Identification d`un récepteur à l`odeur d`œstrus chez le rat

Commentaires

Transcription

Identification d`un récepteur à l`odeur d`œstrus chez le rat
Rapport de stage du 18 avril au 16 juin 2016
Identification d’un récepteur à l’odeur d’œstrus chez le rat
Louis Richevaux
Université Paris-Saclay / Université de Versailles St-Quentin-en-Yvelines
Master 1 Biologie Santé – Année 2015-2016
Etablissement d’accueil : Institut National de la Recherche Agronomique (INRA) – Domaine
de Vilvert, Jouy-en-Josas, France
Unité de recherche : UR1197 Neurobiologie de l’Olfaction (NBO) – Bâtiment 230
Site internet : www.jouy.inra.fr/nbo/
Stage encadré par :
Mr. Patrice CONGAR, chargé de recherche.
Rendu le 9 juin 2016
Soutenance le 20/21 juin 2016
L’INRA est un organisme français de recherche publique qui s’intéresse à
l’agronomie, à l’alimentation, et à l’étude des plantes et des animaux. Son but est d’apporter
des solutions à des enjeux actuels tels que les changements climatiques, l’alimentation
humaine, l’épuisement des ressources non renouvelables (fossiles) en intégrant économie,
société et environnement.
Dans le cadre de mon stage, j’ai intégré l’unité de Neurobiologie de l’olfaction (UR
1197) dont un des objectifs est de comprendre le sens qu’est l’olfaction à travers des modèles
murins comme la souris ou le rat. L’olfaction est un sens très important chez la plupart des
animaux, et l’unité cherche à comprendre ses bases neurobiologiques qui permettent la
détection et la discrimination des odeurs ainsi que la plasticité et l’adaptation du système
olfactif. Mais leur intérêt se porte également sur son impact sur la physiologie de l’animal et
son comportement, et inversement l’impact de l’état physiologique d’un individu, comme son
état nutritionnel ou son stress, sur sa capacité à percevoir les odeurs.
Remerciements :
Mr Patrice CONGAR, Mr Adrien ACQUISTAPACE et Mme Guenhaël SANZ pour
leur disponibilité et leur confiance, Mr Nicolas MEUNIER pour son aide lors de la recherche
de ce stage, l’ensemble des personnels, chercheurs, techniciens de l’unité NBO et de l’INRA
de nous avoir accueilli, moi et mes camarades stagiaires.
Identification d’un récepteur à l’odeur d’œstrus chez le rat
Louis Richevaux
Sommaire
Résumé
&
Abréviations…………………………………………………………………………...1
Introduction…………………………………………………………………………………………2
1. Contexte de la recherche……………………………………………………………………….2
2. Le
système
olfactif……………………………………………………………………………....2
3. Quantification de l’activité neuronale et identification d’un récepteur………………....
3
4. Etudes précédentes……………………………………………………………………………...4
a) Etude chez la souris……………………………………………………………………
4
b) Electro-olfactogramme………………………………………………………………. 5
5. Objectif…………………………………………………………………………………………...5
Matériels
et
méthodes……………………………………………………………………………...6
1. Préparation des cellules dissociées ………………………………………………………….
6
a) Dissection…………………………………………………………………………….... 6
b) Dissociation des cellules………………………………………………………………
6
2. Fluorescence et observation au microscope inversé……………………………………….
7
a) Marqueur fluorescent………………………………………………………………….
7
b) Microscopie inversée…………………………………………………………………. 7
3. Prélèvement des cellules……………………………………………………………………….
7
4. RT-PCR sur cellule unique ……………………………………………………………………
8
a) Reverse Transcription RT……………………………………………………………..
8
b) Nested PCR…………………………………………………………………………….. 9
c) Migration sur gel……………………………………………………………………… 9
Résultats……………………………………………………………………………………………
10
1)
Identification
des
cellules
d’intérêt……………………………………………………………10
2)
Prélèvement
des
cellules………………………………………………………………………..11
3)
Résultats
de
la
RT-
PCR…………………………………………………………………………12
Discussion et perspectives……………………………………………………………………….14
Bibliographie………………………………………………………………………………………18
Résumé
L’olfaction est un sens primordial dans la majorité des espèces animales. En effet
nombre de signaux sociaux sont véhiculés par ce sens, par exemple lors des phases de
reproduction. Lors de ce stage, nous avons cherché à identifier et prélever les neurones
olfactifs de rat répondant à une odeur spécifique de la période d’ovulation des femelles, dite
œstrus : la 6-méthyl-5-hepten-2-one (ou méthylheptenone MH). Pour détecter les neurones
répondant à la MH, nous avons utilisé une approche d’imagerie calcique sur des cellules
dissociées de muqueuse olfactive de raton. Les neurones isolés sensibles à la MH ont été
prélevés et nous avons ensuite essayé d’extraire de ces neurones le récepteur olfactif
spécifique à cette odeur d’œstrus par une technique de RT-PCR « Nested » sur cellule unique.
Le but serait de permettre, à terme, la conception de biosenseurs à base de récepteurs olfactifs
pouvant détecter les périodes de fécondité des femelles dans les élevages, via la détection
d’odorants, et de ce fait améliorer la gestion et l’efficacité de la reproduction au sein des
élevages de rente.
Abréviations : ADNc : ADN complémentaire, BET : bromure d’éthidium, BO : bulbe
olfactif, EO : épithélium olfactif, KCl : solution saline enrichie en chlorure de potassium,
MH : 6-méthyl-5-hepten-2-one (méthylheptenone), MO : muqueuse olfactive, MOP : mélange
de 12 odorants, NO : Neurone olfactif, RCPG : récepteur couplé aux protéines G, RT : reverse
transcription, RO : Récepteur olfactif, PCR : polymerase chain reaction, SN : salin normal,
TAE : Tris Acetate EDTA.
1
Introduction
1. Contexte de la recherche
La vie animale est régie de manière prépondérante par l’interaction entre les individus,
en effet, ces interactions sont les fondements de la société et jouent un rôle important dans la
survie de chaque espèce, notamment lors des périodes de reproduction. Dans beaucoup
d’espèces l’odorat est un des sens les plus développés et cette interaction entre les individus
repose en grande partie sur ce sens (partie 2).
