groups
responded faster and more accurately to approachrelated (anger and happiness-related) stimuli relative to withdrawal-related (sadness-related) stimuli.
Autistic children responded faster, t(12) = -8.09, p <
.001, and more accurately, t(12) = 4.07, p < .01, to
anger-related stimuli in comparison with sadnessrelated stimuli. Similarly, they responded faster, t(12)
= -5.74, p < .001, and more accurately, t(12) = 5.74,
p < .001, to happiness rather than sadness-related
stimuli. Typically developing children responded faster, t(12) = -3.54, p < .01, and more accurately, t(12)
= 2.94, p < .05, to anger rather than sadness-related
stimuli. Similarly, they responded faster, t(12) = -3.06,
p < .01 to happiness rather than sadness-related
stimuli. Sadness-related (withdrawal-related) stimuli
were processed at approximately the same speed
and accuracy as neutral stimuli and better than surprise stimuli by both controls and autistic individuals. This indicates that both groups have a left brain
hemispheric lateralization tendency for emotional auditory processing.
4. Innovative Educational System Personalized for Each Individual’s Specific Needs
Figure 4.
26
Each subject’s optimal artificially time-stretched
speech rate of auditory processing led to the development of a system personalized for each individual’s
specific needs based on a world-class real-time and
file-based media encoding system. It has been proven effective for its potential to improve processing of
long, connected speech strings when speech is preprocessed through different plug-ins: time-stretching,
filtering and noise reduction, equalizer, audio level
and video processing amplifier. It can serve as an
innovative educational system (especially for the
autistic children) in which media input is captured,
pre-processed and personalized for each individual’s
specific needs, encoded and published (archived or
streamed).
Conclusion
The results of this project provide significant insight into how to help those who live with autism.
There is a strong need for developing strategies
to help autistic individuals overcome their processing deficits so they can recognize basic speech elements and normal connected speech with greater
intelligibility, higher accuracy and speed. Speech
that matches a child’s listening “window” would make
it easier for the child to perceive and learn. Timestretching technology can not only improve the life of
people with autism and other learning disabilities, but
that of typically developing individuals and foreign
language learners as well. Further benchmark testing and analysis of the innovative educational system
will be performed to investigate whether autistic children would benefit from pre-processed information
in real time.
Acknowledgements
First of all, I would like to thank the participants,
without whom this project would not have met its
goal. I would also like to thank the parents of the participants, the York Region District School Board Research Review Committee and the teachers from Silver Stream Public School, Oak Ridges Public School,
the Children’s Development Group and the Merle
Levine Academy, all of whom have given me permission to perform this experiment. A special note of
thanks goes to the Autism Ontario organization, who
has helped me recruit the participants, and the Digital
Rapids and Enounce companies, who have provided
me with the required hardware and software. Also, I
would like to thank my mentors from the University of
Toronto and my parents for their support.
Key Words
Autism; auditory processing; technology; education
References
[1] World Health Organization. F84. Pervasive developmental
disorders. International Statistical Classification of Diseases
and Related Health Problems. 2006. (10th ed. (ICD-10) ed.).
http://www.who.int/classifications/apps/icd/icd10online/?gf80.
htm+f840. Retrieved 2007-06-25.
[2] Boyle C, Van Naarden Braun K, Yeargin-Allsopp M. The
Prevalence and the Genetic Epidemiology of Developmental
Disabilities. In: Genetics of Developmental Disabilities. Merlin
Butler and John Meany eds. 2005.
[3] Johnson, C.P. Early Clinical Characteristics of Children with
Autism. In: Gupta, V.B. ed: Autistic Spectrum Disorders in
Children. New York: Marcel Dekker, Inc., 2004:85-123.
[4] Ganz ML. Arch Pediatric Adolescent Medical. The Lifetime
Distribution of the Incremental Societal Costs of Autism. 2007
April; 161(4):343-9. Abt Associates Inc, Lexington, MA 02421,
USA
[5] Autism Society Canada. Canadian Autism Research Agenda
and Canadian Autism Strategy. March 2004
[6] Flagg EJ, Roberts W, Roberts, T.P. Language lateralization development in children with autism: insights from the late field
magnetoencephalogram. Neurosci Lett. 2005. 386(2): 82-7.
Roberts, T. P., Schmidt, G. L., Egeth, M., Blaskey, L., Rey, M.
M., Edgar, J. C., et al.
[7] Tecchio F, Benassi F, Zappasodi F, Gialloreti LE, Palermo M,
Seri S, Rossini PM. Auditory Sensory Processing in Autism:
A Magnetoencephalographic Study. Biol Psychiatry, 2003; 54:
647–654.
[8] Roberts, T. P., Schmidt, G. L., Egeth, M., Blaskey, L., Rey,
M. M., Edgar, J. C., et al. Electrophysiological signatures:
magnetoencephalographic studies of the neural correlates of
language impairment in autism spectrum disorders. Int J Psychophysio. 2008. 68(2), 149–160.
[9] Tallal P. Improving language and literacy is a matter of time.
Nature Reviews Neuroscience. 2004. 5(9):721-728
[10]Boddaert N, Belin P, Chabane N, Poline JB, Barthélémy C,
Mouren-Simeoni MC, Brunelle F. Perception of Complex
Sounds: Abnormal Pattern of Cortical Activation in Autism. Am
J Psychiatry, 2003; 160: 2057-2060.
[11]Blackstock EG. Cerebral asymmetry and the development of early infantile autism. J Autism Child Schizophr, 1978; 8: 339-353.
[12]Prior MR, Bradshaw JL. Hemisphere functioning in autistic
children. Cortex, 1979; 15: 73-81.
[13]Harmon-Jones, E., Elesvier B.V. The role of asymmetric frontal
cortical activity in emotion-related phenomena. Biological Psychology. 2009. 6130, 1-12.
[14]Paul R, Augustyn A, Klin A, Volkmar F. Perception and Production of Prosody by Speakers with Autism Spectrum Disorders.
J Autism Dev Disord, 2005; 35: 205-220.
Bibliography
[15]Benasich, AA and Tallal, P Auditory temporal processing
thresholds, habituation, and recognition memory over the 1st
year. Infant Behavior and Development. 1996. 19(3), 339357.
[16]Boddaert N. et al. Perception of complex sounds in autism:
abnormal auditory cortical processing in children. American
Journal of Psychiatry. 2004. 161(11), pp. 2117-2120
27
[17]Brock J, Brown CC, Boucher J, Rippon G. The temporal binding deficit hypothesis of autism. Development and Psychopathology. 2002. 14(2):209-224.
[18]Flagg EJ, Roberts W, Roberts TP. Language lateralization
development in children with autism: insights from the late
field magnetoencephalogram. Neurosci Lett. 2005. 386(2):
82-7.
[19]Fombonne E, Zakarian R, Bennett A, Meng L, McLean-Heywood D. Pervasive developmental disorders in Montreal, Quebec, Canada: prevalence and links with immunizations. Pediatrics. 2006 Jul;118(1):e139-50.
[20]Gomot M. et al. Change detection in children with autism: an
auditory event-related fMRI study. Neuroimage. 2006. 29(2),
pp. 475-484
[21]Hobson RP. Emotion recognition in autism: Coordinating faces
and voices. Psychol Med, 1988; 18: 911-923.
[22]James AL, Barry RJ. Developmental effects in the cerebral lateralization of autistic, retarded and normal children. J Autism
Dev Disord, 1983; 13: 43-54.
28
[23]Jansson-Verkasalo E, Ceponiene R, Kielinen M, Suominen K,
Jäntti V, Linna SL, Moilanen I, Deficient auditory processing in
children with autism, as indexed by event-related potentials.
Neurosci Lett, 2003; 338: 197-200.
[24]Jarvinen-Pasley A. and Heaton, P. Evidence for reduced domain-specificity in auditory processing in autism. Developmental Science. 2007. 10(6), pp. 786-793.
[25]Johnson, C.P. Early Clinical Characteristics of Children with
Autism. In: Gupta, V.B. ed: Autistic Spectrum Disorders in
Children. New York: Marcel Dekker, Inc., 2004:85-123.
[26]Kemner C, Verbaten MN, Cuperus JM, van Engeland H. Auditory event-related brain potentials in autistic children and three
different control groups. Biol Psychiatry, 1995; 38: 150-165.
[27]Oram Cardy J, Flagg E, Roberts W, Roberts TP. Delayed mismatch field for speech and non-speech sounds in children with
autism. Neuroreport. 2005. 16(5): 521-5.
[28]Williams, J. H. G., Whiten, A., Suddendorf, T., & Perrett, D.
I. Imitation, mirror neurons and autism. Neuroscience and
Biobehavioral Reviews. 2001. 25, 287–295.
Review of Slow It Down to Speed It Up: Breaking
Through the Window of Autism
The study by Cozma tested auditory processing of 13 high functioning autistic cases and 13 age-match controls and compared response times and accuracy when words were slowed down or sped up. Time-stretching
of syllables improved processing information in cases and controls. Autistic children demonstrated left ear
preference and right brain hemispheric lateralization for non-emotional auditory processing, which is reversed
to what is observed in controls. For emotional auditory processing, both cases and controls showed left brain
lateralization tendency. By optimizing the time-stretched speech rate of auditory processing for each subject,
it is possible to develop an educational system personalized for an individual’s speech needs.
I am by no means an expert in the field of magnetoencephalographic studies but I did find the study to be
very innovative and interesting and complex. I do have several comments that might make the article flow
better and be clearer to the average reader.
I found the hypotheses sound but hard to follow. I think it would help if the background section was longer
(i.e. one page) to help set up these hypotheses. For instance, there are studies referenced in the hypothesis
section but after the hypothesis. This is a little unconventional and hard to follow; the background could also
help define some of the terms that are used, since these are hard to follow as well. For example, you refer to
approach-related and withdrawal-related stimuli and define these in the results as happiness and sadnessrelated, respectively. I think you should define this earlier.
I have the same issue with the experimental design/procedure. Although the figures provided are very nice,
you should have a very simple flow diagram outlining the experimental procedure (i.e. cases and controls, the
tests done and the results). You should also refer to the display items in the text so that it is easier to follow.
You refer to emotional and non-emotional information but do not say why this is important in the study of
autistic behaviour. I think a line in the background as to why this is important would be good.
For the results, it would be very useful to have a table with the test, and the measured times. If it is tabulated
with means and standard deviations, it is much easier to read. Try to use display items as much as possible to
show data: then the results can describe these. Much of the results indicate increased or decreased in cases
versus controls, but it is preferable if numbers are used to show this. Typically, one would need some statistical, rather than anecdotal evidence for interpretation of the data.
Are there any measureable results for the implantation of subsection 4 of the results? I understand that the
focus of the article is the research behind the design of the system, but I would be very interested to know how
the tailored educational system is being implemented and how effective it has been. Are there any practical
issues that should be discussed?
Christian R. Marshall, Ph.D., Research Associate, Genetic Analysis Facility, The Centre for Applied Genomics
29
Chemistry
Système de Captation du CO2: Rentabiliser le
Développement Vert
Joël Filion
DEC en science de la nature, Collège Mérici, Québec
Joël Fillion a toujours aimé les
sciences à cause de sa curiosité
et sa volonté de comprendre. Il
était encouragé par ses professeurs et sa participation dans les
clubs parascolaires a ouvert ses
yeux aux possibilités de la science. Il se n’est jamais contenté
avec un seul domaine de science ; pour l’Expo-Sciences il a
fait des travaux de microbiologie,
physique optique et électrique appliqué, et ingénierie chimique en
lien avec l’écologie. Il s’intéresse
dans les expositions, les dialogues sur la science avec des
professionnels du milieu et, dans
ce projet, les possibilités réelles
qui peuvent en ressortir et qu’on
pourra réaliser. Il pense que,
avec la science, on peut affirmer
une idée ou réaliser qu’il y a des
solutions aux problèmes réelles
et avec la contribution de chacun,
on peut les trouver. En fin, c’est
l’application des connaissances
afin de résoudre les problèmes
qui reste la source initiale de son
intérêt dans les sciences. Maintenant Joël fait ses études à la
l’Université Laval.
Tout hydroxyde possède la capacité de fixer le dioxyde de
carbone (CO2) sous la forme d’un carbonate, plus facilement
isolable sous la forme d’un sel solide que le CO2 gazeux.
L’utilisation de l’hydroxyde de calcium (Ca(OH)2) pour filtrer
le dioxyde de carbone semble ainsi prometteuse en regard du
faible coût du produit, ainsi que de la facilité à renouveler le
produit naturellement. Ensuite, la réutilisation d’un déchet toxique de l’industrie pétrolière permet la libération subséquente
du CO2 épuré et d’obtenir un sous-produit en demande dans
le marché de la construction. Le CO2 ainsi libéré peut être fixé
par photosynthèse, accélérant la production des plantes en
serre. Un tel système coûterait environ 17 millions de dollars.
Couplant des gains du secteur agricole et de celui des matériaux de construction, cet investissement pour la construction
des infrastructures pourraient être remboursés à l’intérieur des
dix premières années. Des expérimentations plus pointues demeurent toutefois nécessaires afin de vérifier l’imperméabilité
du système face aux autres gaz émanant des raffineries. Il
ne devrait toutefois pas y avoir de problème de ce côté, car
ces autres gaz ne peuvent traverser que difficilement l’étape
de filtration du calcaire. Le procédé industriel fonctionne par
une succession de circuits fermés réutilisant tous les réactifs
qui n’ont pas réagie lors d’un premier cycle. Ce procédé a été
conçu à partir d’un principe de collaboration entre plusieurs
compagnies, dont Suncor Energy ou Shell, Graymont Inc. et
la Canadian Gypsum company.
