Performance of 18S rDNA helix E23 for phylogenetic relationships
Transcription
Performance of 18S rDNA helix E23 for phylogenetic relationships
C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 © 2000 Académie des sciences/Éditions scientifiques et médicales Elsevier SAS. Tous droits réservés S0764446900012300/FLA Taxonomy / Taxinomie Performance of 18S rDNA helix E23 for phylogenetic relationships within and between the Rotifera–Acanthocephala clades Anne Miquelisa, Jean-François Martinb, c, Evan W. Carsond, Guy Bruna, André Gillesa* a Laboratoire d’hydrobiologie, UPRES Biodiversité 2202, université de Provence, 1, place Victor-Hugo, 13331 Marseille, France b Laboratoire de systématique évolutive, UPRES Biodiversité 2202, université de Provence, 1, place VictorHugo, 13331 Marseille, France c Rocky Mountain Biological Laboratory, Crested Butte, CO 81224, USA d Department of Biology, Arizona State University, Tempe, AZ 85287-1501, USA Received 16 February 2000; accepted 19 June 2000 Communicated by André Adoutte Abstract – The species diversity of the phylum Rotifera has been largely studied on the basis of morphological characters. However, cladistic relationships within this group are poorly resolved due to extensive homoplasy in morphological traits, substantial phenotypic plasticity and a poor fossil record. We undertook this study to determine if a phylogeny based on partial 18S rDNA, which included the helix E23 of 18S rDNA sequence, was concordant with established taxonomic relationships within the order Ploimida (class: Monogononta). We also estimated the level of polymorphism within clones and populations of Ploimida ‘species’. Finally, we included the Cycliophora Symbion pandora as outgroup and the variable helix E23 region to examine the influence of their signal on the evolutionary relationships among Acanthocephala, Bdelloidea and Ploimida. Phylogenetic reconstruction was performed using maximum parsimony, neighbour joining and maximum likelihood methods. We found 1) that morphologically similar Ploimida ‘species’ show vastly different 18S E23 rDNA sequences; 2) inclusion of the helix E23 of 18S rDNA and its secondary structure analysis results in better resolution of family level relationships within the Ploimida; 3) an impact of Symbion pandora as an outgroup with inclusion of the helix E23 on the relationships between the Rotifera and the Acanthocephala; and 4) partial incongruence and differential substitution rate between conserved region and helix E23 region of the 18S rDNA gene depending on the taxomic group studied. © 2000 Académie des sciences/Éditions scientifiques et médicales Elsevier SAS Rotifera / Acanthocephala / 18S rDNA / Ploimida systematic / substitution rate Résumé – Performance de l’hélice E23 du 18S ADNr pour les relations phylogénétiques entre et au sein du clade Rotifera-Acanthocephala. L’étude de la diversité spécifique des rotifères a longtemps reposé sur l’analyse des caractères morphologiques. Or, l’existence d’homoplasie au sein de ces caractères ainsi que l’importante plasticité phénotypique et la rareté des fossiles ne permettent qu’une faible résolution des relations phylogénétiques au sein de ce groupe. Notre étude a été réalisée afin de confronter une phylogénie basée sur une portion du 18S ADNr (incluant l’hélice E23, région variable) avec les relations taxinomiques préalablement définies sur la base des * Correspondence and reprints: [email protected] 925 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 caractères morphologiques au sein de l’ordre des Ploimida (classe des Monogononta). Nous avons, en outre, estimé le degré de polymorphisme entre clones et populations « d’espèces » de Ploimida. Enfin, nous avons utilisé le Cycliophora Symbion pandora comme groupe extérieur et nous avons inclus l’hélice E23, région variable, afin d’examiner leur influence respective sur les relations phylogénétiques entre Acanthocephala, Bdelloidea et Ploimida. Les méthodes du « maximum de parcimonie », du « neighbor joining » et du « maximum likelihood » ont été utilisées dans le cadre des reconstructions