Dans les espèces mammifères, la femelle suit un cycle précis de production de
gamètes qui délimite des périodes pendant lesquelles elle est fécondable et donc où la
conception est possible, notamment la période d’ovulation, dite œstrus. Il a été montré que
lors de cette période d’œstrus, la femelle émettait certaines odeurs en plus grande quantité, et
qui serait donc spécifique de cette période. Parmi ces molécules odorantes la 6-méthyl-5hepten-2-one (méthylheptenone MH) (Nielsen et al. 2013) est retrouvée chez le rat, le renard
et le cheval, et la trans-5-heptèn-2-one chez la souris (Schwende et al. 1984). Ces odorants,
quand ils sont perçus par les rats mâles, déclenchent alors des comportements sexuels incluant
érections (Nielsen et al. 2013), comportements de type parade nuptiale destinés à préparer
l’accouplement et la reproduction.
2. Le système olfactif
2
Les odeurs sont des composés
chimiques volatiles capables de se
fixer sur des récepteurs spécifiques
situés à la surface des neurones
Figure 1 – Organisation cytologique du système olfactif
olfactifs. Ces neurones sont situés au primaire – OM : muqueuse olfactive, OE/EO : épithélium
olfactif, SES : cellules de soutient, ORNm : neurones
niveau de l’épithélium olfactif (EO, olfactifs matures, ORNi : neurones olfactifs immatures
schéma figure 1) entre d’autres types cellulaires comme des cellules de soutien ou des cellules
progénitrices destinées au renouvellement des neurones. L’EO recouvre le cartilage des
cornets nasaux de la cavité nasale des mammifères. Les neurones olfactifs se projettent au
niveau des glomérules du bulbe olfactif (BO) après avoir traversé la lame criblée, c’est le
premier relais de l’information olfactive dans le système nerveux périphérique (figures 1 et 2).
Le BO se projette ensuite à son tour dans le système nerveux central au niveau des régions
sensorielles associées à l’olfaction comme le tubercule olfactif ou le cortex pyriforme.
Figure 2 – Schéma du système olfactif chez le rat
Les molécules odorantes se fixent à des récepteurs couplés à des protéines G (RCPG)
spécifiques : Golf, exprimés à la surface des neurones olfactifs (NO). Chaque neurone exprime
un seul type de RCPG olfactif (RO) parmi plusieurs centaines, voire plus de 1000 chez la
souris ou le rat. La reconnaissance d’un odorant par un neurone olfactif déclenche
principalement une cascade de transduction dépendante de la protéine Golf. Celle-ci induit
l’activation de l’adénylate cyclase 3 qui transforme l’ATP en AMPc. Cet AMPc va ensuite
déclencher l’activation de canaux CNG (cyclic nucleotide gated channel) qui permettent
l’entrée d’ions Na+ et Ca2+ dans
la
cellule
et
également
l’activation de la PKA qui
permet
l’inactivation
du
3
Figure 3 – Schéma de la
transduction olfactive
récepteur. L’accumulation de Ca2+ dans la cellule active des canaux chlore Cl- (figure 3), l’ion
va alors sortir de la cellule en fonction de son gradient transmembranaire. L’entrée de cations
Na+ et Ca2+ et la sortie de l’anion Cl- entraine une dépolarisation de la membrane du neurone
et la genèse un potentiel récepteur, qui pourra, si l’intensité de stimulation est suffisante,
conduire à l’émission d’un potentiel d’action.
3. Quantification de l’activité neuronale et identification du récepteur.
Afin de quantifier et d’observer l’activité neuronale déclenchée par un stimulus
olfactif et d’identifier les cellules répondantes, sur tissu dissocié, la quantité de messagers
intracellulaires impliqués dans cette activité est évaluée. Le Ca2+ est un des messagers qui
s’accumulent dans la cellule lors de cette activation neuronale, il peut être quantifié et
visualisé grâce à certains marqueurs fluorescents comme le Fura2-AM (Touhara et al. 1999)
ou le fluo 4 (voir Matériel et méthodes) par des approches d’imagerie cellulaire.
Une fois un neurone répondant à une odeur identifié grâce aux marqueurs, celui-ci est
prélevé et une RT-PCR sur cellule unique (voir Matériel et méthodes) est pratiquée pour
identifier l’ARNm et ainsi le récepteur spécifique à l’odeur d’intérêt.
4. Etudes précédentes
a) Etude chez la souris
En travail préliminaire, le laboratoire a utilisé des approches similaires à celles qui
seront développées dans ce rapport pour la recherche de RO connus et exprimés chez la
souris. Les récepteurs i7 de souris sont sensibles à l’heptanal et ont été exprimés en
association avec la GFP dans l’objectif de mettre au point un protocole permettant
l’identification d’un RO répondant à une molécule odorante d’intérêt. Les chercheurs ont
donc trouvé au sein de tissus dissociés des NO GFP positifs qui présentaient des réponses
Figure 4 – Neurone GFP positif de souris à gauche et réponses à différentes stimulations au
cours du temps (en niveaux de fluorescence)
4
calciques à l’heptanal.
Sur les quelques neurones GFP positifs qui ont pu être prélevés, des RT-PCR de type
Nested mono-cellule (développé en Matériel et Méthodes) ont été effectuées en ciblant le
récepteur connu i7 ainsi que la β-tubuline III (une protéine spécifique des neurones) (Figure
5).
Cependant, ce modèle de souris présentait une fiabilité relative puisque les résultats
étaient peu reproductibles et les préparations de cellules ne permettaient qu’un rendement
faible. Il s’est alors imposé qu’un autre modèle devait être développé et le modèle rat a été
choisi puisqu’en étant relativement proche de la souris il permettrait d’utiliser des protocoles
relativement similaires.
b) Electro-olfactogramme
Une étude précédente effectuée par un stagiaire du laboratoire a montré des réponses
Figure 5 – Nested PCR sur les ADNc i7 et β-tubuline III
Figure 6 – Résultats d'un EOG après stimulation par la MH : l’intensité de couleur
représente l’intensité de réponse (en mV) à la stimulation (partie droite et basse de la figure)
de certaines zones spécifiques de la muqueuse olfactive à des stimulations par la
méthylheptenone dans des expériences d’électro-olfactogramme, une technique permettant la
détection de champs électriques locaux au niveau de la muqueuse olfactive et traduisant une
activité neuronale en réponse à des odorants.