Every hydroxide has the capacity to fix the carbon dioxide
(CO2) as a carbonate, easier to filtrate as a salt than the gaseous CO2. The use of calcium hydroxide (Ca(OH)2) to filtrate
the CO2 seems promising considering the low cost and the fast
and natural restoration of the product. Then, the use of a toxic
waste of the petroleum industries generates the subsequent liberation of a filtrated CO2 and the obtaining of an industrial waste in request on the construction material’s market. This CO2 can be fixed by photosynthesis, accelerating the growth of plants in greenhouses. Coupling the gains of the agricultural and
the construction sectors, the 17 billion dollars required for building the infrastructures could potentially be
30
Joël Filion SYSTÈME DE CAPTATION DU CO2: RENTABILISER LE DÉVELOPPEMENT VERT
refunded into 10 years. However, some complementary and exhaustive experiments need to be done to
verify that the system is not permeable for the others industrial gases. There should not have a problem
to that point since these gases cannot, normally, pass through the limestone filtration step. Moreover, the
entire process is composed with a succession of close systems reusing all the unused reactives. This
process is base on the collaboration between Suncor Energy or Shell, Graymont Inc. and the Canadian
Gypsum Company.
Introduction
L’utilisation d’un hydroxyde à des fins de captation du dioxyde de carbone (CO2) à fait maintes fois
l’objet de recherches afin de limiter l’impact de cet
important vecteur relié au réchauffement climatique.
Ces expérimentations ont pu montrer l’efficacité des
hydroxydes à fixer une molécule de CO2 et de produire de la sorte une molécule plus facile à isoler que le
gaz carbonique, un carbonate.
2 OH-+ CO2 → CO32- + H2O
(1)
En effet, combiné à un alcalin ou un alcalino-terreux, le carbonate forme un sel qui, sous une forme
solide, peut être filtré et isolé plus facilement que le
CO2 gazeux afin d’en disposer de la façon désirée.
Cependant, l’application d’une telle technique pour
des fins environnementales et dans une optique de
développement durable présente quelques difficultés.
En effet, des problématiques telles que l’épuisement
de la matière première, le coût énergétique du dispositif et la façon de disposer des sous-produits réactionnels peuvent engendrer des frais afférents rendant le tout économiquement non viable. L’objet de
cette étude est donc de trouver dans quelles mesures
il serait possible de satisfaire à ces exigences.
Cadre théorique
Procédés chimiques et mécanisme techniques
Tout d’abord, afin de répondre aux critères du
développement durable, il est nécessaire d’utiliser
des ressources énergétiques et matérielles renouvelables. En effet, l’utilisation de sources énergétiques provenant de combustibles fossiles, telle
une centrale à charbon, n’est pas envisageable, car
le procédé pour libérer l’énergie nécessaire pour
capter le CO2 produirait aussi du CO2. L’utilisation de
l’hydroélectricité ou encore de l’énergie éolienne permet de pallier à cette contrainte.
Puis, il est nécessaire de trouver un hydroxyde
qui peut être renouvelé aisément. L’hydroxyde de
calcium (Ca(OH)2), aussi appelée chaux éteinte,
répond à ce critère, car ce produit est généralement
obtenu suite à la calcination du carbonate de calcium
(CaCO3), plus connu sous le nom de calcaire.
∆
CaCO3 →
CaO + CO2
(2)
CaO + H2O → Ca(OH)2 + 64,5 kJ/molCaO (3)
Le calcaire est présent presque partout et sa très
faible solubilité (considéré comme insoluble)[1] permet
la précipitation rapide des ions qui le composent en
un composé solide, lorsque ceux-ci entrent en contact. Cela en fait un minéral facilement renouvelable
naturellement et, par conséquent, idéal pour l’objectif
recherché.
Toutefois, la calcination du calcaire produit non
seulement l’oxyde de calcium (CaO), soit la chaux
vive, mais aussi du CO2 (voir équation 2). Il devient
alors indispensable de capter aussi le CO2 libéré par
la production de la chaux. Ce CO2 peut être capté
avant qu’il ne soit mélangé à d’autre gaz. Cependant, les mécanismes de chauffages utilisés pour la
calcination du CaCO3 par l’industrie de la chaux ne
permettent actuellement pas la captation d’un CO2
pur. En effet, malgré que la calcination du calcaire ne
libère que le CO2, les industries de la chaux procède
par « chauffage direct » (conduction thermique direct,
du gaz au minéral) afin d’augmenter la température
du CaCO3. Ils utilisent les gaz provenant des combustibles fossiles, gaz contenant des produits sulfurés,
de l’oxyde nitreux, du monoxyde de carbone, etc.
Les SOX, NOX et CO ne doivent pas être mélangés au CO2, car une filtration supplémentaire deviendrait alors nécessaire. Puisqu’un chauffage « indirect » n’est pas envisageable en vue de la baisse
de l’efficacité du chauffage et de l’augmentation
significative des pertes énergétiques, un chauffage
direct avec un autre gaz doit être envisagé. Il faudrait effectuer la calcination par l’intermédiaire de la
vapeur d’eau (chauffée à l’électricité), au lieu des gaz
31
provenant de combustibles fossiles. L’hydratation
de la chaux vive (voir équation 3) s’effectuerait alors
simultanément. Malgré la grande température qu’il
faut atteindre pour engendrer la réaction (il faut
théoriquement chauffer jusqu’à 825°C, mais aux
alentours de 1200°C en industrie)[2], celle-ci est bien
inférieure à la température de thermolyse directe de
l’eau (qui est supérieure à 2500K[3]). D’ailleurs, il est
toujours possible de réduire la température et de
chauffer plus longtemps afin de réduire aussi l’usure
de l’équipement industriel.
Cette seconde réaction étant très exothermique,
la réaction générale s’autoalimenterait en énergie,
réduisant l’important coût de chauffage. Le risque
d’emballement de la réaction n’a pas été étudié,
mais la lenteur de la cinétique de cette réaction générale réduit ce risque. En effet, l’extinction se fait
en présence de CO2 (facteur de ralentissement à
des températures inférieures à 1000°C) et la surface
de contact (finesse des grains) de l’oxyde de calcium obtenue par la calcination est réduite lorsque
la calcination s’effectue à des plus hautes températures (facteur de ralentissement de l’extinction de la
chaux). Le procédé pour obtenir la chaux éteinte est
donc plus stable[4].
Par la suite, afin de bien isoler le CO2(g) produit par
la calcination de la vapeur d’eau, il est nécessaire
d’utiliser un système de refroidissement. Idéalement, une température finale de -10°C permettrait de
faire condenser la majorité de l’humidité qui pourrait
rester. Toute cette eau condensée retourne par
la suite au début afin d’effectuer un autre cycle de
calcination.
La différence de température étant très importante, un système de refroidissement multiple est
préférable afin d’avoir des matériaux appropriés à
chacune des températures. Une bonne partie de
l’énergie servirait à réchauffer l’eau (précédemment
précipitée) par un système à contre-courant. Puis,
le reste de l’énergie thermique récupérée peut être
utilisée pour chauffer des serres, reconnues comme
étant très énergivores. Par ailleurs, ce sont les plantes contenues dans ces mêmes serres qui serviront
majoritairement à fixer le CO2 isolé.
La compagnie Graymont Inc. possède, à Joliette (Québec) (voir annexe 1), les équipements
requis pour la production du Ca(OH)2 et représente
le premier segment du projet. Il faudrait toutefois ajouter à ses infrastructures des modifications pour inclure le mécanisme de calcination à
la vapeur d’eau, ainsi que le procédé de captation
32
du CO2 (incluant le système de refroidissement). La
construction de serres à côté permettrait l’utilisation
directe ou le stockage du CO2, sans nécessiter de
transport.
La chaux éteinte peut ensuite être utilisée
pour capter le CO2 provenant d’une industrie, alimentant le système de captation proprement dit.
Le barbotage (accentué à l’aide d’agitateur statique et mécanique) des gaz d’échappement dans
l’eau de chaux permet la captation du CO2 sous
la forme du calcaire (voir figure 1). Une presse
à vis permet ensuite la filtration de ce calcaire
(voir figure 2), le reste de la solution retournant au
début du circuit pour se refaire saturer en hydroxyde
de calcium.
Lorsque la pression est assez élevée au bout de
la presse à vis, un mécanisme de ressorts laisse
tomber le calcaire dans un bassin d’acide sulfurique
(H2SO4) où il y a neutralisation du H2SO4 par le calcaire.
H 2O
CaCO3 + H2SO4 → CaSO4 • 2H2O + CO2
(4)
Le peu de solution d’hydroxyde de calcium qui
peut traverser malgré le système de filtration réagit
avec l’acide sulfurique et donne directement du sulfate de calcium dihydraté (CaSO4 • 2H20), plus connu
sous le nom de gypse.
Ca(OH)2 + H2SO4 → CaSO4 • 2H2O
(5)
Les réactions de neutralisation du H2SO4 sont
exothermiques, ce qui favorise l’évaporation d’une
partie de l’eau. Par conséquent, il est encore
une fois nécessaire de séparer CO2 de la vapeur
d’eau. Une tour de refroidissement simple à -10°C
(voir figure 3) suffit cette fois, car la température
initiale est moins élevée. Le CO2 peut, par la suite,
être compressé et stocké pour une utilisation ultérieure. Quant à l’eau condensée (et distillée par le fait
même), elle retourne à l’étape précédant le barbotage pour compenser la perte de liquide engendrée
à la presse à vis.
Figure 1. Système de barbotage des gaz industriels.
la manutention de produits toxiques. La transformation
de chacun de ces produits à l’autre étant possible[6],
l’acide sulfurique peut être obtenu gratuitement et en
quantité suffisante.Afin d’éviter les problèmes de transport, la clientèle idéale pour capter le CO2 serait une
raffinerie qui fournirait directement l’acide sulfurique.
Figure 2. Système de filtration du calcaire.
Figure 3. Tour de refroidissement.
La neutralisation de l’acide sulfurique par le calcaire n’a pas uniquement déclenché la libération du
CO2. Il y a aussi eu production de CaSO4 • 2H2O.
Une presse à bande (associée à trois rinçages pour
éliminer l’acide qui pourrait rester dans le gypse) est
utilisée cette fois pour la filtration de ce solide (voir
figure 4). Ce type de filtre est préférable compte tenu
de la cristallisation particulière du gypse propice à la
formation de plaque (formation de flocons)[5]. La solution d’acide sulfurique ayant été séparée du gypse,
elle peut retourner dans la cuve pour former, comme
le procédé de l’eau de chaux, un second circuit fermé.
Figure 4. Système de filtration du gypse.
Suite à des règlementations pour prévenir
l’occurrence des pluies acides, les industries sont
tenues de traiter les gaz sortant par des procédés de
désulfuration. Les produits sulfurés (principalement
le SO2) alors capturés sont stocké sous forme de sulfure d’hydrogène (H2S) ou de H2SO4. Les pétrolières
doivent alors défrayer d’important montant pour payer des compagnies de transport spécialisées dans
Commercialisation
Les raffineries de Suncor Energy Inc., ou encore
de Shell, situées à Montréal-Est (Québec) sont idéales pour un tel développement. En effet, de vastes
terrains sont disponibles dans ce secteur pour de
nouveaux développements, ce qui pourrait permettre
la construction de serres pour utiliser le CO2 et réutiliser l’énergie thermique de la tour de refroidissement
simple. De plus, Joliette n’est pas trop éloignée de
Montréal, ce qui réduit les émissions engendré par le
transport de la chaux. Puis, tout près des raffineries
se trouve une usine de la Canadian Gypsum Company (CGC) (voir annexe 1). Le sous-produit réactionnel du système de captation du CO2 (le gypse) serait,
par conséquent, mis en marché par CGC.
Puis, pour chaque mole de CaO utilisée, on obtient aussi deux moles de CO2 : une provenant de
la calcination du « calcaire naturel » et l’autre de la
neutralisation du H2SO4 par le « calcaire contenant le
CO2 capturé ». Une partie de ce CO2 peut être vendue en bonbonne, mais l’utilisation de plantes dans
des serres permet d’utiliser un système de fixation
déjà optimisé, la photosynthèse. Il est alors possible
non seulement de fixer le CO2, mais aussi d’accélérer
la croissance des plantes. La température et le CO2
utilisée par les serres sont généralement obtenus
par la combustion de gaz naturels . L’application
de ce nouveau procédé permet ainsi de réduire la
consommation des serres en combustibles fossiles,
ce qui représente une amélioration écologique et
économique.
Plus concrètement, les conditions optimales des
plants en serre permettent une fixation par photosynthèse de 5gCO / (m2 • h)[8]. Ainsi, si les deux serres du
projet totalisent 47 500 m2, près du quart de la surface
totale des six serres de Savoura[9], il est possible de
capter 2 081,9 tonnes de CO2 par an. Pour ce faire,
3 505 tonnes d’hydroxyde de calcium (Ca(OH)2) par an
seront produites et utilisées; 4 639,77 tonnes d’acide
sulfurique (H2SO4) seront neutralisées; 8 049,46
tonnes de gypse (CaSO4 • 2H2O) seront vendues[10].