phylogénétiques. Nous avons trouvé 1) que les « espèces» de Ploimida morphologiquement identiques ont des séquences de 18S ADNr différentes ; 2) que l’inclusion de l’hélice E23 du 18S ADNr et son analyse en structure bidimensionnelle permettent de réincorporer l’information qu’elle contient, entraînant ainsi une meilleure résolution des relations entre familles au sein des Ploimida ; 3) que le groupe extérieur Symbion pandora et l’inclusion de l’hélice E23 ont un impact majeur sur les relations entre rotifères et acanthocéphales ; et 4) qu’il y a une incongruence partielle ainsi que des taux de substitution différents entre région conservée et hélice E23 au sein du 18S ADNr suivant le groupe taxonomique étudié. © 2000 Académie des sciences/Éditions scientifiques et médicales Elsevier SAS Rotifera / Acanthocephala / 18S ADNr / systématique des Ploimida / taux de substitution Version abrégée Les 2 000 espèces constituant le phylum des Rotifera sont réparties en trois classes : Monogononta, Bdelloidea et Seisonidea. Malgré l’existence de nombreuses données morphologiques, ultrastructurales et allozymiques, les relations phylogénétiques ne sont que faiblement résolues dans ce groupe. Or, de récentes études de phylogénie moléculaire réalisées au sein des Aschelminthes suggèrent l’existence d’un clade RotiferaAcanthocephala. D’autres analyses moléculaires font des acanthocephales un sous taxon des rotifères. La présente étude basée sur l’utilisation d’une portion de 500 pb du 18S ADNr a pour but d’analyser les variations génétiques au sein de ce groupe. Cela inclut une estimation du taux de polymorphisme observé entre clones et populations appartenant à l’ordre des Ploimida (classe des Monogononta) ainsi que, la définition des relations existant entre Bdelloidea, Ploimida et Acanthocephala. Nous incluons dans l’analyse l’hélice E23, région variable du 18S ADNr et nous utilisons comme groupe extérieur le Cycliophora Symbion pandora. Les Ploimida sont prélevés dans différents habitats dans le sud-est de la France. Après identifications réalisées sur la base de caractères morphologiques, cinq espèces representées par dix clones issus chacun d’une femelle parthénogénétique sont cultivés en laboratoire. L’ADN total de tous ces Ploimida est ensuite extrait et un fragment de 500 pb du 18S ADNr est alors amplifié par PCR. Les huit séquences d’acanthocéphales, ainsi que celles du Bdelloidea, de deux autres Ploimida et du Cycliophora proviennent de GenBank. Les séquences sont alignées manuellement puis comparées en structure secondaire. Cette procédure permet de localiser deux portions conservées (C1 = posi- 926 tions 1 à 186 et C2 = positions 432 à 500) ainsi qu’une région variable (hélice E23 = positions 187 à 431). Trois méthodes d’analyse sont utilisées : le neighbor-joining (NJ), le maximum de parcimonie (MP) et le maximum de vraisemblance (ML pour Maximum Likelihood en anglais). Différentes méthodes sont utilisées pour tester la topologie des arbres et la robustesse des nœuds. La composition en bases des Ploimida est faiblement biaisée (A+T = 56,41 %), mais aucune différence significative n’est observée entre les espèces. Le taux de divergence des séquences de 18S ADNr des différents genres de Ploimida peut atteindre 5 %. L’utilisation de la structure secondaire du 18S ADNr montre que les substitutions prédominent dans l’hélice E23. Le taux de transitions par rapport aux transversions diminue rapidement avec l’augmentation de la divergence moléculaire totale, cependant aucun effet de saturation n’est observé entre les différents profils de substitution. Afin de tester l’influence des régions conservées et de l’hélice E23 sur la reconstruction phylogénétique, ces parties sont analysées séparément puis conjointement. Pour la région conservée (nucléotides 1 à 186 et 432 à 500), seules 62 positions sont informatives. La valeur du g1 est de –1,175, ce qui indique que ce jeu de données contient un signal phylogénétique significatif. Les valeurs du IC (indice de cohérence) et du IR (indice de rétention) sont respectivement de 0,762 et 0,836, indiquant un faible taux d’homoplasie. Le