5
Cette expérience a permis de montrer que la zone antéro-ventrale des cornets olfactifs
IIb et III présentait une augmentation d’activité en réponse à une stimulation à la MH, il
convient donc d’utiliser ces zones pour des expériences de cellules dissociées.
5. Objectif du stage
L’objectif de ce stage fut donc d’identifier des neurones répondant à l’odeur d’œstrus
MH dans un modèle de rat grâce à la technique d’imagerie calcique sur des cellules dissociées
d’épithélium olfactif de ratons et immobilisées sur lamelles. Les NO répondants sont prélevés
et les ARNm extraits pour identifier le RO sensible à la méthylheptenone par une technique
de RT-PCR sur cellule unique.
Matériels et méthodes
1. Préparation des cellules dissociées
a) Dissection
a
Des ratons Wistar de 7 à 15 jours sont
euthanasiés par décapitation. La boite crânienne
est ouverte en deux avec un scalpel selon l’axe
sagittal et les cavités nasales dégagées (septum
et membranes) pour laisser apparaitre les cornets
olfactifs (figure 7 ci-contre). Les parties ventrale
et médiane des cornets IIb et III sont prélevés et
b
disséquées dans une solution saline normale (SN
– composition détaillée en annexe : tableau S1)
froide (4°C) afin de séparer la muqueuse
olfactive du cartilage sous-jacent en maintenant
les cellules en vie. Ces deux cornets ont été
I
IIa
IIb
III
IV
montrés comme particulièrement répondants à la
MH
dans
des
expériences
d’électro-
olfactogramme (figure en 6 introduction).
Figure 7 – a) Coupe sagittale d'une tête de
raton, b) Schéma des cornets olfactifs chez
le rat, cornets d’intérêt encadrés en rouge
b) Dissociation des cellules
Une fois la muqueuse isolée, elle est plongée d’une solution de dissociation (Hank’s
Dissociation Buffer, papaïne 20U/mL, L-cystéine 500mM, 400µL, activée au bain-marie 15
6
minutes avant ajout des tissus) au bain-marie pendant 15 minutes. La dissociation à l’aide de
la papaïne est arrêtée par l’ajout de sérum de veau fœtal (protéines en large excès) puis une
fois les tissus retombés au fond du tube
après homogénéisation, le surnageant est
remplacé par une solution de rinçage
(Hank’s
Dissociation
Buffer,
DNase1 100U/Ml, 800µL) homogénéisée
par quelques reversements de tube. Le
surnageant est à nouveau éliminé et
remplacé par 800µL de SN. 400µL de
solution contenant les tissus dissociés par
trituration à la pipette de verre rodée sont Figure 8 – Spectre d'excitation (en nm) du
déposés à travers un tamis de 40µm Fura2-AM en fonction de la concentration en
calcium
(Falcon) sur des lamelles en poly-L-lysine
(protocole de préparation en annexe) montées dans des chambres d’enregistrement en
microscope inversé et laissés à sédimenter 1h à l’obscurité et à température ambiante.
2. Fluorescence et observation au microscope inversé
a) Chargement et marqueur fluorescent
Les 400µL de solution de fixation sont alors remplacés par 400µL de solution de
chargement de marqueur fluorescent Fura2-AM : SN, Powerload 100X – perméabilisation de
la membrane, probenicid 250mM – séquestration du marqueur (Molinas et al. 2012), Fura2AM ; la lamelle est mise à charger 1h à température ambiante et à l’obscurité. Le Fura2-AM
est un fluorophore sensible au calcium : en l’absence de calcium, il est excité par une lumière
à 380nm, mais en présence de Ca2+ son spectre est décalé et atteint un maximum à 340nm
(figure 8). Sa longueur d’onde d’émission est de 510nm indépendamment de la présence ou
non de Ca2+. En cas d’activation neuronale, il y une entrée de calcium dans le neurone, si
celui-ci est chargé en Fura-2, il y aura plus d’émission lorsque la longueur d’onde d’excitation
sera de 340nm que 380nm.
b) Microscopie inversée
7
Les lamelles sur lesquelles sont fixées les cellules de la MO, montées en chambre
d’enregistrement pour le microscope inversé muni d’un objectif 10X à immersion, sont
soumises à deux excitations successives à 380 et 340nm (200ms chacune) grâce à un boitier
Olympus MT-20. L’émission est filtrée par un filtre d’émission spécifique au Fura2-AM
(510nm) et captée par une caméra Hammamatsu ORCA-ER. Un ratio de l’émission en
fonction de l’une ou l’autre des longueurs d’onde d’excitation (340-380nm) est calculé en
fonction des différents traitements présentées au cours du temps et les résultats sont
enregistrés sous forme de film à 1 image par seconde (correspondant au ratio), le tout grâce au
logiciel excellenceRT.
3. Prélèvement des cellules
Les cellules d’intérêt sont prélevées grâce à des micropipettes de verre étirées à partir
de capillaires de verre d’1,5mm de diamètre (diamètre à l’extrémité : ½ cellule), telles que les
pipettes
utilisées
en
technique
de
patch
clamp
(électrophysiologie),
fixées
sur
micromanipulateurs manuels (axes x, y, z) et aspirées par pistons (5mL).
La pipette est descendue vers la lamelle dans la solution SN avec une légère
surpression pour éviter l’entrée de liquide, puis approchée de la cellule. L’extrémité de la
pipette est ensuite amenée au contact de la membrane en prenant soin d’éviter, lorsque cela
est possible, le contact avec les cellules environnantes qui pourraient s’y accrocher et
contaminer l’échantillon. Une première dépression est alors lancée pour faire adhérer la
cellule à la pipette, de façon similaire à un patch-clamp, puis le tout est déplacé dans une zone
Figure 9 – Approche et prélèvement de cellule
vide (si la zone est trop dense) où la dépression est augmentée pour aspirer la cellule.