De plus, l’énergie thermique recueillie avec les réactions d’extinction de la chaux et de neutralisation
de l’acide sulfurique par le calcaire peut permettre
2
33
d’économiser l’équivalent de plus de 6 millions de dollars (excluant les pertes énergétiques dues au transfert de l’énergie) en frais de chauffage à l’électricité[11].
Considérant les pertes énergétiques et en tenant
compte du revenu brut proportionnel à la surface
des serres de Savoura[12], on obtient un flux monétaire de 1 250 000$ par année pour les végétaux[10].
Le revenu provenant de la vente du gypse, soustrait du coût relié à sa production donne un flux
monétaire annuel de 700 800$[10]. Malgré le fait qu’ils
n’incluent pas les coûts supplémentaires relatifs à
la méthode de calcination particulière, ils incluent
le prix d’achat de la chaux vive au lieu de la chaux
éteinte (moins dispendieuse en raison de sa plus
faible réactivité). De plus, les calculs ont été faits en
considérant que l’acide sulfurique devait être acheté
alors que les raffineries paient pour s’en débarrasser.
Puis, un rabais peut aussi être considéré pour l’achat
de la chaux dans la mesure où le système de captation du CO2 à Joliette est assumé par le procédé.
En effet, avec les politiques de réductions des émissions de CO2 et les projets de bourse du carbone
du gouvernement, toute réduction des émissions de
CO2 peut devenir une source de revenu (autant à Joliette qu’à une raffinerie de Montréal). Cette source
de revenu potentielle n’est pas incluse à l’intérieur
des calculs préliminaires.
Quant au prix de construction des infrastructures,
le coût de construction des deux serres (à côté de
l’usine de chaux à Joliette et à côté de la raffinerie)
a été estimé à 10 000 000$, celui de l’usine de captation de la raffinerie à 6 000 000$ et le système
de captation de l’usine à Joliette à 1 000 000$. Le
dernier chiffre n’inclut toutefois pas le coût relié à la
construction d’un nouveau système de calcination.
Le coût initial pour construire toutes les parties du
procédé est donc de 17 000 000$.
Prenant en considération le flux monétaire annuel
et les coûts de lancement, le tout est potentiellement
rentable à l’intérieur des 10 premières années (avec
un bémol indiqué à la section analyse). Les taux
d’intérêts sur l’acquisition du montant initial ne sont
cependant pas inclus.
Expérimentation et analyse
Les réactions mentionnées précédemment ont
été expérimentées en laboratoire, individuellement et
à la chaine pour voir le déroulement de chacune des
étapes du procédé industriel. Toutefois, le matériel
disponible ne permettait pas d’effectuer les réactions
dans les mêmes conditions rencontrées en industrie
34
(pression atmosphérique, température, durée réactionnelle, concentration en gaz, etc.).
Les résultats quantitatifs obtenus ne sont donc pas
significatifs (taux de captation d’environ 20% en laboratoire). Les détails expérimentaux ne seront donc
pas approfondis, d’autant plus que les caractéristiques de ces réactions sont déjà bien connues[13,14,15].
De plus, non seulement les conditions industrielles
permettraient d’augmenter substantiellement le taux
de captation du CO2 sous forme de calcaire, mais la
simple augmentation de la grosseur des installations
et quelques changements au procédé permettraient
d’augmenter davantage le pourcentage de captation,
si celui-ci s’avère trop bas.
Autre point pertinent, il n’est pas possible d’affirmer
avec certitude que le procédé puisse être rentable,
car les expérimentations ne vérifiaient pas véritablement la capacité d’une solution d’hydroxyde à filtrer
le CO2 des autres gaz. Puisque la composition du gaz
obtenu expérimentalement n’a pas été analysée, on
ne peut rien déduire sur l’imperméabilité du système
au passage de d’autres gaz. En effet, il est possible
que d’autres gaz se soient dissouts dans la solution
et qu’ils aient pu suivre le CO2. Le CO2 récolté et envoyé dans les serres ne serait pas pur, ce qui occasionnerait une importante défaillance au système.
Le risque mentionné ci-dessus est cependant
moindre compte tenu des méthodes industrielles utilisées. Il s’avère effectivement que même les gaz dissouts ne peuvent théoriquement traverser que difficilement l’étape de filtration du calcaire effectuée avec la
presse-à-vis. La quantité de liquide traversant à ce
niveau (sous forme d’humidité du calcaire) est moindre, et d’autant plus la quantité de gaz dissout dans
cette solution. Puis, étant donné que les systèmes
aqueux fonctionnent en chaîne fermée, le passage
des gaz d’un système à l’autre semble peu probable.
Il serait néanmoins important d’effectuer de plus
amples expérimentations pour valider le potentiel du
système. Effectivement, advenant que ces gaz soient du CO, des SOX ou encore des NOX, le CO2 filtré ne peut plus être utilisé pour alimenter les serres
puisque des gaz aussi toxique que l’éthylène peuvent
occasionner la mort de tous les plants en concentration aussi minime que 0,5 ppm[7].
Conclusion
Malgré les analyses prometteuses du procédé
étudié, certaines expérimentations demeurent indispensables afin de valider l’efficacité du système. En
effet, les tests faits en laboratoire ont certes permis
de vérifier la capacité de captation du système, mais
ne permettaient pas de vérifier la perméabilité du
système aux autres gaz industriels.
Si ces expériences s’avéraient concluantes, le faible coût relatif de 17 millions et son remboursement
dans les 10 premières années pourraient permettre
de rentabiliser un tel système de captation du CO2
inspiré du développement durable.
Mots clés
Industries, raffineries, serres, CO2, chaux
Key words
Industry, refinery, greenhouses, CO2, limestone
Références
[1] ZUMDAHL Steven S., Chimie des solutions. 2e ed., Montréal,
Les Éditions CEC, 1998, p.171.
[2] Graymont Inc., entrevue téléphonique datant du 7 avril 2010.
[3] S. Abanades, P. Charvin, G Flamant, P Neveu (2006) ; - Energy, Volume 31, Issue 14, Novembre 2006, - Elsevier- Pages
2805-2822.
[4] COMMANDRE, J-M., SALVADOR, S., NZIHOU, A., Influence
des conditions de calcination sur les propriétés de la chaux,
Récents Progrès en Génie des Procédés, Numéro 92, 2005,
Ed. SFGP, Paris, France.
[5] D’après les observations des expérimentations effectuées en
laboratoire, février-avril 2010.
[6] EUN, Sangho., Hydrogen sulfide flux measurements and
dispersion modeling from construction and demolition (C&D)
debris landfills, B.S. Seoul National University of Technology,
Orlando (Florida); 2004.
[7] Les Serres du St-Laurent Inc., Producteur d’une serre de Savoura, responsable des ressources humaines d’un producteur,
entrevue téléphonique datant du 7 avril 2010.
[8] TURCOTTE, Gilles (agronome). Enrichissement carboné
par récupération du CO2 d’un système de chauffage central
et stockage de chaleur, PRIVA, Harnois, GT, [en ligne], http://
www.agrireseau.qc.ca/legumesdeserre/documents/CO2%20
Priva-Harnois-GT.pdf page consulté le 5 mai 2010.
[9] Savoura. Culture en serre, Les Serres du St-Laurent Inc., [en
ligne], http://www.savoura.com/fr/section03b.html, page consultée le 14 avril 2010.
[10]Toutes les références relatives aux calculs effectués, aux estimations budgétaires (chiffres nivelés à la baisse) ou à tout
autre détail sont disponibles sur demande.
[11]Hydro Québec, Comparaison des prix de l’électricité dans les
grandes villes nord-américaines (tarif en vigueur le 1er avril
2009), [en ligne], http://www.hydroquebec.com/publications/fr/
comparaison_prix/pdf/comp_2009_fr.pdf, page consultée le 6
avril 2010.
[12]Company listing, St-Laurent’s Greenhouses inc. (Savoura),
[en ligne] http://www.companylisting.ca/SAVOURA/default.
aspx, page consultée le 4 mai 2010.
[13]S.M. Shih, Y.S. Song, J.P. Lin. Kinetics of the Reaction of
Ca(OH)2 with CO2 at Low Temperature. Department of Chemical Engineering, National Taiwan University, Taipei, Taiwan
106 (Republic of China) - ACS Publications; 1999.
[14]M. Chen, S. Ito, A. Yamaguchi. Carbonation of CaO clinkers
and improvement of their hydration resistance, Department of
Materials Science and Engineering, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya-shi, Aichi 466-8555,
JAPON - ACS Publications; 2002.
[15]BARTON Paul, VATANATHAM Terdthai (1976) Kinetics of limestone neutralization of acid waters, Environmental Science &
Technology- ACS Publications.
Annexe 1.
35
Commentaire sur Système de Captation du CO2:
Rentabiliser le Développement Vert
Observations générales
Cette étude décrit la conception d’un processus théorique pour la capture du CO2 à partir d’une raffinerie industrielle de pétrole utilisant l’hydroxyde de calcium comme moyen de capture. Le processus propose ensuite
que le CO2 capturé de cette manière soit utilisé pour favoriser la croissance des plantes dans les serres. La
surproduction de gaz à effet de serre par la société moderne et l’effet de ces gaz sur le climat mondial signifie
que la réduction des émissions de carbone est extrêmement importante. Bien que l’idée derrière cette étude
semble avoir du mérite, l’explication du processus donné dans le présent document n’est pas claire. En outre,
il y a des fautes d’orthographe et quelques fautes de frappe dans le papier qui doivent être corrigées.
Résumé
Le résumé doit vraiment donner un aperçu des objectifs et des réalisations du projet afin que le lecteur soit
capable de lire le résumé seul et comprendre l’essentiel de l’étude. Je voudrais vous informer que le résumé
devrait être réécrit pour donner un aperçu de l’ensemble du processus. Malheureusement, le résumé en anglais doit aussi être retravaillé et peut-être avec de l’aide pour la traduction.
Introduction
L’introduction est concise et au point, ce qui est bon. Toutefois, le dernier paragraphe doit donner un aperçu
des objectifs de l’étude .... Être précis.
Cadre théorique
Alors que la chimie décrite dans cette section est correcte, la présentation d’ensemble du processus n’est
pas claire, et les schémas sont illisibles.
Je vous conseille de commencer cette section avec un aperçu clair et concis de l’ensemble du processus.
S’il vous plaît inclure un diagramme décrivant la chimie du processus de bout en bout, y compris les étapes de
la réaction qui produit du CO2, de celle qui permet la capture du CO2, ainsi que où et quand le CO2 est utilisé.
Vous pouvez même ajouter au schéma les entreprises qui contribuent à l’étape appropriée de la réaction. Le
but d’avoir une vue d’ensemble et un schéma serait d’aider le lecteur en lui permettant de voir l’ensemble du
processus depuis le début pour juger d’un coup d’œil s’il donne une réduction nette de la quantité de CO2 rejetée, et à quel moment dans le processus se produit la réduction.
Vous pouvez ensuite décrire chacune de ces réactions, les critères industriels nécessaires à leur réalisation, et les avantages et les inconvénients de chacun.
J’ai quelques questions précises et des commentaires concernant cette section.
Page 2, paragraphe 3: Ici, vous décrivez l’utilisation de la vapeur d’eau pour entraîner la réaction de CaCO3
par CaO en Ca(OH)2 (réactions 2 et 3). Savez-vous si ce processus a été essayé à l’échelle industrielle?
Comment la deuxième réaction exothermique affecte-t-elle la température nécessaire à la réalisation de la
première réaction ? Est-il nécessaire de séparer le Ca(OH)2 du calcaire résiduel?
S’il vous plaît refaire tous les schémas. Ils sont illisibles en raison de très basse résolution, en particulier
lors de l’impression. Il pourrait être souhaitable de simplifier les schémas, car il est souvent plus facile de comprendre un dessin plutôt que le rendu 3D du même schéma.
S’il vous plaît ajouter à cette section un paragraphe concernant la capture du CO2 par photosynthèse. Si
vous n’avez pas inclus cette information dans le cadre théorique le lecteur se retrouve avec une image incomplète de l’ensemble du processus. Il convient de noter que la capture du carbone par des plantes comme
les tomates ne représente pas une capture de carbone à long terme puisque les tomates n’ont qu’une courte
durée de vie. Le mérite de ce projet réside plutôt dans le remplacement du CO2 dérivé des combustibles
36
fossiles, le plus souvent utilisé pour favoriser la croissance des plantes dans les serres, par celui produit par le
processus de capture du carbone décrit. Cela devrait être clairement indiqué à la fois ici et dans le résumé.
Commercialisation
Cette section devrait contenir des détails sur les sociétés locales impliquées dans la collaboration potentielle et leur rôle dans le processus global, ainsi que les détails des coûts. Je vous conseille de déplacer toute
information sur ces sociétés présentée dans la section Cadre Théorique dans la présente section.
Conclusion
S’il vous plaît ajouter une courte phrase résumant vos conclusions d’une manière plus spécifique.
Pour résumer
Bien que l’idée générale décrite dans ce manuscrit soit intéressante et très pertinente, la description du
processus proposé doit être plus claire et plus simple. Bonne chance avec vos futurs projets scientifiques et
j’espère que vous continuerez à être intéressé par ce domaine très important.
Isla Ogilvie, Ph.D., Senior research application associate, BioMedCom Consultants Inc.
37
How Green is Your Sales Receipt?