test du taux de vraisemblance montre que les topologies obtenues par chacune des trois méthodes d’analyses (MP, NJ et ML) ne sont pas significativement différentes. Pour l’hélice E23 (nucléotides 187 à 431), 127 sites sont informatifs pour la parcimonie. Les valeurs de IC et de IR sont respectivement de 0,716 et 0,792. Les trois méthodes d’analyse donnent là encore des topologies ne présentant pas de différence significative. On A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 observe pour cette région variable une plus grande homogéneité, des longueurs de branche entre les groupes, que celle obtenue avec les parties conservées. Si on considère l’intégralité de la portion du 18S ADNr séquencée (nucleotides 1 à 500), le test d’homogénéite des partitions indique une incongruence entre région conservée (C1-C2) et hélice E23 (hE23). Un retrait itératif des taxa démontre que cette incongruence est due à un manque de signal phylogénétique dans la région conservée (C1-C2) chez les Ploimida mais pas chez les Acanthocephala. Ce manque de signal phylogénétique n’est pas détecté par le g1. Nous démontrons dans cette étude que, la suppression de l’hélice E23 n’est pas justifiée dans le cadre d’une analyse des liens phylogénétiques entre Rotifera et Acanthocephala. Nous démontrons, en outre, que l’hélice E23 contient une information phylogénétique plus grande que celle des regions conservées pour la résolution des genres de Ploimida. Nous observons également que l’hélice E23 et les régions conservées n’évoluent pas au même taux aussi bien à l’intérieur des groupes (Ploimida, Bdelloidea, et Acanthocephala) que entre eux, augmentant de ce fait l’hétérogéneite dans les longueurs de branches entre les différents taxa. Les régions conservées montrent une violation de l’uniformité du taux de substitution plus grande que celle observée dans la partie variable. Notre étude montre des résultats nouveaux et robustes sur les liens phylogénétiques entre Rotifera et Acanthocephala qui redeviendraient deux clades distincts tout en restant des groupes frères. Ces résultats demandent à être complétés par l’étude de nouveaux gènes nucleaires afin de confirmer le fort signal phylogénétique contenue dans l’hélice E23. 1. Introduction cephala. However, due to alignment difficulties, some of these studies have excluded the variable helix E23 region of 18S rDNA and obtained an unstable position of the Bdelloidea (Rotifera) [33, 34]. On the other hand, Garey et al. [32, 35] obtained a stable position of the Bdelloidea grouped with Acanthocephala but with a very long branch. Finally, Near et al. [36] analysed the phylogenetic relationships of the Acanthocephala by including no new rotifer species and no outgroup. So it was impossible for instance to confirm (or infirm) the monophyly of Rotifera. Because the helix E23 may provide critical phylogenetic information for resolving the position of the Bdelloidea, removal of this region may not be justified. Therefore, we have included the helix E23 to determine if its inclusion increases phylogenetic resolution and we have chosen Symbion pandora (Cycliophora) as outgroup, a close relative of the Rotifera–Acanthocephala clade [37]. The phylum Rotifera contains approximately 2 000 aquatic, semi-aquatic and ectoparasitic species [1], which are divided into three classes: Monogononta, Bdelloidea and Seisonidea [2]. Establishment of systematic relationships within this phylum has been challenging due to high levels of phenotypic plasticity, asexual mode of reproduction (strict or not), succession of sibling species in the same environment over time [3, 4] and introgression between species of the same group [5]. Several character sets have been used to examine the phylogenetic relationships of this group, including ultrastructure [6–12], mating behaviour [13–16] and allozymes [3, 17–19], yet relationships among ‘species’ remain uncertain. Molecular phylogenetic studies of Aschelminthes have suggested a clade consisting of Rotifera and the endoparasitic phylum Acanthocephala [20, 21]. This clade contains at least 1 150 endoparasitic species