4. RT-PCR sur cellule unique
8
Une fois la cellule unique prélevée, la pointe de la pipette est cassée au fond d’un
microtube contenant un mélange de tampon de resuspension (2µL) et de RNase out
(inhibiteur de RNase, 1µL) (kit SuperScript III, ThermoFisher) et l’air contenu dans la pipette
est expulsé pour s’assurer de bien récupérer la cellule. Le microtube est ensuite congelé
instantanément dans de l’azote liquide puis conservé dans un congélateur à -80°C.
a) Reverse transcription RT
Les microtubes sont d’abord décongelés dans de la glace puis chauffés 1’ à 75°C et
centrifugés pour culoter toutes les gouttes qui restent sur les parois. 7µL de mélange DNase
(DNase 1µL, tampon de suspension 10X 1µL, H2O 5µL) sont ensuite ajoutés dans chaque
tube. Ils sont ensuite incubés 5’ à température ambiante puis mis dans la glace, et enfin
incubés 5’ à 70°C. Cette première étape permet d’éliminer l’ADN cellulaire afin de
n’amplifier que les ARN. Suite à ceci, 9µL de mélange de RT sont ajoutés (4µL de tampon
10X, 0,7µL de DTT, 0,7µL de mix de dNTP, 1,3µL d’oligo dT, 0,7µL de RNase out, 0,7µL
de SuperScriptIII – transcriptase – et 1,9µL d’H2O) dans chacun des tubes laissés 2’ à
température ambiante puis incubés 1h à 37°C et 10’ à 65°C. Ils sont ensuite conservés à 20°C. Cette étape permet la réverse transcription des ARN en séquences d’ADN
complémentaire (ADNc).
b) Nested PCR
La Nested PCR (Polymerase Chain Reaction)
ou réaction en chaîne par polymérases emboitée est
effectuée sur l’ADNc obtenu après la RT. Cette
technique particulière de PCR utilise deux paires
d’amorces nucléotidiques. Un premier fragment est
tout d’abord amplifié par les amorces extérieures
(first outer primer set dans la figure 10 ci-contre), qui
engendre un premier amplicon. Sur ce premier
amplicon, une deuxième PCR est appliquée à l’aide
d’amorces plus rapprochées et délimitant exactement
Figure 10 – Schéma d'une PCR de la séquence d’intérêt (second inner primer set dans la
type Nested, en vert : séquence figure). Cette technique de PCR permet de réduire la
d'intérêt, en bleu : brins d'ADNc,
quantité de produit non spécifique et ainsi, dans le
flèches orange : amorces
9
cas d’une PCR sur cellule unique, d’amplifier deux fois la séquence d’intérêt qui se trouve en
très faible quantité dans l’échantillon, puisqu’il ne s’agit que du cytoplasme d’une cellule
unique.
Dans chaque tube est ajouté un mélange réactionnel de PCR contenant : 6,3 µL d’eau
stérile, 4µL de tampon 5X, 1,2µL de MgCl2, 1µL de dNTP à 5Mm, 1µL de chaque amorce
externe (sens ‘fwd’ et antisens ‘rev’) ainsi que 0,5µL de Taq polymérase. De même pour la
seconde PCR en utilisant les amorces internes. A ce mélange sont ajoutés 5µL de produit de
RT pour la première PCR ou de produit de première PCR pour la seconde. Les séquences des
amorces pour l’amplification de la β-tubuline III sont détaillées avec les températures
Nom de l’amorce
Fwd1_b_tub3_m
Rev1_b_tubIII_rat
Fwd2_b_tubIII_rat
Rev2_b_tubIII_rat
Séquence (nombre de nucléotides)
CAGTGCGGCAACCAGATAG (19)
CTGTTAGTGGGGCAAAGC (18)
CTGGAAGCGATCAGTGTCTAG (21)
CGTAGGTGGGTGTAGCCAG (19)
Tm
TmPCR
58,8°C
56°C
56°C
59,8°C
59°C
61°C
Couple
1 – externe
1 – externe
2 – interne
2 – interne
d’hybridation à l’ADN (Tm) dans le tableau suivant :
Tableau 1 – Détail des amorces et Tm associés utilisées pour la PCR sur la β-tubuline III
c) Migration sur gel
Les produits de PCR sont déposés sur gel d’agarose 1,2% contenant une goutte de
bromure d’éthidium BET, un intercalant de l’ADN permettant de marquer les produits de
PCR. L’électrophorèse est réalisée dans du tampon TAE (Tris, Acetate, EDTA) 1X à 100
puis 50 mV. Un marqueur du nombre de paires de bases, le 2-log DNA Ladder, est également
placé à migrer pour évaluer la taille des produits de PCR. Une photographie est prise sous
UV.
Résultats
1. Identification des cellules d’intérêt
Les neurones d’intérêt sont des cellules présentant une activité en réponse à une
stimulation par une solution contenant un odorant (MH) et par une solution saline enrichie en
KCl à 40mM. Le KCl induit une dépolarisation des cellules excitables (i.e. neurones), ainsi,
une cellule répondant à une stimulation par une solution enrichie KCl sera identifiée comme
étant un neurone. L’un des protocoles de stimulation établis pour identifier ces neurones est
présenté dans la figure suivante :
MH [10-6 M] 1'-1'30"
KCl [40mM] 7'-7'30"
10’
MH [10-5 M] 4'-4'30"
Figure 11 – Protocole de stimulation sur une durée totale de 10 minutes (600s) ; entre
10
chaque stimulation, un flux continu de SN est diffusé, de même qu’entre chaque protocole.
L’odorant utilisé est la 6-méthyl-5-heptane-2-one (MH) qui, comme expliqué
précédemment, signerait l’œstrus, et dont
on cherche à identifier le récepteur. Il est
a
d’abord dilué à 10-2M dans de l’huile
minérale puis en série à 10-5M et 10-6M
dans du SN. Les cellules répondant
uniquement
au
KCl
à
40Mm
ou
répondant au KCl et à un mélange de 12
odorants (MOP à 10-5M, tableau S2 en
annexe)
sont
considérées
comme
contrôles.
b
c
a
11
Pour chaque lamelle (2 par rat et par jour de manipulation), le protocole est répété sur
plusieurs champs. Chaque champ est analysé directement près l’enregistrement afin de
déterminer les cellules dont l’activité est modifiée. Dans un premier temps l’enregistrement
est visualisé en accéléré et la variation d’intensité de fluorescence des cellules due au
marqueur Fura2-AM en réponse à une accumulation de Ca2+ intracellulaire est recherchée.