David A. Gobbi
Grade 11, Northern Collegiate Institute and Vocational School, Sarnia, Ontario
I was born extremely premature,
This project describes the extraction and analysis of cash regwith many life-threatening mediister sales receipts to determine how extensively bisphenols
cal conditions. A team of medical
were used. Approximately sixty percent of the thermal paper
professionals in London’s Neonareceipts investigated contained Bisphenol A, and forty percent
tal Intensive Care Unit dedicated
contained Bisphenol S. The levels present were approximatethemselves around the clock to
ly ten million times higher than those reported for Bisphenol A
my care. As a youngster, my fain polycarbonate plastic baby bottles, banned in 2008 by the
vourite television programs were:
Canadian government.
The Magic School Bus and Bill
Nye the Science Guy. In grade
school, I loved attending science
Le projet décrit l’extraction et l’analyse des ventes registre des
camps, and have always had an
recettes monétaires de déterminer à quel point les bisphénols
innate interest in how to improve
ont été utilisés. Environ soixante pour cent des recettes du
life through science and technolpapier thermique enquête contenait du bisphénol A, et quarogy.
ante pour cent contenaient du bisphénol S. Les niveaux acThe things that appeal to me in
tuels sont d’environ dix millions de fois supérieures à celles
research and science are: that
déclarées pour le bisphénol A dans les biberons en plastique
you never truly know what you
polycarbonate, interdit en 2008 par le gouvernement canaare going to find: each experiment
dien.
can vary in a number of different
ways, and sometimes you discover the unexpected. I love the challenge of trying to find things that will benefit mankind and society as a
whole to make our lives safer and/or more convenient.
The thing that I find most interesting about Earth and Environmental Science is that you can find new ways
to improve people’s lives, while limiting the impact on our planet. Earth and Environmental Sciences allow
you to study how to reduce our exposure to harmful toxins, and find safer alternatives, so that we can enrich our lives. Even the small discoveries help us reduce our footprint on the earth and improve our health.
Some of these require minimal adjustments like changing from thermal paper to an electronic form of a
receipt, which not only reduces our impact on the earth, but also improves our own health.
Background
In October 2008, the Canadian government
banned plastic baby bottles containing Bisphenol A,
and classified the chemical as toxic to human health
and the environment[1]. Hundreds of studies have
linked this estrogen-mimicking chemical to developmental disorders, endocrine system disruption, early
38
onset of puberty in females, breast cancer, prostate
cancer, obesity, diabetes, and attention deficit hyperactivity disorder[2,3,4].
More than eight billion pounds of Bisphenol A are
produced annually,[5] and it is used in the manufacture of many everyday products including: compact
discs (CDs), digital video discs (DVDs), medical
David A. Gobbi HOW GREEN IS YOUR SALES RECEIPT?
equipment, dental sealants, canned food liners,
water bottles, self-adhesive labels, and some thermal papers. Although Bisphenol A does not occur
naturally, Environment Canada scientists discovered that it is entering the environment through
wastewaters, washing residues, and leachate from
landfills[1]. Also, this chemical has been detected
in the urine of ninety-one percent of Canadians[6],
suggesting people are being exposed to it on a regular basis.
Purpose
This project will describe an experimental procedure and analysis to determine how extensively bisphenols are used in thermal paper for sales receipts,
and discuss the implications of the findings relative to
bisphenol exposure concerns.
Hypothesis
I predict that there is not widespread use of bisphenol based thermal paper receipts, since there are
no hazard warning labels on them, and they have not
been banned by the government.
Procedure
A total of eighteen transaction receipts from a variety of retail establishments in the Sarnia, Ontario
area were collected, and included: department, grocery, hardware, postal outlet, and drug stores, gasoline stations, banks, fast food restaurants, movie theatre, rental car agency, and an airline ticket counter.
A three centimeter by eight centimeter section (approximately one-hundred milligrams) from each receipt was cut into pieces, and placed into a glass vial.
One gram of deuterated acetone solvent was added
Figure 1. 1H NMR Spectra of: 1.5 mg Bisphenol A (top left); Fast Food Restaurant Receipt Extract (bottom left);
Bisphenol S (top right); and Bank ATM Receipt Extract (bottom right). The vertical arrows denote Bisphenol A
and Bisphenol S resonances.
39
to the vial to extract the soluble components of the
thermal paper, and a hydrogen (1H) nuclear magnetic
resonance (NMR) spectrum was obtained.
Results
Nuclear magnetic resonance is a powerful analytical tool that is used extensively to identify chemical
structures, because it provides spectral fingerprints
of the molecules. The 1H NMR spectrum of Bisphenol
A is given in Figure 1, and consists of characteristic
resonances, arising from the four different types of
hydrogen atoms present in the molecule: there are
two aromatic alcohol (-OH) group hydrogens, four aromatic ring hydrogens that are closest to the hydroxyl
group, four aromatic ring hydrogens that are furthest
from the hydroxyl group, and six hydrogens that are
part of two methyl (-CH3) groups. Other resonances
arising from water, and non-deuterated acetone solvent, were observed in the spectrum also.
1
H NMR analysis of the acetone extract of a onehundred milligram cash register receipt from a popular world-wide fast food restaurant chain revealed the
presence of Bisphenol A (Figure 1). Additional resonances were observed in the spectrum, and these
could be attributed to other components in the thermal paper. From a consideration of the spectral peak
integrals, and comparing with those of the 1.5 mg
Bisphenol A in 1.0 g acetone (standard) sample (Figure 1), the Bisphenol A concentration was at the milligram level in the one gram of acetone from the fast
food sales receipt extraction. It should be noted that
the efficiency of bisphenol extraction by acetone was
probably less than one-hundred percent, meaning
that the bisphenol levels determined from the NMR
spectra would be less than the actual levels.
The spectrum obtained from solvent extraction of
a Canadian bank’s automated teller machine (ATM)
receipt (Figure 1), indicated that Bisphenol A was
not used in the paper coating, since the methyl hydrogen resonance was missing, and the positions of
other resonances were shifted slightly from those observed for Bisphenol A. It was apparent that the phenol structure contained substituted aromatic rings,
but not methyl groups. The spectrum was consistent
with that of Bisphenol S (Figure 1). Even though this
receipt paper could be described as “Bisphenol A
free”, it should be pointed out that Bisphenol S also is
estrogenic[7] and does not degrade readily[8].
A summary of the NMR results for the receipts sampled in this study is given in Table 1. It was found that
each of the eighteen transaction receipts contained
40
bisphenol: Approximately sixty percent contained
Bisphenol A, and forty percent contained Bisphenol
S. The bisphenol levels in a one-hundred milligram
receipt piece were in the two milligram range, suggesting percent concentration levels of bisphenols
in the thermal paper. A typical sales receipt weighs
approximately one gram, so it would contain greater
than twenty milligrams of Bisphenol A or Bisphenol
S. Since twenty milligrams is equal to twenty million
nanograms, the levels of bisphenols in thermal cash
register receipts are approximately ten million times
higher than those reported[9,10] for banned polycarbonate plastic baby bottles!
Receipt Source
Bisphenol Detected?
Bank #1 ATM
Yes – Bisphenol S
Bank #2 ATM
Yes – Bisphenol A
Gas Station #1 Pump
Yes – Bisphenol A
Gas Station #2 Pump
Yes – Bisphenol A
Movie Theatre
Yes – Bisphenol A
Fast Food Restaurant #1
Yes – Bisphenol A
Fast Food Restaurant #2
Yes – Bisphenol A
Grocery Store #1
Yes – Bisphenol S
Grocery Store #2
Yes – Bisphenol A
Grocery Store #3
Yes – Bisphenol S
Grocery Store #4
Yes – Bisphenol A
Grocery Store #5
Yes – Bisphenol S
Postal Outlet Store
Yes – Bisphenol S
Drug Store
Yes – Bisphenol S
Hardware Store
Yes – Bisphenol A
Department Store
Yes – Bisphenol A
Airline Ticket
Yes – Bisphenol A
Car Rental Agency
Yes – Bisphenol S
Table 1. Summary of NMR Results for Various Retail
Sales Receipts.
Conclusion
A procedure for extracting bisphenols from transaction receipts was developed, and their analysis
using 1H NMR spectroscopy was successful in this
project. Each of the eighteen transaction receipts
obtained for this study contained bisphenol: approximately sixty percent contained Bisphenol A, and forty
percent contained Bisphenol S. It was found that the
levels of bisphenols in thermal cash register receipts
are approximately ten million (10,000,000) times
David A. Gobbi HOW GREEN IS YOUR SALES RECEIPT?
higher than those reported for polycarbonate plastic baby bottles that were banned by the Canadian
government in 2008! Bisphenols are found not only
in plastics - You are coming into contact with them
every time you touch a sales receipt.
Implications and Recommendations
The general population mainly is unaware that
their transaction receipts contain quite high concentrations of bisphenols, and there could be occupational exposure hazards for receipt handlers in a
wide variety of retail occupations, especially for store
cashiers. Consumers should reduce unnecessary
exposures to bisphenols, and the following guidelines have been proposed:
• Don’t accept thermal paper sales receipts.
• Do not allow infants or children to handle or play
with transaction receipts.
• Be sure to keep food from coming into contact
with cash register receipts.
• Wash your hands thoroughly, and as soon as possible, after handling receipts.
• Lobby government officials, retailers, and thermal
paper producers for safer alternatives, such as
bisphenol-free paper.
• Receipts should have warning labels on them if
they contain bisphenols.
In light of a recent study studying continual and
widespread human exposure to Bisphenol A, retail
sales thermal paper receipts should be considered
as a source of bisphenols. Additionally, research
could be done to find alternatives for cash register
receipt paper coatings.
[6]
References
[2] F. S. vom Saal and J. P. Myers, Bisphenol A and Risk of Metabolic Disorders, J. Amer. Medical Assoc., 300, 1353 (2008).
[3] S. C. Nagel, F. S. vom Saal, K. A. Thayer, M. G. Dhar, M.
Boechler, and W. V. Welshons, Relative Binding Affinity-Serum Modified Access (RBA-SMA) Assay Predicts the Relative
In Vivo Bioactivity of the Xenoestrogens Bisphenol A and Octylphenol, Environ. Health Perspect., 105, 70 (1997).
[4] L. N. Vandenberg, R. Hauser, M. Marcus, N. Olea, and W. V.
Welshons, Human Exposure to Bisphenol A (BPA), Reprod.
Toxicol., 24, 139 (2007).
[5] L. N. Vandenberg, I. Chahoud, J. J. Heindel, V. Padmanabhan,
F. J. R. Paumgartten, and G. Schoenfelder, Urinary, Circulating, and Tissue Biomonitoring Studies Indicate Widespread
Exposure to Bisphenol A, Environ. Health Perspect., 118, 1055
(2010).
[6] T. Bushnik, D. Haines, P. Levallois, J. Levesque, J. Van Oostdam, and C. Viau, Lead and Bisphenol A Concentrations in the
Canadian Population, Health Reports, 21, 7 (2010).
[7] R. Kuruto-Niwa, R. Nozawa, T. Miyakoshi, T. Shiozawa, and
Y. Terao, Estrogenic Activity of Alkylphenols, Bisphenol S, and
Their Chlorinated Derivatives Using a GFP Expression System, Environ. Toxicol. Pharmacol., 19, 121 (2005).
[8] E. Danzl, K. Sei, S. Soda, M. Ike, and M. Fujita, Biodegradation of Bisphenol A, Bisphenol F and Bisphenol S in Seawater,
Int. J. Environ. Res. Public Health, 6, 1472 (2009).
[9] C. Brede, P. Fjeldal, I. Skjevrak, and H. Herikstad, Increased
Migration Levels of Bisphenol A from Polycarbonate Baby
Bottles After Dishwashing, Boiling and Brushing, Food Addit.
Contamin., 20, 684 (2003).
[10]H. H. Le, E. M. Carlson, J. P. Chua, and S. M. Belcher, Bisphenol A is Released from Polycarbonate Drinking Bottles and
Mimics the Neurotoxic Actions of Estrogen in Developing Cerebellar Neurons,Toxicol. Letters, 176, 149 (2008).
Bibliography
[11]Toxic Baby Bottles in Canada, Feb. 2008, http://www.toxicnation.ca/files/toxicnation/report/ToxicBabyBottleReport.pdf
[12]R. Senjen and D. Azoulay, Blissfully Unaware of Bisphenol A,
June 2008, Friends of the Earth Europe, www.foeeurope.org/
publications/publications2008.html
[13]European Union Risk Assessment Report: Bisphenol A, Feb.
2010, http://ecb.jrc. it/documents/ExistingChemicals/RISK_
ASSESSMENT/ADDENDUM/bisphenola_add_325.pdf
[14]H. H. Baum, NCR Company, Thermographic Recording System, United States Patent 3451338 (1969).
[1] “Canada Adds Bisphenol A to Toxic List; Government to Prohibit Sale of Baby Bottles That Contain Chemical”, Toronto
Star, October 18, 2008, pg. A4.
41
Review of How Green is Your Sales Receipt?
Given the recent public concern and Health Canada action regarding bisphenol A (BPA) in plastic bottles,
the author analyzes for bisphenols in thermal paper sales receipts. He compared the NMR (Nuclear Magnetic
Resonance) fingerprints from eighteen transaction strips from a variety of sources against known samples of
bisphenol A and S, to determine their presence in the samples. The author concluded that 60% of the samples
contained bisphenol A, while 40% contained bisphenol S. He also concluded that the bisphenol levels in the
sampled sales receipts were ten million times higher than those reported in polycarbonate baby bottles.