divided into three classes: Archiacanthocephala, Palaeacanthocephala and Eoacanthocephala [22, 23]. Even though this relationship has also been supported by morphological and comparative ultrastructural studies, it is still controversial [24–31]. More recent molecular studies have even placed Acanthocephala within the Rotifera [32–35]. In order to gain a better understanding of the evolution of Rotifera and Acanthocephala, it is critical that the systematic position of the Bdelloidea be resolved with more certainty. In this study, we used a 500-bp region of 18S rDNA to examine patterns of genetic variation within and among various rotifer groups. This included estimation of levels of polymorphism within clones and populations of the order Ploimida (class: Monogononta), and reconstruction of relationships among taxa within and between Ploimida, Bdelloidea and Acanthocephala. Earlier studies [32, 33] have used this gene in an attempt to resolve the position of Bdelloidea relative to other Rotifera and the Acantho- 2. Materials and methods 2.1. Biological samples Rotifers of the order Ploimida were sampled from different habitats in southeast France (table I). Morphological characters were measured for 30 individuals from each clone (see below) to identify specimens to species [38]. Ten clones descended from a single parthenogenetic female (for each of the five putative species), were maintained in 2 mL of low-mineral water at 17 °C under a 15L/9D photoperiod. Food used for cultures were algal (Chlorella vulgaris and Dunaliella tertiolecta) or rotifer (Brachionus angularis – clone from Saint-Gilles, France) depending on natural diet. Frequent sub-cultures were made to prevent production of males. Exclusion of males prevented genetic recombination, which only occurs during the sexual phase of the Monogononta life cycle [39]. Rotifers were sampled within each clone at regular inter- 927 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Table I. List of species and Genbank accession numbers. Specimen name Systematic position Sequence name Brachionus angularis Monogononta, Ploimida, Brachionidae B. angularis1 B. angularis2 Brachionus calyciflorus Monogononta, Ploimida, Brachionidae B. calyciflorus Brachionus plicatilis1 Monogononta, Ploimida, Brachionidae B. plicatilis1 Brachionus plicatilis2 Monogononta, Ploimida, Brachionidae B. plicatilis2 Brachionus plicatilis3 Monogononta, Ploimida, Brachionidae B. plicatilis3 Keratella quadrata1 Monogononta, Ploimida, Brachionidae K. quadrata1 Keratella quadrata2 Monogononta, Ploimida, Brachionidae K. quadrata2 Asplanchna priodonta1 Monogononta, Ploimida, Asplanchnidae A. priodonta1 Asplanchna priodonta2 Monogononta, Ploimida, Asplanchnidae A. priodonta2 Asplanchna priodonta3 Monogononta, Ploimida, Asplanchnidae A. priodonta3 Asplanchna priodonta4 Monogononta, Ploimida, Asplanchnidae A. priodonta4 Asplanchna priodonta5 Monogononta, Ploimida, Asplanchnidae A. priodonta5 Synchaeta tremula1 Monogononta, Ploimida, Synchaetidae S. tremula1 Synchaeta tremula2 Monogononta, Ploimida, Synchaetidae S. tremula2 Synchaeta sp.1 Monogononta, Ploimida, Synchaetidae S. sp.1 Synchaeta sp.2 Monogononta, Ploimida, Synchaetidae S. sp.2 Philodina acuticornis Bdelloidea,Bdelloida, Philodinidae P. acuticornis Macracanthorhynchus ingens Archiacanthocephala, Oligacanthorhynchida, Oligacanthorhynchidae M. ingens Moniliformis moniliformis Archiacanthocephala, Moniliformida, Moniliformidae M. moniliformis Neoechinorhynchus pseudemydis Eoacanthocephala, Neoechinorhynchida, Neoechinorhynchidae N. pseudemydis Plagiorhynchus cylindraceus Palaeacanthocephala, Polymorphida, Plagiorhynchidae P. cylindraceus Polymorphus altmani Palaeacanthocephala, Polymorphida, Polymorphidae P. altmani Corynosoma enhydri Palaeacanthocephala, Polymorphida, Polymorphidae C. enhydri Centrorhynchus conspectus Palaeacanthocephala, Polymorphida, Centrorhynchidae C. conspectus Echinorhynchus gadi Palaeacanthocephala, Echinorhynchida Echinorhynchidae E. gadi Symbion pandora Cycliophora S. pandora vals, then placed in three successive 45-min baths to clear the intestinal tract [40]. This procedure ensured that each individual used in subsequent analyses had an empty digestive tract during final harvest (checked with 50× power dissecting scope), before being stored at –80 °C. Because the genus Asplanchna is carnivorous, individuals were starved for 24 h prior to harvesting to minimize genetic contamination from their rotifer food, B. angularis. Suitable food for the Synchaetidae was not available for culture; therefore, field collections of Synchaetidae species (Synchaeta tremula, Synchaeta sp1 and Synchaeta sp2) were made, individuals identified, and stored at –80 °C. Origin Rhône river Rhône river ‘Landre’ mere U29235 U49911 ‘Bolmon’ mere ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond ‘Grans’ pond U41281 AF001844 Z19562 U41400 AF001839 AF001838 AF001837 U41399 U88335 Y14811 Fragments were directly sequenced from the purified PCR products using an automated sequencer (Genome Express S.A.) and the PCR primers. Sequences were obtained from GenBank for the following taxa (see table I for accession codes): Bdelloidea (Philodina acuticornis), two Ploimida (Brachionus plicatilis1 and Brachionus plicatilis2), eight Acanthocephala and the Cycliophora (Symbion pandora). 2.2. Molecular data For Ploimida individuals, total DNA was extracted according to the method of Taberlet and Bouvet [41] and a 500-bp segment of 18S rDNA gene was amplified by standard PCR techniques using the following primers: 5’ CCACATCCAAGGAAGGCAGCAGGC 3’ (forward) and 5’ CCCGTGTTGAGTCAAATTAA 3’ (reverse). Thermal cycle parameters were as follows: 2 min at 92 °C (1 cycle); 15 s at 92 °C, 45 s at 48 °C, 1 min 30 s at 72 °C (5 cycles); 15 s at 92 °C, 45 s at 52 °C, 1 min at 72 °C (30 cycles); 7 min at 72 °C (1 cycle). A second, higher annealing temperature of 52 °C was used for more stringent annealing conditions when necessary. The PCR products were purified following the Gelase protocol (EpicentreT) and stored at –20 °C. 928 Figure 1. Relationships of two distance measures with the proportion of nucleotide differences (p distance) for the positions 1–500. A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 2.3. Data analysis All 18S rDNA sequences were aligned manually using MUST [42] and compared with the secondary structure alignment [43]. Visualization of the secondary structure was made using RNAviz [44], which allowed for identification of the three distinct regions described by Winnepenninckx et al. [21] and Garey et al. [32]: two conserved segments (C1 = positions 1 to 186 and C2 = 432 to 500), separated by a variable stretch corresponding to helix E23 (helix E23 = positions 187 to 431). Phylogenetic analyses were performed using three different methods: 1) the neighbour-joining (NJ) method [45] based on a matrix of the Jukes and Cantor distance [46] and the Jukes and Cantor distance with an estimation of alpha parameter equal to 1.22; in Mega [47]. These two distance measures showed similar relationships with the proportion of nucleotide differences (p distance) (figure 1); 2) A cladistic approach following the maximum parsimony (MP) criterion (Branch and bound search of PAUP*); and 3) maximum likelihood (ML) framework was used to choose a model which best explains the data [48, 49]. Figure 2. Part of the secondary structure of the 18S rRNA gene of Brachionus plicatilis showing the complete helix E23. Nucleotides that are polymorphic in Ploidmida are shown in bold. 929 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Table II. Position of substitutions for the different Ploimida clones. See figure 1 for the structural links (* represents a gap). Figure 3. Saturation curves for transitions versus transversions (positions 1–500). General time reversible with a gamma distribution was the best fit model, but the likelihood of this tree was not significantly different to the tree obtained by the Felsenstein’s method [50] using PAUP*. So, due to the computer time calculation, robustness of nodes was estimated by bootstrap with 100 replicates for ML analysis on Felsenstein’s method [50] (using FastDNAML version 1.0 [51], 1 000 replicates for NJ (using Mega) and 1 000 replicates for MP trees (heuristic search of PAUP* with ten random additions of taxa and TBR branch-swapping). Incongruence between partition based on conserved and/or helix E23 of 18S rDNA sequences was assessed by the partition homogeneity test (PHT) [52] as implemented in PAUP* with alpha = 0.01 and 0.001. To test the robustness of deep branches in the tree two constraint trees were built, with each one defining monophyly for one of the 930 groups, and the following statistics were computed: Bremer’s decay index [53]; differences in topology between trees were assessed by Templeton’s test (Wilcoxon signrank tests [54]) and the likelihood ratio test [55]. Relative rate tests were conducted using Phyltest [56]. 3. Results 3.1. Evolutionary patterns of 18S rDNA for Ploimida The Ploimida exhibited slight base composition bias in A + T content (56.41%); however, there were no significant differences in individual nucleotide compositions within or between species. Base frequencies (in percent) were A: 26.7, C: 16.6, G: 27.0 and T: 29.7. Different genera within Ploimida show 18S rDNA sequences that A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 differ by up to 5% (appendix). For instance, the level of differentiation (mean of pair-wise nucleotide differences and standard error) within Brachionus plicatilis was very low (0.0028 ± 0.0012, appendix), while it was very high for the two clones of Keratella quadrata (0.0211 ± 0.0066, appendix). For Synchaeta sp. (the only specimens not cloned), levels of variation between the sequences were 0.09–1.7% (appendix). For Asplanchna priodonta, we found considerable variation among the five clones, ranging from 0.00422 to 0.0211. To ensure that this variation was not due to genetic contamination, one or two additional amplifications were examined for each cloned specimen. These sequences were identical to the original in all cases except B. angularis, where we found two different sequences with a level of variation of 0.0063. Furthermore, no differences were found among sequences from amictic females (i.e. produce diploid egg by mitosis), males and mictic females of the K. quadrata1 clone, indicating that no genetic recombination occurred during cloning. We also examined the variation in 18S sequences by localizing substitutions with respect to secondary structure using the Vawter and Brown [57] nomenclature to name the different structures. In Ploimida sequences, there were 51 substitutions, one deletion in a loop region and two insertions (B. plicatilis2 was used as reference for the secondary structure). All these substitutions appear predominantly in the helix E23. We observed eight substitutions (= 17.02%) in loops (47 bases) and twenty-seven substitutions (= 10.03%) in stems (269 bases), three pairs of which were compensational. The bulges (82 bases) contained six substitutions (= 7.31%) and the ‘other’ (75 bases) showed eleven substitutions plus two nucleotide insertions (= 17.33%). Only two multiple substitutions occurred in loops and three in stems (table II and figure 2). In the C1 region 2.68% of the positions were phylogenetically informative (number of informative positions/length of the region), 2.89% in C2, and 8.16% in the helix E23 region. It can also be seen that all non-homoplasic sites are located in the helix E23 region. Therefore, for the remainder of the study we partitioned the 500-bp segment of the 18S rDNA gene in conserved (C1–C2) and helix E23 (hE23) regions. Many studies have shown that stem, loop and bulge regions of the ribosomal DNA structure exhibit nearly equivalent rates of evolution [57], although structureassociated biases in base composition do exist (G/C rich Figure 4. A. Ratio of transitions to transversions versus percentage divergence for all pair-wise comparisons except those between identical taxa (positions 1–500). B. For the conserved zone (positions 1–186 and 432–500). C. For the helix E23 region (positions 187–431). Saturation curves for transitions versus transversions (positions 1–500). for stem and A/T rich for the loops and ‘other’). Our