Chaque cellule que l’on suppose avoir une réponse suffisamment importante aux stimulations
est analysée individuellement par traçage d’une région d’intérêt (ROI : Region Of Interest)
5,50
4,50
Cellule répondante à la MH
KCl
MH 10-5M
6,50
MH 10-6M
Intensité de réponse (niveaux
de gris)
Cellule contrôle
6,50
5,50
4,50
3,50
3,50
2,50
0
2,50
60 120 180 240 300 360 420 480 540 600
0
60 120 180 240 300 360 420 480 540 600
Temps (s)
Temps (s)
Figure 13 – Exemple de graphiques obtenus pour une ROI délimitant une cellule contrôle
répondant uniquement au KCl à 40mM (contrôle) et une cellule répondante à une stimulation
à 10-5 de MH et à 40mM de KCl. Les rectangles noirs indiquent les périodes de stimulation
d’après le protocole présenté en figure 11
(figure 12) et mesure de la variation d’intensité de gris (figure 13). Les cellules d’intérêt
réagissent à l’odorant (à 10-5M ou 10-6M) ainsi qu’au KCl à 40mM et présentent une variation
d’intensité similaire à celle présentée dans la figure ci-dessous. De même, la figure 13 cidessous montre la variation d’intensité d’une ROI d’une cellule considérée contrôle, ne
réagissant donc qu’au KCl.
Une analyse du nombre de cellules par champ a été réalisée. Celle-ci nous a permis de
déterminer le nombre moyen de cellules par champ qui répondent à une stimulation par le
Moyenne du
pourcentage de
cellules répondanes
+ SEM
Figure 12 – Champ cellulaire
enregistré a)
1750
1500
1250
1000
750
500
250
0
1
2
3
Champ
Exemple d’un champ 50,0
de lamelle observé au
microscope à contraste
de phase – barre
40,0
d’échelle : 200µm, b) Gros plan sur l’encadré de
30,0
la partie a, c) Traçage d’une
ROI sur
une cellule.
[VAL
EUR]
b et c – barre
d’échelle :20,0
50µm
4
Pourcentage
Nombre de cellules
Nombre de cellules totales et de cellules
répondantes par champ sur 4 champs
10,0
12
0,0
Figure 14 – Nombre de cellules répondantes au KCl 40mM par rapport
au nombre total de
Cellules répondantes au KCl à 40mM
Cellules non répondantes
Moyenne
cellules dans 4 champs et moyenne du pourcentage de cellules répondantes par
rapport au
nombre total de cellules + SEM (±5,19%), n=4
KCl à 40mM. Cette quantification est présentée dans la figure 14 ci-dessous.
En moyenne, un champ enregistré au microscope inversé présente 38,9%±5,19%
(SEM, n=4) de cellules répondantes à une stimulation par le KCl à 40mM. Ainsi, environ
40% des cellules observées sur un champ sont des neurones.
2. Prélèvement des cellules
Chaque cellule est prélevée selon le point 3 du Matériel et méthodes. Un récapitulatif
des cellules prélevées et de leurs réponses est présenté dans le tableau 2 ci-dessous.
Prélèvement Date Lamelle Champ ROI
/2016
Réponse
MH
10 M 10-5M
2
X
2
1
X
3
1
X
1
X
1
X
2
1
3
3
X
1 X
X
2
3
2
1
8+9
6
7
1
X
-6
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
04/05
04/05
09/05
09/05
12/05
12/05
12/05
12/05
13/05
13/05
13/05
17/05
18/05
18/05
18/05
19/05
19/05
19/05
19/05
19/05
1
2
2
2
1
1
2
2
1
1
2
1
1
1
2
1
1
1
1
2
2
3
2
2
3
4
2
2
4
4
3
1
4
4
2
2
2
2
2
2
MOP
10-5M
X
X
Henkel KCl
10-5M 40mM
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Tableau 2 – Récapitulatif des prélèvements de 20 cellules
3. Résultats de la RT-PCR
Dans un premier temps une PCR est réalisée pour cibler la β-tubuline III de manière à
confirmer que les cellules prélevées et dont les ARN ont été convertis en ADNc sont bien des
neurones. En effet, cette protéine est spécifique des cellules neuronales et peut être amplifiée
par des amorces présentées dans le tableau 1 (matériel et méthodes). L’amplification de cette
protéine donne un fragment de 538pb d’après les amorces utilisées. La PCR est tout d’abord
13
réalisée sur quelques cellules
contrôles (répondant au KCl
mais pas à la MH) parmi les
20 prélevées afin de vérifier
que le bon fonctionnement du
protocole.
Le
gel
d’électrophorèse obtenu avec
les
produits
de
PCR
est
présenté dans la figure 14. On
observe dans cette figure une
bande à environ 0,5kb pour le
Figure 14 – Gel de migration des produits de
PCR de 6 prélèvements précisés en haut,
l'échelle du marqueur M est jointe à gauche
prélèvement 19, qui correspondrait aux 538pb de la β-tubuline recherchée. Ceci indique donc
que la cellule prélevée dans le tube 19 est bien un neurone. Toutefois, parmi les 6
prélèvements utilisés ici, un seul produit un résultat positif (19) alors que les autres produisent
des résultats négatifs sous forme de trainées (smears). Ceci indique qu’aucun fragment n’a pu
être spécifiquement amplifié en PCR pour ces prélèvements.
Afin de vérifier si l’absence de signal observé précédemment pouvait être due à des
conditions de réverse transcription ou de PCR non optimales, une deuxième série de cellules
contrôles (10 cellules de 21 à 30) prélevées a été analysée. Ces prélèvements ont été réalisés
en faisant attention de bien vortexer et culoter les échantillons avant de pratiquer la RT.
L’actine, protéine présente dans toutes les cellules en quantité abondante, est également
recherchée par RT-PCR en plus de la βtubuline III afin de vérifier la présence de
matériel cellulaire dans le prélèvement.
Elle a été amplifiée en utilisant un
protocole déjà mis au point au laboratoire
et les amorces utilisées sont présentées
a
dans le tableau S3 en annexe.
La figure 15a montre les résultats
de l’amplification de la β-tubuline et la
figure 15b ceux de l’amplification de
l’actine.
b
Figure 15 – Gels d’électrophorèse des
produits de PCR des prélèvements 21 à 30,
pour une amplification de la β-tubuline (a) et
de l'actine (b), le marqueur (M) est le même
14
que dans la figure 14
Le gel d’électrophorèse en figure 15a ne présente pas de bandes d’amplification de la
β-tubuline. Cette absence d’amplification peut être due soit à un défaut de PCR, soit à
l’absence de matériel cellulaire. Au niveau du gel présenté en figure 15b une amplification de
matériel est présente dans 6 prélèvements. En effet, des bandes sont observées dans les puits
22, 27 et 30 malgré une absence de migration. Quant aux bandes à environ 0,6kb présentes
dans les puits 21, 23 et 30, elles correspondent au fragment amplifié de l’ADNc d’actine
(607pb). Ces résultats montrent qu’il y a présence de matériel cellulaire dans 6 cas sur 10 et
que l’étape de RT est efficace dans ces cas-là.
Discussion et perspectives
Lors de ce stage, nous avons cherché à identifier les RO répondant à la
méthylheptenone, qui a été montrée comme signant l’œstrus dans différentes espèces (Nielsen
et al. 2013). Nous nous sommes basés sur un protocole de 1999 (Touhara et al.) qui a défini
les bases de l’utilisation d’approches d’imagerie calcique et de RT-PCR pour l’identification
fonctionnelle de récepteurs répondant à des odorants spécifiques.
Identification et prélèvement des cellules :
Pour ce faire, nous avons prélevé des cellules dissociées d’épithélium olfactif de ratons
qui présentaient en imagerie calcique une réponse à une stimulation par la MH. Une
stimulation par du KCl à 40mM nous permettait ensuite de vérifier la viabilité des cellules et
d’identifier les cellules excitables (neurones) qui répondent par une augmentation rapide du
calcium intracellulaire. Les cellules répondant uniquement au KCl ont été considérées comme
des NO viables mais ne répondant pas à l’odorant d’intérêt, et un certain nombre d’entre elles
ont été prélevées comme cellules contrôles. L’utilisation de jeunes rats pour cette expérience
s’explique par le fait qu’à cet âge (7 à 15 jours), les épithéliums olfactifs de l’animal sont plus
faciles à prélever et à dissocier en comparaison d’un épithélium mature prélevé chez un
adulte. A ce stade, il y a plus de plasticité tissulaire et développement et maturation sont
encore très présents. De plus la viabilité cellulaire est également plus importante sur des
prélèvements issus de ratons, ce qui a pu être vérifié expérimentalement. Cette étape de
prélèvement de cellules a représenté la majeure partie du stage puisque le rendement
d’obtention de cellules répondantes et d’intérêt est très faible. Ceci s’explique par le fait que
sur un champ pouvant compter de 300 à 1500 cellules, donc un nombre très variable selon la
qualité de la préparation (dissection et dissociation), la probabilité qu’une cellule soit
répondante à notre odorant est faible. En effet, nous avons vu que la proportion de cellules
15
répondantes à une stimulation par le KCl dans un champ environnait les 40%. De plus, chez le
rat, 800 à 1000 récepteurs olfactifs différents sont exprimés dans l’EO, ainsi, parmi les 40%
de cellules répondantes au KCl 40mM, des neurones, nous avons une faible chance de trouver
une cellule d’intérêt répondant à la MH, même si le fait de prélever des zones qui ont été
particulièrement répondantes en EOG nous permet d’augmenter ces chances car nous avons
pu repérer au final une dizaine de cellules répondantes. De tels résultats avaient été observés
par l’équipe de Touhara en 1999. En effet, parmi les 3500 neurones répondant au KCl que
cette équipe a pu mettre en évidence, 226 répondaient à au moins un des 11 odorants utilisés,
2 à 45 cellules répondant par odorant. La dissociation du tissu est également un facteur
important puisque s’il n’est pas correctement effectué, il peut subsister des blocs de cellules
non dissociées qui se trouvent alors moins fixées et perturbent l’enregistrement en étant
ballotées par le flux constant de solution. L’ensemble de ces données nous a poussé à réaliser
le protocole de nombreuses fois pour obtenir un nombre correct de cellules correctement
dissociées à prélever et à analyser en biologie moléculaire, soit trois à quatre champs par
lamelle, pour deux lamelles par raton et jour de manipulation, sur 2 semaines.
Les premiers jours ont été utilisés à la mise au point des différentes étapes de cette
manipulation. En effet, nous avons testé plusieurs concentrations d’enzyme de dissociation
(papaïne) en fonction de l’âge des rats pour s’assurer de l’efficacité de chacune, et il s’est
avéré que les épithéliums des ratons les plus âgés se dissociaient mieux avec une
concentration de papaïne doublée. De plus, les premières triturations de cellules, avant la
filtration et le dépôt sur lamelles, ont été effectués avec des micropipettes et cônes de
plastique classiques (à la P1000), ce qui ne nous permettait pas d’observer une bonne
dissociation, beaucoup de paquets de cellules subsistant à cette trituration. Nous avons alors
opté pour l’utilisation de pipettes de verre rodées pour la réalisation de cette étape, qui nous
permettait une meilleure dissociation et donc un plus grand nombre de cellules fixées malgré
un nombre plus important de cellules mortes.