The author is commended for the sound use of the scientific methodology to determine the level of BPA in
certain products that a large number of consumers are exposed to.
Some improvements on the paper are suggested:
1. In the background section the author could describe why he chose to analyze thermal paper. For example,
was it due to the extent of human exposure, ease of analysis, or other consideration?
2. The method of quantifying the amount of the bisphenols could be explained more clearly with supporting
data. How did the author determine that the analyzed pieces contained bisphenols in the two milligram
range? What was the variation between samples? A baseline sample with a known amount of BPA, even
with a null amount of BPA, would be helpful to verify the accuracy and repeatability of the sampling and
analytical methodology.
3. The Implications and Recommendations are based on the premise that receipts containing bisphenols
are hazardous. This premise should be declared and supported, potentially based on further review on
the subject. The author has considered the presence of a substance of concern in a product, as well as
potential exposure to such products. What is the mechanism by which the substance impacts the human
body; touch, inhalation, consumption? Is the substance fixed in the product, or does it readily breakdown
facilitating entry into the human body?
Peter Baltais, Environmental Regulatory Advisor, Petroleum Products
42
Edward Kim TOXICITY OF CARBON NANOTUBES TO DAPHNIA MAGNA
Toxicity of Carbon Nanotubes to Daphnia
Magna
Edward Kim
Grade 12, Cameron Heights Collegiate Institute, Waterloo, Ontario
The spark that got Edward Kim
into science is very simple:
a science fair. Ever since he
began competing in middle
school, science has been a
part of Edward Kim’s life. He
is pushed by the thought of
himself helping the world by
adding a part of his knowledge to
humanity’s database. His field of
nanoscience and nanotechnology
is very interesting because it is the
science that is happening here
and now. For Edward science is
just another way to help those
who need it most.
Carbon nanotubes (CNTs) are being actively researched for
fields such as materials engineering and medicine. However, very little is known about their possible toxic effects,
particularly in the context of aquatic ecosystems. The acute
toxicity of multi-walled CNTs was investigated by exposing Daphnia magna (D. magna) neonates to suspensions
of CNTs for a 48-h period. Additionally, the effects of humic
acid (HA) on the solubility and toxicity of CNTs was investigated. It was found that CNTs were toxic to D. magna at the
highest concentration tested. Spectrophotometry analysis revealed that HA could be used at some concentrations (8 mg/L of HA, 16 mg/L of CNTs) to significantly increase the duration that CNTs remain in suspension.
Overall, the determining factor of the toxicity of the CNTs
appeared to be related to their ability to aggregate within
the suspensions and adhere to the neonates; the solubility of the CNTs had little effect on their toxicity to D. magna.
HA was observed to inhibit CNT aggregation, and was thus
able to significantly reduce the toxicity of CNTs to D. magna at sufficient concentrations of both HA and
CNTs (25 mg/L of HA, 32 mg/L of CNTs).
Les nanotubes de carbone (NTC) sont activement recherchés dans des domaines comme l’ingénierie
des matériaux et de la médecine, mais on sait très peu sur leurs éventuels effets toxiques, en particulier
dans le contexte des écosystèmes aquatiques. La toxicité aiguë des nanotubes de carbone multiparois
a été étudiée en exposant daphnies (D. magna) nouveau-nés à des suspensions de nanotubes de carbone pour une période de 48-h. En outre, les effets de l’acide humique (HA) sur la solubilité et la toxicité
des nanotubes de carbone a été étudiée. Résultats constaté que D. magna ont montré augmentation
de la mortalité à des concentrations plus élevées de la CNT. Spectrophotométrie analyse a révélé que
HA peut être utilisé dans certaines concentrations (8 mg / L de HA, 16 mg / L des NTC) d’augmenter
significativement la durée que NTC rester en suspension. Dans l’ensemble, le facteur déterminant de la
toxicité des nanotubes de carbone semblent être liées à leur capacité à agréger au sein de lasuspension
et de respecter les nouveau-nés, la solubilité de la CNT avait peu d’effet sur leur toxicité pour D. magna.
HA a étéobservée pour inhiber l’agrégation CNT et a ainsi pu réduire considérablement la toxicité des
nanotubes de carbone pour D. magna à des concentrations suffisantes des deux HA et NTC (25 mg / L
de HA, 32 mg / L de NTC).
43
Introduction
Carbon nanotubes (CNTs) are a recently-discovered allotrope of carbon, and they possess numerous unique properties. CNTs have an incredibly
small size, and are actively being researched for
potential medical, electrical and mechanical applications (references). However, relatively little is known
about the potential toxic effects of CNTs in aquatic
systems.
The goal of this project was to investigate the acute
toxicity of CNTs, in addition to the effect of humic
acid (HA) used as an additive, to Daphnia magna (D.
magna). It was hypothesized that, if CNTs were toxic
to D. magna, then greater concentrations of CNTs
would cause higher rates of mortality in D. magna.
Additionally, it was hypothesized that the presence of
HA would increase the toxicity of CNTs to D. magna,
as HA has been found to increase the solubility of
CNTs[1], thus allowing more CNTs to be suspended in
the water column.
Methods
Part A: Toxicity Tests
D. magna adults were cultured according to standardized Environment Canada guidelines for toxicity
testing[2]. D. magna neonates produced by the cultures were used for the acute toxicity tests. Each 48hour acute toxicity test was performed according to
the following procedure:
1. Test solutions were prepared at the desired
concentrations by sonicating mixtures of CNTs,
HA, and reconstituted water (water with specific
ion concentrations that are ideal for D. magna
growth). Reconstituted water was used as the
control solution, and a solution of HA with reconstituted water was used as the solvent-control
solution.
2. 100-mL test beakers were set up in a randomized
block design, with 2-4 replicates for each test concentration.
3. Ten D. magna neonates were transferred into
each of the test beakers.
4. The test solutions were added to the beakers,
yielding a total of 50 mL of solution in each
beaker.
5. The neonates were then examined after 48 hours
of exposure to the solutions, and the immobilized
D. magna were enumerated. Immobilization was
defined as lack of movement or heartbeat after 15
seconds of observation.
44
Part B: Spectrophotometry
Spectrophotometry analysis was performed according to the following procedure:
1. Four solutions were prepared, each with 8 mg/L
of CNTs. The HA concentrations in each solution was 0 mg/L (control), 4 mg/L, 8 mg/L, and 16
mg/L. These solutions were prepared in 250-mL
Erlenmeyer flasks and sonicated.
2. A micropipette was used to transfer 1 mL of each
solution into 1-mL spectrophotometer tubes. For
each solution, a total of 5 mL was transferred into
five replicate tubes. Control tubes were also prepared, containing each respective concentration
of HA without the CNTs.
3. The “0-hour” absorbance at 500 nm was recorded
for each of the tubes from each solution.
4. The tubes were allowed to settle for 48-h, and
their “48-hour” absorbances were recorded.
The immediate results from acute toxicity assays
revealed that D. magna do show a dosage-dependent response to CNTs, with higher mortality at higher concentrations. Specifically, CNTs caused significant toxicity to D. magna at the highest concentration
tested (32 mg/L), (p < 0.05 stats are usually put in the
figure legend) (Figure 1).
Additionally, HA was found to decrease the toxic effect of CNTs (Figure 1), in contrast to the predicted result: this can be observed by the difference in the two data series at 32 mg/L of CNTs. As
further support for this conclusion, the calculated
LC50 values were 23.5 mg/L for CNTs, and 129.8
mg/L for CNTs with HA. Qualitative observations
suggested that this effect was due to HA inhibiting the aggregation of CNTs, and thus preventing
the CNTs from adhering to the D. magna. This inhibition of CNT aggregation is shown in Figure 2.
Using spectrophotometry analysis it was demonstrated that HA not only influences the aggregation
of CNTs, but also their solubility. Figure 3 shows that
adding 4 mg/L of HA to a 16 mg/L solution of CNTs promotes the prolonged suspension of CNTs. However,
adding further HA causes the CNTs to precipitate out
of solution again. Regardless, higher concentrations
of HA that cause CNTs to precipitate out solution are
still effective in inhibiting CNT aggregation.
Figure 4 further supports the conclusion that HA
decreases the toxic effect of CNTs to D. magna.
Analysis through student’s t-tests revealed that test
Figure 1. D. magna neonate mortality versus concentration of CNTs, with a series of solutions containing HA,
and a series of solutions without HA.
Figure 2. Both flasks contain 16 mg/L of CNTs. The left flask has no added HA, while the right flask has 25
mg/L of HA. This figure shows distinct differences in CNT aggregation behaviour between the two flasks.
solution with HA concentrations of 5 mg/L and above
were able to significantly reduce the toxic effects of
CNTs (p < 0.05).
The results from this study will be useful in understanding the possible risks of CNT contamination
in aquatic ecosystems. Additionally, the data gained
from this study will allow for better predictions of how
HA concentrations will affect the behaviour of CNTs
in the environment. Furthermore, the results from this
study suggest that HA could potentially be used to
suspend CNTs for industrial applications, while also
lowering their environmental impact.
Acknowledgements
• Brendan McConkey, Ph.D., Associate Professor
• Richard Frank, Ph.D., Research Associate
• Philip Evans, Research Assistant
• The University of Waterloo
45
Figure 3. The percent decrease of absorption (at 500
nm) for each of four solutions, each containing 16
mg/L of CNTs and varying concentrations of HA. Error bars show +1 standard deviation.
Figure 4. D. magna mortality in solutions with 32
mg/L of CNTs and varying concentrations of HA. Error bars show +1 standard deviation.
Key Words
• Carbon nanotubes: a long, cylindrical nanomaterial composed entirely of networks of
carbon.
• Daphnia magna: a small, aquatic crustacean that
is commonly used as an indicator species.
• Humic acid: an organic acid that comes from the
decomposition of lignin in woody plants.
Bibliography
References
[1] Liu, Yangqiao, Lian Gao, Shan Zheng, Yan Wang, Jing Sun,
Hisashi Kajiura, Yongming Li, and Kazuhiro Noda. “Debundling of single-walled carbon nanotubes by using natural polyelectrolytes.” Nanotechnology 18 (2007).
[2] Environment Canada. “Biological Test Method: Acute Lethalist
Test Using Daphnia spp.” Environmental Protection Series (1990).
46
[3] Chappell, Mark A., Aaron J. George, Katerina M. Donstova,
Beth E. Porter, Cynthia L. Price, Pinheng Zhou, Eizi Morikawa,
Alan J. Kennedy, and Jeffery A. Steevens. “Surfactive stabilizationof multi-walled carbon nanotube dispersions with dissolved
humic substances.” Environmental Pollution 157 (2009).
[4] Olasagasti, Maider, Noelia Alvarez, Carolina Vera, and Sandra
Rainieri. “Evaluation of MWNT toxic effects on daphnia and
zebrafish embryos.” Journal of Physics: Conference Series
(2009): 170.
[5] Roberts, Aaron P., Andrew S. Mount, Brandon Seda, Justin
Souther, Rui Qiao, Sijie Lin, Pu Chun Ke, Apparao M. Rao,
and Stephen J. Klaine. “In vivo Biomodification of Lipid-Coated
Carbon Nanotubes by Daphnia magna.” Environmental Science and Technology 41 (2007).
[6] Schierz, A., and H. Zänker. “Aqueous suspensions of carbon
nanotubes: Surface oxidation, colloidal stability and uranium
sorption.” Environmental Pollution 157.4 (2009): 1088-094.
Review of Toxicity of Carbon Nanotubes in Daphnia
Magna
General comments
This is an excellent study on carbon nanotube (CNT) toxicity to Daphnia magna. As a very new class of
materials, it is crucial to assess their environmental impacts. This paper is a good investigation into the aquatic
toxicity of CNTs. The paper is well written and the conclusions are consistent with the data. In particular, the
interactions between CNTs and humic acid on toxicity are very interesting and an important result.
Abstract
The abstract nicely describes the study and gives the main conclusions. It is succinct and clearly written. However, care should be taken in describing the results of the concentration response to CNTs. This is
because there was only an effect at the highest concentration. Therefore, you cannot really say that toxicity
increases with concentration.
Introduction
The introduction sets the stage for the study. The objectives of the study are clear and the need for the study
is well stated. However, the first paragraph could have provided a little more background on CNTs. In particular,
information on the occurrence and amounts in the environment would be useful.
Methods
Well done. They are very clear and the detail is excellent.
They are very clear. The figures are nicely presented and clear. The effects of humic acid are very clear and
quite interesting. This is actually the result I would have predicted, because many contaminants bind to humic
acid, limiting their bioavailability and toxicity.
In conclusion, this is an excellent study. The author is to be commended on a very interesting paper.
I have provided some comments directly on the manuscript.
Bruce M. Greenberg, Ph.D., Professor, Department of Biology, University of Waterloo
47
Genomics and Biotech
Engineering of LEA genes to Investigate
Enhanced Salt Tolerance
Yun (Jessica) Zou, Shuanglin (Linda) Zhu, Surya Kant, and Steven Rothstein
University of Guelph, Guelph, Ontario
From a young age, Jessica Zou
and Linda Zhu became interested
in the field of scientific research
because each has a parent who
works in the field: for Jessica, her
father, and for Linda, her mother.
In their own individual experiences Jessica and Linda realized the reward in the sense of
accomplishment that they would
be awarded should they to go into
research. Also, science research
appeals to both because of all
the possibilities that come with
discovery, and the limitless questions that one could ask and find
answers to. The duo has a particular interest in their topic of research because they’re intrigued
by the huge impact that genetic
transformation could have on an
organism, in this case, E. coli.