analysis of base composition revealed no significant differences between regions or taxa. The A + T bias in Ploimida was similar to that in Acanthocephala, Cycliophora and Bdelloidea. The ratio of transitions to transversions showed a rapid decline (figure 3) with increasing total molecular divergence, but no saturation effects were Table III. Characteristics of the phylogenetic data from partial 18S rDNA sequences. Segment hE23 C 1 + C2 C1 + C2 + hE23 Number of trees 11 24 236 Number of steps 395 181 592 CI RI g1 0.72 0.79 –0.97 0.76 0.84 –1.18 0.71 0.79 –1.04 Parsimony Estimation of gamma shape parameter* Informative characters Other variable Constant characters characters 127 62 189 50 46 96 68 147 215 α = 2.69 α = 0.99 α = 1.22 * Yang-Kumar method 1996 [72]. 931 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. A. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the conserved region (positions 1–186 and 432–500) among 26 ‘species’ of Ploimida, Acanthocephala and Bdelloidea, with Cycliophora as an outgroup: using maximum parsimony (bootstrap value on the top left and branch length value at the bottom), neighbour joining on a matrix of the Jukes and Cantor model (middle bootstrap value) and maximum likelihood (right bootstrap value) on a matrix of the Jukes and Cantor model. The likelihood ratio test and Templeton’s test indicate that the three trees are not significantly different in topology so only the maximum parsimony tree is shown. The decay index value is in bold next to the nodes. observed between different substitution patterns (figure 4). Therefore, the entire 500-bp segment of 18S rDNA was used to study phylogenetic relationships between Rotifera and Acanthocephala, with Cycliophora as an outgroup. In order to test the influence of conserved regions and helix E23 on phylogenetic reconstruction, we also analysed these regions separately (sequences descriptions are found in table II. 932 3.2. Phylogenetic analysis 3.2.1. Conserved region (nucleotides 1–186 and 432–500) Of the 254 positions in the conserved region, only 62 were informative for standard unweighted parsimony. The g1 value was –1.175, suggesting that the 18S rDNA data set contains significant phylogenetic signal, and the CI A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. B. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the helix E23 (positions 187–431). The likelihood ratio test and Templeton’s test indicate that the three trees are not significantly different in topology so we show only the maximum parsimony tree. (consistency index) and RI (retention index) (0.762 and 0.836, respectively) indicated a low level of homoplasy (table III). The three tree-making methods (MP, NJ and ML) produced similar topologies, and the likelihood ratio test (LRT) shows that the three trees are statistically indistinguishable. These topologies all displayed a basal dichotomy with Bdelloidea and Acanthocephala forming one cluster and Ploimida forming a large, separate group (figure 5.a). The statistical support for this branching pattern is high (BP > 50 %; decay index = 11) but the branch of the Bdelloidea is extremely long in comparison with the other taxa (46–69 steps in parsimony). However, separate analyses conducted using maximum parsimony for Ploimida and Acanthocephala (using successive addition or removal of Philodina acuticornis) produced no significant difference in the internal structure of the Ploimida or Acanthocephala. The unresolved topology in the Ploimida is not surprising, as there are few parsimony informative sites. In fact, all Ploimida species clustered into a basal polytomy, except Brachionus calyciflorus and K. quadrata2, which apparently grouped together due to stochastic homoplasy. 