Le protocole de prélèvement des cellules reste encore à optimiser. En effet le
prélèvement n’est peut-être pas optimal du fait qu’il est réalisé à sec. Un article dans la revue
Single-channel recording de 1995 (par Hannah Monyer et Peter Jonas), utilise un dispositif
différent de prélèvement. Dans ce dispositif, du liquide de prélèvement est présent dans la
pipette, ce qui permet un enregistrement en patch-clamp d’une cellule unique, puis un
prélèvement de la cellule. Le contenu de la pipette après prélèvement est expulsé par un
système d’air comprimé dans le tube de PCR. Cette technique pourrait être adaptée à notre
16
protocole bien qu’elle soit réalisée sur des tranches d’encéphale, mais ceci nécessiterait une
évaluation du ratio difficulté/bénéfice puisque cela rajouterait une complication.
Recherche du récepteur olfactif :
Les cellules prélevées ont été analysées grâce à une reverse transcription suivie d’une
PCR de type Nested. Dans un premier temps, la nature neuronale des cellules a été testée
grâce à une amplification de la β-tubuline III, une protéine spécifique des neurones. Cela n’a
donné que peu de résultats car les produits d’amplification correspondant à la β-tubuline III
(bande à environ 0,5kb) n’ont été observés que pour une cellule sur 16 analysées. Néanmoins,
puisque la β-tubuline a quand même été détectée une fois, cela signifie que les conditions de
PCR utilisées permettent d’amplifier la β-tubuline III lorsque son ADNc est suffisamment
représenté dans l’échantillon. Cependant, le très faible rendement de cette PCR pourrait
suggérer d’améliorer les amorces utilisées pour cibler plus facilement la β-tubuline III. Le
choix d’amorces plus longues par exemple pourrait permettre une meilleure reconnaissance de
la β-tubuline lors de la PCR, malgré des risques d’amplification de matériel cellulaire de
façon non-spécifique. Le niveau d’expression des gènes étudiées est un autre paramètre qui
pourrait avoir son importance au vu de nos résultats, à savoir. En effet, la présence d’actine
dans les prélèvements a été évaluée afin de s’assurer de la présence de contenu cellulaire dans
ceux-ci puisqu’il s’agit d’une protéine fortement exprimée. Cette analyse nous a permis de
montrer que dans 60% des cas, la RT semble être efficace, car une bande d’amplification est
observé dans le gel (Figure 15b). Dans ce même graphique, 3 échantillons ne migrent pas.
Des données similaires avaient été observées dans l’étude sur la souris et ce point reste à sujet
à interrogation. En comparaison de l’actine, la β-tubuline III est une protéine moins exprimée,
et on peut donc se demander si son niveau d’expression est suffisant pour permettre une
détection efficace dans le cadre d’une PCR sur cellule unique. Un moyen de répondre à cette
question serait d’augmenter la quantité de matériel en regroupant plusieurs cellules prélevées.
Cette question demande d’être résolue car les niveaux d’expression des RO sont du même
ordre de grandeur que celui de la β-tubuline, voir plus faibles. La phase de mise en évidence
du RO sensible à la méthylheptenone ne sera donc envisageable que lorsqu’il sera possible de
détecter efficacement la β-tubuline.
L’étape de DNase-RT, qui semble ne pas être majoritairement en cause dans l’absence
d’amplification de la β-tubuline, pourrait cependant être également optimisée. En effet,
l’élimination de l’ADN génomique à l’aide de la DNase préalablement à la RT pourrait jouer
un rôle dans les résultats que nous obtenons. Le premier protocole de RT pratiqué incluait un
ajout d’EDTA entre l’étape de DNase et la RT. L’EDTA (Éthylène Diamine Tétra-Acétique)
17
est généralement utilisé comme inhibiteur de nucléases comme la DNase, du fait qu’il
séquestre les ions Mg2+ qui sont nécessaires à l’activité de nombreuses de ces enzymes.
Cependant il se peut que des traces d’EDTA puisse également altérer, par le même
mécanisme, les enzymes de RT comme la SuperScript III. L’EDTA a donc été retiré du
protocole et la DNase est simplement inactivée par la chaleur. Mais, de ce fait, des traces de
DNase pourraient subsister et altérer les ADNc produits lors de la RT dans certains
échantillons. La réalisation de RT-PCR en absence d’étape de DNase devrait permettre de
répondre à cette question.
Poursuite de l’étude :
L’étape suivante de cette étude, après les différentes mises au point suggérées
précédemment, sera de rechercher un RO sensible à la méthylheptenone au moyen des
approches de biologie moléculaire présentées ci-dessus en utilisant des amorces dégénérées.
Ces amorces dégénérées permettent de cibler une large proportion des RO exprimés chez le
rat et consistent en des séquences conservées parmi ces récepteurs séquencés dont quelques
bases ont été modifiées. Les neurones olfactifs n’exprimant qu’un seul type de RO,
l’utilisation des amorces dégénérées devrait permettre d’amplifier l’unique récepteur olfactif
exprimé dans ces cellules, dans notre cas les NO et les RO répondant à la MH.
Le système olfactif est conçu de telle
sorte que les récepteurs ne sont capables de
reconnaître que quelques groupements des
molécules odorantes et rarement leur totalité,
c’est le code combinatoire, présenté en figure 16
ci-contre, tirée de Ache et Young (Neuron,
2005). Ainsi, une molécule odorante peut être
détectée, dans différentes mesures, par chaque
récepteur sensible aux différents groupements
qui la composent. Dans le cas de notre étude, en
cherchant
à
isoler
le
récepteur
à
la
méthylheptenone, il serait en réalité possible
d’isoler plusieurs récepteurs, sensibles aux
Figure 16 – Schéma du code combinatoire
différents groupements de la molécule. Les du système olfactif. A gauche, les différents
odorants et leurs différents groupements
neurones
exprimant
ces
récepteurs
fonctionnels en couleur, et à droite les
récepteurs spécifiques à ces groupements
18
présenteraient donc des réponses variables en fonction du groupement qui se fixe au
récepteur.
Dans l’optique de la conception de biosenseurs associant récepteurs olfactifs et
capteurs en diamant (CEA List), le récepteur à la MH permettrait la détection des femelles en
œstrus dans les élevages. Toutefois, pour s’assurer de la spécificité de cette détection, d’autres
odorants spécifiques de cet état physiologique devraient être recherchés, et leurs récepteurs
potentiels identifiés. Ainsi, les senseurs envisagés pourraient être porteurs des récepteurs
sensibles aux différents odorants signant l’œstrus mais également des récepteurs sensibles à
des odorants neutres et ne présentant aucune surproduction pendant la période d’œstrus.