Enhancing the salinity tolerance of crop plants is imperative
to increase agricultural production. Late embryogenesis abundant (LEA) proteins are a group of hydrophilic proteins that
are involved in plant responses to various stresses. However,
whether these proteins can help plants cope with high-salt conditions is not well understood. To gain insight into this potential
function, we examined transgenic Escherichia coli (E. coli) with
introduced LEA 1 (At2g40170; group 1), LEA 4 (At1g32560;
group 4) and LEA 7 (At1g01470; group 7), respectively. How
LEA genes perform in E. coli may shed light on how they work
in plants. The results of the experiment showed that under 800
mmolL-1 NaCl treatment, transgenic E. coli with LEA 1, LEA 4
and LEA 7 had approximately five times more colonies than
did the control strain. Furthermore, the lag phase of E. coli
with LEA 1 or LEA 4 was 12 hours shorter than that of the
control group, and the lag phase of E. coli with LEA 7 was 4
hours shorter than that of the control group. In conclusion, the
protein expression of LEA 1 and LEA 4 can greatly increase
the salt tolerance of E. coli, and that of LEA 7 can moderately
enhance the salinity resistance of E. coli. This experiment produced a promising result indicating that LEA proteins might be
used to genetically improve crops’ salinity tolerance.
Pour augmenter la production agricole des plantes cultivées, il est nécessaire d’améliorer leur tolérance
à la salinité. Les protéines embryogenèse fin abondante (LEA) sont un groupe de protéines hydrophiles
qui sont impliqués dans les réactions des plantes aux stress différents. Cependant, on ne comprend pas
si ces protéines peuvent aider les plantes à faire face aux conditions de haut sel. Pour mieux comprendre cette fonction de potentiel, nous avons examiné Escherichia coli (E.coli) transgéniques avec introduit
LEA 1 (At2g40170; groupe 1), LEA 4 (At1g32560; groupe 4) et LEA 7 (At1g01470; groupe 7), respectivement. Comment effectuer des gènes LEA dans E.coli peut faire la lumière sur la façon dont ils travaillent
dans les plantes. Les résultats de l’expérience ont montré qu’avec moins de 800 mol/L NaCl traitement,
E. coli transgéniques avec LEA 1, LEA 4 et LEA 7 avaient environ cinq fois plus de colonies que la
souche de contrôle. De plus, la phase de latence d’E.coli avec LEA 1 ou LEA 4 était de 12 heures plus
courtes que celle de la souche de contrôle et la phase de latence d’E.coli avec LEA 7 était de 4 heures
plus courtes que celle de la souche de contrôle. En conclusion, l’expression de la protéine de LEA 1 et
LEA 4 peut augmenter considérablement la tolérance au sel d’E.coli et celle de LEA 7 peut augmenter
48
Yun (Jessica) Zou, Shuanglin (Linda) Zhu, Surya Kant, and Steven Rothstein ENGINEERING OF LEA GENES TO . . .
modérément la tolérance au sel d’E. coli. Cette expérience a doté des résultats prometteurs que les
protéines LEA pourraient être utilisées pour l’amélioration génétique de la tolérance au sel des plantes.
Background
Salinity is a leading environmental stress inhibiting plant growth and limiting agricultural production.
Worldwide, approximately half of all existing irrigated
soils are adversely affected by salinization, and the
area of agricultural land destroyed by salinized soils
is estimated to be 10 million hectares per year (Pimentel et al., 2004). The problem of the shrinking
agricultural land is made even more critical by the
persistently growing human population. Fortunately,
introducing exogenous salt tolerant genes into plants
via DNA reconstruction and gene modification has
become a promising way to improve the stress tolerant quality of plants (Xu et al., 1996).
In order to combat excessive salinity, many plants
have developed specific proteins to protect themselves. Late Embryogenesis Abundant (LEA) proteins, a group of hydrophilic proteins that accumulate
to high levels during the late stage of seed development, are among the most successful products of the
evolution for this purpose (Dure et al., 1981; Ingram,
1996). A common feature of LEA proteins is that they
all harbour a biased amino acid composition in which
glutamine is notably over-represented while cysteine,
tryptophan, isolecuine, leucine and phenylalanine are
highly under-represented (Garay-Arroyo et al., 2000).
This biased makeup results in high hydrophilicity and
heat stability in solution, which subsequently evokes
potential mechanisms including retention of water, sequestration of ions, direct protection of other proteins
or membranes and renaturation of unfolded proteinsimportant features necessary to increase the plants’
salinity resistance (Close et al., 1989; Garay-Arroyo
et al., 2000; Wise, 2004).
There are 51 LEA genes in Arabidopsis thaliana, which are subsequently categorized into nine
families by virtue of the similarities in their deduced
amino acid sequences (Bies-Ethève et al., 2008).
To better understand their functions, we transferred the selected genes into E. coli. The reasons
why we used E. coli system were twofold. First,
E. coli possesses the same salt resistant mechanism as some plants since it synthesizes a LEA-like
protein—hydrophilin (Garay-Arroyo et al., 2000).
Second, compared to using other plant expression
systems, using E. coli system is much simpler and
less time-consuming.
Transferring LEA genes of Arabidopsis thaliana
into E. coli might result in obtaining salt-tolerance
improved transgenic E. coli. This would provide evidence of the anti-salinity function of the LEA gene,
and thus confidence for the future biotechnical application of LEA gene for improving salt tolerance.
Materials and Methods
Plant materials and plant growth conditions
Arabidopsis thaliana ecotype Col-0 wild type, Escherichia coli strains DH5α and BL21 star (DE3), and
plasmid pET-28a were used for this study. Plants
were grown under 23oC day/18oC night, 150 μmol
m-2s-1 light intensity, 16h light/8h dark, and 65% relative humidity. Arabidopsis leaves were harvested for
total RNA extraction 21 days after germination.
Cloning of the Arabidopsis thaliana LEA genes
Total RNA was extracted from Arabidopsis seeds
and leaves using Spectrum™ Plant Total RNA Kit
(Sigma-Aldrich®). Following the RNA extraction,
single-strand cDNA was synthesized using qScrip™
cDNA SuperMix (Quanta BioSciences).
In order for the open reading frame (ORF) of the
LEA genes to be amplified, primers with restriction
enzyme sites were designed according to the specific cDNA sequences (Table 1). Amplified fragments
were cloned into plasmid pET28a and transformed
into E. coli strain DH5α. Positive clones were then
selected and sequenced with a DNA Sequencing
System (Applied Biosystems 3730 DNA Analyzer).
Expression of Arabidopsis thaliana LEA genes in E. coli
The constructs containing LEA 1, LEA 4, LEA 7,
or pET28a alone were introduced into E. coli strain
BL21 star (DE3) and grown at 37°C in Luria–Bertani
(LB) media supplemented with 50 gml-1 kanamicin,
respectively. Isopropylthio-β-galactoside (IPTG) was
added to cell cultures (A600 = 0.6-0.8) until a final concentration of 1 mmolL-1 and then the resultant cultures
were grown at 34°C for 4h. Over-expressed proteins
were then detected by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE).
49
Primer
Locus
Gene
L1 F
TTAGGATCCATGGCGTCTCAACAAGAGAAGAAG
At2g40170
LEA 1
L1 R
GAGGAATTCTTAGGTCTTGGTCCTGAATTTGGATTC
At2g40170
LEA 1
L4 F
AAAGGATCCATGCAATCGGCGAAACAGAAG
At1g32560
LEA 4
L4 R
GGGGAATTCTTAGTAGTGATGATGATTATGATGTCC
At1g32560
LEA 4
L7 F
TTTGGATCCATGGCGAGCTTGCTAGAT
At1g01470
LEA 7
L7 R
GGGGAATTCTCAGAAGAAATCTTTAAAAGTAGG
At1g01470
LEA 7
Table 1. The sequences of the forward (F) and reverse (R) primers designed
Salinity tolerance assay
The E. coli BL21 star cells harbouring pET28aLEA 1, pET28a-LEA 4, pET28a-LEA 7, or pET28a
were induced by addition of IPTG as described
above. A 2 ml aliquot of the induced cultures (A600
= 0.8) was incubated in LB medium with or without 800 mmolL-1 NaCl and grown at 34°C. At each
time point, 2 ml of the cultures was harvested and
measured at A600 with a spectrophotometer. The
absorbance was measured three times at each
time point and growth curves were obtained and
compared.
When the induced E. coli cultures in LB medium
reached an A600 value of 0.8, cells were diluted to
1/100 and a 50 µl aliquot was then spread on LB
agar plates with or without 800 mmolL-1 NaCl. After
incubation at 34°C for 48h, colonies appearing on the
plates were counted.
Results
cDNA cloning of LEA 1, LEA 4, and LEA 7 from Arabidopsis thaliana
In order for the LEA genes to be cloned, total RNA
was isolated from Arabidopsis seeds and leaves,
respectively, and the RNA concentration was measured using a spectrophotometer. The ratios of the
absorbance at 260 and 280 nm for RNA from seeds
and leaves were 1.97 and 1.84, respectively, indicating the high purity of the RNA samples.
The quality of extracted RNA was further checked
by running the RNA samples on 1.0% agarose gel.
The 28S and 18S rRNA bands were clear, signifying
successful RNA extraction (Figure 1A).
Although most LEA genes are highly expressed in
plant seeds, there are certain genes showing strongest expression in vegetative tissues or in flowers
(Bies-Ethève et al., 2008). Based on publications,
three LEA genes from three different groups were selected for testing their roles in salt tolerance. Among
50
these three genes, LEA 1 (At2g40170; group 1) and
LEA 4 (At1g32560; group 4) are highly expressed in
the seeds, whereas LEA 7 (At1g01470; group 7) is
predominantly expressed in the leaves (Bies-Ethève
et al., 2008). LEA 1 and LEA 4 were amplified using
RNA extracted from seeds, and LEA 7 was amplified by using RNA extracted from leaves (Figure 1B).
LEA 1 is a 279-bp sequence encoding a protein of
92 amino acid residues, LEA 4 is a 405-bp sequence
encoding a protein of 134 amino acid residues, and
LEA 7 is a 456-bp sequence encoding a protein of
151 amino acid residues.
Expression of LEA 1, LEA 4 and LEA 7 genes in E.
coli
cDNA fragments of LEA 1, LEA 4 and LEA 7 were
ligated into plasmid pET-28a. The constructs of pET28a-LEA 1, pET28a-LEA 4, and pET28a-LEA 7 were
then introduced into E. coli strain BL21 star (DE3)
for protein expression. After induction with IPTG for
4 or 8 hours, total protein extracts from various cell
cultures were analyzed by using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) (Figures 2A and 2B). Over-expression of LEA
1, LEA 4 and LEA 7 genes in E. coli produced protein
bands of approximately 12, 20, and 24 kDa on the
gels, respectively. The results deduced from Figures
2A and 2B affirmed the successful expression of LEA
1, LEA 4 and LEA 7 in E. coli.
Growth performance of transgenic E. coli under high
salt stress in liquid medium
To test the growth performance of the E. coli
transformed with pET28a-LEA 1, pET28a-LEA 4, and
pET28a-LEA 7 in high salinity environment, control
strain transformed with pET28a alone and the three
LEA transformants were grown in LB liquid medium
or LB liquid medium with 800 mmolL-1 NaCl to mimic
a high salt environment. 4 hours after induction, the
Figure 1. Total RNA from Arabidopsis and RT-PCR products of LEA 1, LEA 4 and LEA 7.
A. Seed: 2 µg of total RNA from Arabidopsis seeds; Leaf: 2 µg of total RNA from Arabidopsis leaves.
B. L1: LEA 1 DNA from seeds; L4: LEA 4 DNA from seeds; L7: LEA 7 DNA from leaves.
Figure 2A and 2B. LEA protein expression in E. coli.
28a: Protein expression of E. coli with pET-28a plasmid as the control.
LEA: LEA protein expression of transgenic E. coli.
#h: Hours after IPTG was introduced to induce protein expression.
51
Figure 3: E. coli growth curves.
A. The growth curves of E. coli under normal conditions.
B. The growth curves of E. coli under 800 mmolL-1 NaCl treatment.
samples’ absorbance at 600 nm was measured with
a spectrophotometer every 2 hours for the first 24
hours and every 4 hours afterwards. Under normal conditions, all strains of E. coli shared approximately the same growth rate; the lag phase lasted
about 6 hours, the exponential phase happened
between the 6th hour and the 14th hour, and the stationary phase started at the 14th hour (Figure 3A).
The similar growth rates demonstrated that the overexpressed LEA proteins were not harmful for the
growth of the strains under normal environmental
conditions.
When the lag phases of the control under normal
conditions and that under high salt conditions were
compared, it was evident that the latter was significantly delayed for approximately 38 hours. Therefore, it could be concluded that the high salinity stress
could significantly influence negatively the adaptability of E. coli to the environment because it is during
the lag phase that bacteria adapt themselves to the
growth conditions.
As shown in Figure 3B, the lag phases of the
transgenic E. coli were significantly shorter than
the lag phase of the control. The lag phases of
LEA 1 and LEA 4 were about 32 hours, and the lag
phase of LEA 7 was about 40 hours. Since the
lag phase of the control was 44 hours, after simple calculation, it could be concluded that the lag
phases of LEA 1 and LEA 4 were 12 hours shorter than that of the control, and the lag phase of
LEA 7 was 4 hours shorter than that of the control.