Bibliographie

Adrien Molinas, Gilles Sicard, Ingrid Jakob (2012) Functional Evidence of Multidrug
Resistance Transporters (MDR) in Rodent Olfactory Epithelium

Barry W. Ache, Janet M. Young (2005) Olfaction: Diverse Species, Conserved
Principles

Birte L. Nielsen, Nathalie Jerôme, Audrey Saint-Albin, Olivier Rampin, Yves Maurin
(2013) Behavioural response of sexually naïve and experienced male rats to the smell
of 6-methyl-5-hepten-2-one and female rat faeces

Birte L. Nielsen, Nathalie Jerôme, Audrey Saint-Albin, Christian Ouali, Sophie
Rochut, Emilie-Laure Zins, Christine Briant, Elodie Guettier, Fabrice Reigner,
Isabelle Couty, Michèle Magistrini, Olivier Rampin (2016) Oestrus odours from rats
and mares : Behavioural responses of sexually naive and experienced rats to natural
odours and odorants

Hannah Monyer, Peter Jonas (1995) Polymerase Chain Reaction analysis of ion
channel expression in single neurons of brain slice

Kazushige Touhara, Shintaro Sengoku, Koichiro Inaki, Akio Tsuboi, Junzo Hirono,
Takaaki Sato, Hitoshi Sakano, And Tatsuya Haga (1999) Functional identification and
reconstitution of an odorant receptor in single olfactory neurons
19
20
Annexe
Produit
NaCl
KCl
MgCl2
CaCl2
Hepes
Sucrose
Glucose
MW
(g/mol)
58,44
74,55
203,31
147,02
238,3
342,3
180,16
Concentration
(mmol/l)
140
5
2
2
10
6
10
Poids
(g / 1 l)
8,180
0,373
0,407
0,294
2,383
2,054
1,802
Poids
(g / 2 l)
16,360
0,746
0,814
0,588
4,766
4,108
3,604
Poids
(g / 5 l)
40,900
1,865
2,035
1,470
11,915
10,269
9,010
Tableau S3 - Composition de la solution de Salin Normal (SN)
Protocole de préparation des lamelles coatées à la poly-L-lysine :
Des lamelles rondes de diamètre 15mm stérilisées à l’autoclave sont rincées à l’alcool à 70%
puis séchées. 150 µL de solution de coating (0,01% de Poly-L-lysine dans de l’eau stérilisée
et filtrés à 0,22µm) sont déposés sur chaque lamelle et laissés à polymériser 1h à température
ambiante. Les lamelles sont ensuite rincées 3 fois à l’eau stérilisée puis laissées à sécher et
enfin disposées dans des plaques B12 (1 par puit) conservé au réfrigérateur.
Note : On observe une meilleure fixation des cellules sur lamelles fraiches
Odorants
Densité Pureté Poids
moléculaire
(g/ml)
(%)
(g/mol)
Solvant Concentration Volume
d'odorant
(µl) / 1ml
final
Stock (mol/l)
pour
101
M
9,08
11,01
5,60
17,86
DMSO 6,81
14,69
DMSO 4,69
21,30
0,992
99
108,14
Anisole
0,888
96
152,24
Citral
0,818
95
114,19
Heptanal
0,873
70
130,19
Isoamyl
acetate
0,989
99
210,32
EtOH
4,66
Lyral
0,944
204,34
EtOH
0,00
Lilial
0,827
98
130,23
6,22
Octanol
0,89
75
154,25
4,33
1-4-cinéole
99
154,25
5,78
Isomenthone 0,9
0,843
99
136,24
6,13
Limonène
0,959
97
150,22
MetOH 6,19
L-carvone
0,818
95
114,19
H2O
6,81
Pyridine
Ajouter le volume de DMSO (µl) pour compléter à 1 ml :
Tableau S4 – Composition en odorants du mélange MOP 12
21,48
34,50
16,07
23,11
17,31
16,32
16,15
14,69
775,49
Nom de l’amorce
Act305
Act1068
Act331
Act938
Séquence (nombre de nucléotides)
TTGTCACCAACTGGGACGATATGG (24)
GATCTTGATCTTCATGGTGCTAGG (24)
AAGATTTGGCACCACACTTTCTAC (24)
CACTTCATGATGGAATTGAATGTA (24)
TmPCR
57°C
57°C
Tableau S5 – Détail des amorces et Tm utilisés pour la PCR ciblant l'actine
Couple
1 – externe
1 – externe
2 – interne
2 – interne
Identification of an œstrus-specific sensitive olfactory receptor in the rat
Louis Richevaux
Smell is one of the most important senses within the animal kingdom; it elicits lots of
behaviours and governs most of the social interactions between individuals, including
reproduction.
In
mammals,
reproduction
strongly
depends
on
the
female
reproductive/hormonal cycle. During this cycle, oestrus is a period during which the female is
particularly receptive to male sexual behaviours and willing to mate. Within this period, the
production of specific odorants by the female is increased, including the 6-methyl-5-hepten-2one (methylheptenone) identified in rats (Nielsen et al. 2013). This odorant has been shown to
elicit behavioural responses on sexually experienced or naive rat males (Nielsen et al. 2013
and 2016), strongly suggesting the existence of an olfactory receptor specific for this innately
responsive odor. The purpose of this study was : firstly to identify methylheptenoneresponding olfactory neurons in the olfactory epithelium of young rats using calcium imaging
technique; secondly to extract the olfactory receptor(s) expressed in these responding-neurons
by a monocellular reverse transcription-coupled nested PCR. The first aim of my work was
thus to optimize the different protocols on control neurons, from the dissection of animals’
olfactory mucosa and cellular dissociation to calcium imaging, cell harvesting and the
different single-cell RT-PCR steps. The next step was to apply this multistep optimizedapproach to isolated methylheptenone-responding neurons. The ultimate goal of this study is
to design biosensors to detect the periods of fertility of females in livestock.