Therefore, the three recombinant strains displayed
52
a stronger tendency to adapt quickly to the stressed
environment.
Growth performance of transgenic E. coli under high
salt stress in solid medium
To confirm the effects of LEA proteins on the salt
tolerance of E. coli, the control and transformed E.
coli with LEA 1, LEA 4 and LEA 7 were grown in solid
LB media with kanamycin and IPTG at 34°C. Kanamycin was added to eliminate negative colonies, and
IPTG added to induce over-production of the LEA
proteins. 800 mmolL-1 NaCl was added in the plates
in Figure 4B to mimic a high salinity environment.
Photos were taken to exhibit bacterial growth pictorially, and the numbers of colonies were counted after
incubation for 20 hours and 48 hours, respectively
(Table 2, Figures 4A and 4B). It could easily be observed that approximately equal numbers of E. coli
colonies were grown in the plates in Figure 4A, confirming that the over-production of LEA proteins did
not inhibit E. coli growth. Furthermore, the plates in
Figure 4B had noticeably fewer E. coli colonies than
did those in Figure 4A. This fact demonstrated that
excessive salinity could inhibit E. coli growth. Figure
4B also demonstrated the significant increase in salinity tolerance in transgenic E. coli. LEA 1, LEA 4
and LEA 7 had, on average, approximately 50 colonies, whereas the control under 800 mmolL-1 NaCl
treatment had only 9 colonies (Table 2). This phenomenon further showed that LEA 1, LEA 4 and
LEA 7 could considerably promote the salt tolerance
of E. coli.
Strains
Normal condition
800 mmolL-1 NaCl
pET-28a (control)
~1000
9
LEA 1
~960
58
LEA 4
~1050
54
LEA 7
~960
39
Table 2. Growth performance of the several recombinant strains of E. coli under either normal or high salt
conditions of solid medium. The numbers refer to the numbers of colonies counted.
Figure 4. E. coli plates under normal conditions and 800 mmolL-1 NaCl treatment.
A. Control and transformed E. coli with LEA 1, 4 and 7 were grown in LB media with kanamycin and IPTG at
34°C for 20 hours.
B. Control and transformed E. coli with LEA 1, 4 and 7 were grown in LB media with kanamycin, IPTG and 800
mmolL-1 NaCl at 34°C for 48 hours.
Discussion
The Late embryogenesis abundant proteins (LEA)
usually amass late in plant seed development, and
also appear in vegetative plant tissues under environmental stress and in desiccation tolerant bacteria
and invertebrates (Hundertmark and Hincha, 2008).
LEA proteins can be divided into 9 different groups
based on the similarities and the differences of their
amino acid sequences. Previous studies have shown
that LEA proteins are rich in hydrophilic amino acids
and alpha helix coils, which in turn enable them to
seize water molecules. This ability is probably crucial to help plants combat salinity, because in a high
salt environment, the water concentration is low;
therefore, the plants need to secure as many water
molecules as possible to prevent themselves from
being dried up. As a result, we hypothesized that
LEA proteins could increase the salinity tolerance
of organisms.
An E. coli expression system was used in this research project to investigate the salinity function of
Arabidopsis LEA proteins from groups 1, 4 and 7. E.
coli was used because this Gram-negative model organism is comparatively easy to grow, to manipulate,
and to multiply. E. coli also synthesizes hydrophillin,
thus making it possible to closely mimic a plant’s salt
resistant mechanism. Using Arabidopsis thaliana alleviated the time restraint imposed upon the project
because the plant has a short life cycle. The pET28a vector was used because it was a bacterial plasmid designed to facilitate the gene cloning and enable the quick production of a large quantity of any
53
LEA 1
LEA 4
LEA 7
# of hydrophilic amino acids
56
76
64
% of hydrophilic amino acids
61
57
42
# of hydrophobic amino acids
36
58
87
% of hydrophobic amino acids
39
43
58
Total # of amino acids
92
134
151
Salt Resistance Level
High
High
Moderate
Table 3. The numbers and percentages of hydrophilic and hydrophobic amino acids of LEA 1, 4 and 7 and their
respective salt resistance levels
desired protein when the promoter was activated by
IPTG.
The experimental data collected and analyzed
shed light on the functions of LEA proteins. It was
shown that salt could negatively affect the adaptability of E. coli, and the protein expression of LEA 1 and
LEA 4 could greatly increase the salt tolerance of E.
coli, and the protein expression of LEA 7 can moderately enhance the salinity resistance of E. coli (Figures 3 and 4). It has been shown that the homologs
of Arabidopsis LEA 1, LEA 2 and LEA 3 from soybean
could significantly increase the salinity tolerance of E.
coli (Lan et al., 2005). In addition, LEA4-1 from Brassica napus, a homolog of Arabidopsis LEA 4, plays
a key role in salt tolerance (Dalal et al., 2008). Our
results about LEA 1 and LEA 4 not only confirmed
part of the findings, but also partially proved the validity of our data.
After obtaining and analysing our experimental
data of LEA 1, LEA 4 and LEA 7, we went a step
further to investigate the essentiality behind the fact
that the protein expression of LEA 1 and LEA 4 had
better effects on increasing the salinity tolerance of
E. coli than that of LEA 7. For this further research,
we decoded the respective amino acid sequences,
acquired the polarity of each individual amino acid,
and compared the percentage of hydrophilic amino
acids. We found that the percentages of hydrophilic
amino acids in LEA 1 and LEA 4 are higher than the
percentage in LEA 7 (Table 3). These data presented
a positive correlation between the percentage of hydrophilic amino acids and the salt resistance of E.
coli, indicating a potential reason for the high effectiveness of LEA 1 and LEA 4 and the mediocre efficiency of LEA 7.
Further investigation is needed because E. coli and
plants, no matter how similar they are in terms of salt
resistant mechanisms, are fundamentally different.
54
Also, it is necessary to test other LEA genes for
their potentials, to transfer LEA genes into Arabidopsis, and finally, to transfer LEA genes into other crops. Concerns about human health should
also be addressed before the genetically improved
crops are placed into the market. Finally, the growth
of these plants should closely be monitored to prevent biodiversity from being disrupted because
of the plants’ artificial advantages over natural
ones.
Conclusion
In conclusion, LEA 1, LEA 4 and LEA 7 can increase the resistance of E. coli under high salt conditions. These proteins thus have high potential for
playing a vital role in enhancing the salinity tolerance
of crop plants, augmenting the efficiency of using
natural resources, and reducing hunger around the
world.
Acknowledgement
We thank Dr. Surya Kant and Dr. Steven Rothstein at the University of Guelph, and Mr. Doug Gajic
and Ms. Brown at Centennial CVI for their supervision and guidance.
References
Bies-Ethève, N., Gaubier-Comella, P., Debures, A., Lasserre, E.,
Jobet, E., Raynal, M., Cooke, R., Delseny, M., 2008. Inventory,
evolution and expression profiling diversity of the LEA (late
embryogenesis abundant) protein gene family in Arabidopsis
thaliana. Plant Mol. Biol. 67, 107-124.
Close, T.J., Kortt, A.A., Chandler, P.M., 1989. A cDNA-based comparison of dehydration-induced proteins (dehydrins) in barley
and corn. Plant Mol. Biol. 13, 95-108.
Dalal, M., Tayal, D., Chinnusamy, V., Bansal, K.C., 2008. Abiotic
stress and ABA-inducible Group 4 LEA from Brassica napus
plays a key role in salt and drought tolerance. J. Biotechnol.
139, 137-145.
Dure III, L., Greenway, S.C., Galau, G.A., 1981. Developmental
biochemistry of cottonseed embryogenesis and germination:
changing messenger ribonucleic acid populations as shown by
in vitro and in vivo protein synthesis. Biochemistry 20, 41624168.
Garay-Arroyo, A., Colmenero-Flores, J.M., Garciarrubio, A. et al,
2000. Highly hydrophilic proteins in prokaryotes and eukaryotes are common during conditions of water deficit. J. Biol.
Chem. 275, 5668-5674.
Hundertmark, M., Hincha, D.K., 2008. LEA (Late Embryogenesis
Abundant) proteins and their encoding genes in Arabidopsis
thaliana. BMC Genomics 9, 118.
Ingram, J., Bartels, D., 1996. The molecular basis of dehydration
tolerance in plants. Annu Rev Plant Physiol Plant Mol. Biol.
47, 377-403.
Lan, Y., Cai, D., Zheng, Y.Z., 2005. Expression in Escherichia coli
of three different soybean late embryogenesis abundant (LEA)
genes to investigate enhanced stress tolerance. J. Integr Plant
Biol. 47, 539-603
Pimentel, D., Berger, B., Filiberto, D. et al, 2004. Water Resources:
Agricultural and Environmental Issues. Biosci. 54, 909-918.
Wise, M.J., Tunnacliffe, A., 2004. POPP the question: what do LEA
proteins do? Trends Plant Sci. 9, 13-17.
Xu, D., Duan, X., Wang, B., Hong, B., Ho, T.H.D., Wu, R.,
1996. Expression of a late embryogenesis abundant protein gene, HVA1, from barley confers tolerance to water
deficit and salt stress in transgenic rice. Plant Physiol. 110,
249-257.
55
Review of Engineering of LEA genes to Investigate
Enhanced Salt Tolerance
The authors have taken a very simple but effective approach to studying the role of plant LEA genes in salinity stress. I found the manuscript was well written and the experiments were quite rigorous. The conclusion is
that overexpression of LEA genes in E. coli confers an increased salt tolerance to the bacteria. This conclusion
is sound. I have a few comments below but overall, I liked the study.
Comments
1. Second paragraph in Background section: Did plants evolve LEA proteins to protect against salinity or did
they evolve them as a way to protect the embryo during seed desiccation? If the author’s logic is correct
and LEA genes are present as a protective mechanism then I think plant species that have never evolved
in saline soils would not have LEA genes as they would not be selected for. I believe that all plant species
looked at so far have LEA genes, so these proteins must have a more fundamental function beyond stress
protection.
2. I think the authors can state their setup for studying LEA gene function in E. coli more explicitly. They are
correct in stating that LEA genes are thought to have roles in “mechanisms including retention of water, sequestration of ions, direct protection of other proteins or membranes and renaturation of unfolded proteins”.
However, much of this is correlative and has not been directly proved. Putting the genes into an experimentally tractable system such as E. coli allows one to now direct test mechanism.
3. I would like a better explanation of why they picked the three LEA genes out of a possible 51 in the Arabidopsis genome.
4. The results in Figure 3 and Table 2 are compelling but have no statistical analysis. I assume the growth
curves were done at least three times so Standard Deviations can be added to the data.
5. The authors did a nice analysis of why LEA1 and LEA4 may be better salinity protectors than LEA7. However, they never connected that their two best LEA genes are the ones expressed in the seed versus LEA7,
which is vegetative. They should comment on this and think about the seed environment as to why this
might be. This comment related back to comment 1.
6. The authors concerns about GMO and biodiversity at the end of the Discussion are far beyond the nature of
this study and appear to be a personal opinion. This section should be removed as these issues are more
ecological or at best a social issue than mechanistic. I think a better line of comment is why overexpression
of LEA genes in E. coli has no developmental drag on the bacteria even when it is not under salt stress. If
you think about all the processes that LEA genes are supposed to be involved in, this is surprising. Can the
authors comment on a system that protects the organism under environmental stress but has no negative
consequences under optimal conditions?
Peter McCourt, Ph.D., Department of Cell & Systems Biology, University of Toronto
56
Judy Letourneau NRC RESEARCH PRESS BACK FILES: NOW OPEN ACCESS FOR CANADIANS
Teaching Resources
NRC Research Press Back Files:
Now Open Access for Canadians
Judy Letourneau
Canadian Science Publishing, Ottawa, Ontario
Ottawa, Canada – On January 1, 2011, over 100,000
back files of NRC Research Press journals became
Open Access for all Canadians (with the exception
of newly released Canadian Journal of Fisheries and
Aquatic Sciences phase 2, 1901–1979, and Canadian Journal of Research).
Cameron Macdonald, Executive Director of Canadian Science Publishing, says this is an important step
forward for NRC Research Press. “As the Canadian
leader in scientific publishing it is our commitment to
Canadians that they have access to some of the finest
research published. The NRC Research Press back
files, dating back to 1951, cover fields ranging from
botany to physics, and we are proud to offer all Canadians full Open Access to this important resource.”
The journals to offer Open Access back files are
Biochemistry and Cell Biology; Botany; Canadian
Geotechnical Journal; Canadian Journal of Chemistry; Canadian Journal of Civil Engineering; Canadian
Journal of Earth Sciences; Canadian Journal of Fisheries and Aquatic Sciences (phase 1, 1980–1995);
Canadian Journal of Forest Research; Canadian
Journal of Microbiology; Canadian Journal of Physics; Canadian Journal of Physiology and Pharmacology; Canadian Journal of Zoology; and Genome.
Canadian Science Publishing is a not-for-profit
publisher, under the name of “NRC Research Press,”
of 15 journals. By offering Canadians Open Access
to its back files, NRC Research Press is reinforcing its position as the leading scholarly publisher in
Canada. The organization also provides publishing
services to another 11 journals, including Canadian
Aeronautics and Space Journal and Canadian Journal of Remote Sensing.
About the Publisher
Canadian Science Publishing, (http://nrcresearchpress.com), is the foremost scientific publisher in
Canada and one of the most advanced electronic
publishing services in the world. With over 50 highly
skilled experts and an editorial staff comprising some
of the world’s leading researchers, NRC Research
Press (Canadian Science Publishing) communicates
scientific discoveries to over 100 countries, and
publishes 15 journals, with more than 2000 manuscripts each year, in a broad range of scientific
disciplines. All journals are available online fulltext and are accessible before print publication.
Disclaimer
Canadian Science Publishing operates under
the brand NRC Research Press and is not affiliated
with the National Research Council Canada. Articles
published by Canadian Science Publishing are
peer-reviewed by experts in their field. The views of
authors in no way reflect the opinions of Canadian
Science Publishing or the National Research Council
of Canada. Requests for commentary about the
contents of any study should be directed to the
authors.
For more information, contact:
Judy Letourneau (Canadian Science Publishing,
Ottawa, ON)
Email: [email protected]
Phone: 613-993-0151
57
Modus Operandi
A Career in Applied Mathematics
Greg Lewis
Associate Professor of Mathematics, UOIT
Would you like to work in the “best” profession? If
you were thinking that would mean being a doctor or
a lawyer, you would be wrong. In fact, you would be
a mathematician, according to a study that compared
200 occupations based on five criteria: environment,
income, employment outlook, physical demands and
stress. The study, carried out by Les Krantz, author of
“Jobs Rated Almanac”, was released on CareerCast.
com, and was the topic of an article that appeared in
the Wall Street Journal (http://online.wsj.com/article/
SB123119236117055127.html?mod=yhoofront).
Perhaps you are wondering what work you would
be doing in the best profession. It turns out that the
answer to this requires a little explanation, as mathematicians can be found in a wide variety of companies, in a number of different sectors.
For instance, many mathematicians work in the financial sector, in particular for banks and investment
firms. They may have a variety of responsibilities,
including evaluating the risk associated with the purchase of a certain stock, or determining the price of
various financial products, such as stock options, or
other financial ‘derivatives’.
There are also many mathematicians who work in
the pharmaceutical industry. Their jobs can involve
creating and solving mathematical models to aid in
the development of new drugs, or applying algorithms that search through large sets of data to determine, for instance, which chemical compounds tend
to have the desired effect on a given disease. The
last of these activities, which is referred to as ‘data
mining’, is a procedure that involves extracting the
important information from very large sets of data;
essentially it is an efficient way of looking for a needle-in-a-haystack. Data mining is also used in other
biomedical applications, as well as other areas, such
as marketing.
In the manufacturing sector, you may find mathematicians in teams that develop products and processes, that find ways of improving the quality and
efficiency of the manufacturing process, and that
58
solve the ‘supply-chain problem’, which attempts to
optimize the entire process that takes a product from
the manufacturer to the customer. Mathematics can
be particularly useful for saving a company time and
money in product development, because mathematical models can be used to evaluate ideas before
an often very expensive physical prototype is constructed and tested. This is particularly important in,
for example, the automotive, aircraft, or aerospace
sectors.
You will also find mathematicians in software development, creating software that, for instance, robustly and efficiently solves problems of interest for a
variety of companies and/or individuals, or you’ll find
them in government agencies studying the potential
effects of, and potential methods for the mitigation
of, a bioterrorism attack, or studying the dispersion
of radio-active material after an nuclear attack or an
accident at a nuclear power plant. Mathematicians
are also found in hospitals developing medical imaging techniques, or modeling the growth of tumors.
As a mathematician, you could also work in climate
modeling or weather prediction, because these fields
involve the numerical computation of large-scale
mathematical models.
With the emergence of the critical need to develop
renewable energy sources, many companies have
begun to see that they can help society while creating
a successful business. The skills of a mathematician
are particularly suited to contribute in this area. You
will find many mathematicians, for instance, helping
to develop fuel cells that could be used to make automobiles run on an efficient renewable fuel source.
If your ambition has always been to work in the
Hollywood film industry, enrolling in a math degree
might actually help you get there! Have a look at the
internet page of Rhythm & Hues (www.rhythm.com),
a company that produces visual effects for Hollywood
block-busters; you can also look them up on the Internet Movie Data Base (www.imdb.com). The specialists in visual effects and computation working for this
Greg Lewis A CAREER IN APPLIED MATHEMATICS
California-based company have produced scenes
for films like Superman Returns and X-Men. Who
founded this company and who makes the graphics
that keep millions on the edge of their seats? The
founders are an engineer, a computer scientist and
... a mathematician.
There are many companies who require the use of
mathematicians, but do not hire them directly. This is
the domain of the consulting companies, which perform many of the tasks discussed above, but work on
a contract basis with a given company. Working for a
consulting company will sometimes involve changing
areas of application many times.
These are just a few of the possibilities. In fact,
mathematics is used, and thus there is a need for
mathematicians, in almost every sector. For more
examples and information, you can see the Society
for Applied and Industrial Mathematics (SIAM) Careers Page (http://www.siam.org/careers/).
Although mathematicians can be found in a variety of sectors, generally, there is a commonality in
the kind of work they do. In particular, a mathematician’s job often involves the development and numerical computation of mathematical models that are
formulated using (partial, ordinary or stochastic) differential equations, combinatorics, and graph theory,
and often involves the use of various types of statistical, dynamical and optimization analysis techniques.
Problem-solving is usually an important part of the
job, and often, if not usually, the use of computers is
required.
Another commonality is that positions that require
mathematics training are often intellectually stimulating. Two of the fundamental skills that mathematicians develop as they obtain their degrees are their
problem-solving ability and the ability to think abstractly. Because these skills are often very useful for
a company, mathematicians are often hired specifically for these intellectual attributes. Therefore, the
jobs usually require the application of these skills,
and thus involve continuous learning and creative
thinking. It might be said that the tool that is most
important to mathematicians is their brain.
For the most part, companies do not have large
groups of mathematicians working together, but
mathematicians tend to work as members of multidisciplinary groups. Furthermore, many of the jobs, for
which mathematicians are hired, are not titled ‘mathematician’. As the SIAM Careers Page states, “applied mathematicians and computational scientists …
often hold jobs with titles such as statistician, scientific
programmer, electrical engineer, computer scientist,
operations researcher, systems engineer, analyst, research associate, or technical consultant.” Perhaps
this has led to the idea that there are fewer jobs for
mathematicians than is the case.
Of course to become a mathematician you have to
go to university and be taught by a mathematics professor. The job of a professor, however, is not only to
teach mathematics courses, but also to mentor students in research projects, and to conduct research of
their own. The research that you could undertake as
an applied mathematics professor spans a stunning
range of possibilities. You could work on the cutting
edge of research, and, in the process, develop the
methods necessary to solve problems in any of the
above areas, and perhaps many more yet to be integrated. You could work in applications spanning all
of the above fields, but also in other, more academic
areas, such as, among many others, neuroscience,
which is the science dedicated to understanding how
the brain works.
Many people would say that the problems of the
future lie at the boundaries between disciplines, and
thus will be solved using an interdisciplinary approach. Because mathematics is the language of all
quantitative analysis, it, perhaps more than any other
single field, will be necessary for the solution of these
problems. Applied mathematicians are positioned
not only to have the best profession, but also to be
the most in-demand.
For further reading, you should check out SIAM’s
Why Do Math? website (http://www.whydomath.org),
which describes in-depth descriptions of several applications of mathematics that have made a significant impact on society.
59
Pathways
My life is FIT
Michael Kasperovich
Computer Science Student, York University
Hello, my name is Michael Kasperovich. I am currently a first year student at York University in the Computer Science program. I have always known I would
go down this road ever since I was a kid. My journey
started when I was around 5 years old, in the 1990’s.
A home computer back then was pretty amazing, and
my father managed to wrap his hands around one. As
a young boy who often watched action movies involving cool computer technology and hacking, I thought I
would become something along the lines of a hacker
when I grew up. I often had this craving to learn anything about computers, even if it was boring. My father
taught me the basic knowledge he could pass down to
a 5 year old; yes, he taught me Microsoft Word, which
made me feel amazing at computers-- mostly because
no one else had one.
Years passed, and by the age of 15 ,I still only knew
Microsoft Word. My journey into the world of computers
would continue at my High School (Northview Heights
Secondary School), where for the first time I started
taking computer courses. My first Computer Science
course was grade 10 Computer Science, and that
course was what got me hooked into wanting to pursue
this career. The course taught a little bit about hardware, and the logic of computer software, and so for the
first time in my life, I was able to look at a computer and
have a basic understanding of its components beyond
it being “a box with wires, circuits and computer chips”.
I also came to understand that software and OS are
not magical, viruses aren’t monsters, and everything
makes logical sense in a computer. Already hooked on
silicon, I decided to continue taking computer courses,
and over the next years, I took most of the Focus on IT
(FIT Program) courses at my school: grade 11 and 12
Java, and grade 11 and 12 Computer Networking, both
of which I found extremely helpful.
When my High School career ended, and I moved
on to a University, I found it to be the complete opposite
of what High School used to be: no one cares aboutwhether you do anything or not; no one cares whether
you study, go to lectures, or write tests and exams;
60
there are no more teachers standing by and holding
your hand every step of the way. The transition from
High School to University is a little bit of a shock. Having
a very good base of the FIT Program and Computer Science gave me a definite advantage over the hundreds
of other students going into this field without that base
knowledge. As I started my first year in university, I found
it that I was ahead of other students in various ways.
As a first year Computer Science student, one of my
courses is in fact called “Java, the Client Side Approach”, where the first year Computer Science students
learn basic Java. Already one can see that taking the
Java Courses in High School is a benefit to my grades,
because I know above and beyond the basics of Java.
The university course moves extremely quickly with
three lectures and a lab each week, where about two
lectures cover one entire 50 page chapter, and a 50
page chapter in a Java book is not exactly a pleasant
reading material before sleep. That one course not only
requires reading, but also a complete understanding of
the topic and on top of understanding the topic, you
need to spend your own time programming in Java,
which without any assistance can be insanely difficult
or impossible. Of course, there are always Teacher Assistance and Labs open at York, but that means dedicating free time to commute there and do the work.
Knowledge from grade 12 Java has made my first
half of this semester at a University more relaxed. Unlike others in my class who have never taken computer
courses before, I do not feel as stressed about the
subject. However, although programming in Java isn’t
going to be the virtue of my life, as I start my career, I
have many ways to go in Computer Science, The first
year in this subject teaches the basics, then the university gives choices to follow. Having a concrete understanding of how the world of computers works from my
High School years, combined with the knowledge I get
from the courses in the university, makes it a lot easier
to decide what I want to do in life. Interestingly, without
the FIT program at my school I would have never gone
down this path in life.
656 Pages 2009
Softcover / Édition brochée
ISBN-13 9780660198583
NRC / CNRC 49730
CAN$34.95 / 34,95 $CAN
Other Countries: US$34.95 / À l’étranger : 34,95 $US
164 Pages 2008
Spiral Bound / Reliure spirale
ISBN-13 9780660197982
NRC / CNRC 49723
CAN$59.95 / 59,95 $CAN
270 Pages 2009
Hardcover / Édition reliée
ISBN-13 9780660198941
NRC / CNRC 49731
CAN$49.95 / 49,95 $CAN
More Items to Consider from / Plus de livres à retenir du NRC Research Press
Special Price / prix spécial
CAN$29.95 each / 29,95 $CAN chacun
Quote order number / numéro de commande devis
CYSJ-2011
Shipping and handling extra. Canadian customers add
GST. Prepayment required. Cheques or money orders should
be made payable to:“Canadian Science Publishing”
. For all
orders outside Canada, rates are in U.S. dollars.
Frais d’expédition et de manutention en sus
. Clients
du Canada, ajoutez la TPS. Les commandes doivent être
payées d’avance. Les chèques ou mandats doivent être
libellés à l’ordre du « Éditions Sciences Canada
». Pour
les commandes hors-Canada, les tarifs sont en dollars
américains.Vente ferme.
TO ORDER BOOKS /
POUR COMMANDER
Bureau des commandes
Telephone/Téléphone :
613-990-7873
E-mail/Courriel :
[email protected]
Order online /
Commandes en ligne :
www.nrcresearchpress.com
It’s a wired world. Those who keep pace with changes in technology will lead the future. The Focus on
IT (FIT) Program was created with industry and Communications Technology (ICT) skills.
FIT can provide a jump-start to post-secondary education in the exciting and dynamic world of ICT.
Through FIT, high school students explore ICT as a career option while gaining valuable technical and
business skills. Developed by the Information and Communications Council (ICTC), FIT prepares secondary school students with technical and employability skills, including industry recognized certifications.
FIT gives secondary school graduates an educational advantage that can lead to challenging and
rewarding careers in popular new ICT fields such as database technology and network security.
For more information check out www.discoverit.org or ask someone at your school about FIT today.

canadian young scientist journal canadian young scientist journal

Transcription

Documents pareils

Venez dire NON aux LGV Réunions publiques

Grosvenor House, London, Coronation Menu, 1953

Licences sélectives

L`usage d`une calculatrice est

http://geology.19thcenturyscience.org/books/1906-Merz

areva np - lea

Mme Marie GOY Le Bouton d`Or 1224 Route du Col des Aravis

Elle au dessin, lui au st,lo, le beau duo

Livre d`or extrait - Coordination pour l`Afrique de demain

communiqué la pêche, le 12 mars 2013 une 2e arrestation qui mène