3.2.2. Helix E23 (nucleotides 187–431) There are 127 parsimony informative sites, which produce a tree (figure 5.b) with CI and RI values of 0.716 and 0.792, respectively (table III). The three methods produced similar topologies and the likelihood ratio test (LRT) did not reject the null hypothesis of topological congruence 933 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Table IV. Alpha values obtained from the test for incongruence of Farris et al. [52] implemented in Paup* Partitions Total data set Ploimida + Acanthocephala Ploimida Ploimida + Bdelloidea Acanthocephala Acanthocephala + Bdelloidea Number of iterations C1/helix E23 C2/helix E23 C1/C2 C1/C2/helix E23 100 1000 100 1000 100 1000 100 1000 100 1000 100 1000 0.010 0.001 0.010 0.007 0.110 0.127 0.110 0.138 0.250 0.199 0.570 0.583 0.060 0.054 0.050 0.039 0.010 0.010 0.020 0.017 0.820 0.824 0.380 0.367 0.540 0.531 0.420 0.398 0.230 0.265 0.310 0.336 1.000 1.000 1.000 1.000 0.010 0.002 0.010 0.003 0.020 0.008 0.050 0.011 0.620 0.616 0.580 0.564 Table V. Relative rate test (Takezaki et al. [73] implemented in Phyltest [56]). We used Symbiom pandora as outgroup. C1 + C2** ∆L = La – Lb Rotifera Ploimida/Ploimida B. plicatilis–K. quadrata A. priodonta–B. plicatilis S. tremula–B. plicatilis A. priodonta–S. tremula K. quadrata–S. tremula K. quadrata–A. priodonta Rotifera Bdelloidea/other P. acuticornis–Ploimida P. acuticornis–Archiacanthocephala P. acuticornis–Eoacanthocephala P. acuticornis–Palaeacanthocephala Rotifera Ploimida/Acanthocephala Ploimida–Archiacanthocephala Ploimida–Eoacanthocephala Ploimida–Palaeacanthocephala Rotifera Acanthocephala/Acanthocephala Archiacanthocephala–Eoacanthocephala Archiacanthocephala–Palaeacanthocephala Eoacanthocephala–Palaeacanthocephala hE23*** Z value ∆L = La – Lb C1 + C2 + hE23**** Z value ∆L = La – Lb Z value –0.011 7 0.011 3 0.003 8 0.007 5 0.015 5 0.023 0 – – – – – * –0.022 3 –0.013 1 0.005 1 –0.018 2 0.017 2 0.035 4 – – – – – – –0.016 3 –0.013 0 –0.000 9 –0.012 1 0.017 3 0.029 4 – – – – – * 0.231 2 0.191 7 0.150 8 0.038 8 * * * – 0.174 7 0.148 8 –0.020 5 –0.149 5 * – – – 0.224 5 0.186 1 0.096 6 –0.363 6 * * – – –0.039 5 –0.080 4 –0.192 4 – * * –0.025 9 –0.195 3 –0.324 2 – * * –0.038 4 –0.127 9 –0.260 9 – * * –0.040 9 –0.152 9 –0.112 0 – * * –0.169 3 –0.298 3 –0.129 * * – –0.089 5 –0.222 5 –0.133 0 * * * 1 * Indicates significant deviation at the null hypothesis (5 % level) from a constant rate molecular clock (–: Indicates non significant deviation); **distance used: Juke and Cantor distance alpha = 0.99; ***distance used: Juke and Cantor distance alpha = 2.69; ****distance used: Juke and Cantor distance alpha = 1.22. among trees. Interestingly, we established for this region a homogeneity in the branch lengths (figure 5.b) between the different groups. This pattern was due to a better uniformity of the rate of substitution for the whole data set than that obtained for the conserved regions alone (table V). Acanthocephala are monophyletic and represented by the two distinct clades ArchiacanthocephalaEoacanthocephala and Palaeacanthocephala (figure 5.b). These relationships were highly supported in bootstrap tests of MP, NJ and ML trees. Within Palaeacanthocephala, there are clearly two orders: Echinorhynchida and Polymorphida. Phylogenetic relationships within Polymorphida remained largely unresolved. 934 The Bdelloidea representative clustered with Ploimida in MP, NJ and ML trees. The Ploimida consists of four monophyletic groups: Brachionus, Keratella, Synchætidae and Asplanchnidae. Phylogenetic relationships between B. angularis and B. calyciflorus indicate a paraphyletic grouping (figure 5.b). The position of Bdelloidea as a sister group of Ploimida was supported by a decay index of 9. Similarly, monophyly of the class Monogononta is supported (figure 5.b). Templeton’s test indicated that the Bdelloidea position in the (Acanthocephala, (Bdelloidea, Ploimida)) topology was significantly different from both a ((Acanthocephala, Bdelloidea), Ploimida) topology and a (Acanthocephala, Bdelloidea, Ploimida) trichotomy. Suc- A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. C. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the conserved and helix E23 (positions 1–500). cessive addition or removal of the three different groups did not change the internal topology of the remaining phyla. 3.2.3. Conserved + helix E23 (nucleotides 1–500) The partition homogeneity test (PHT) between conserved (C1–C2) and helix E23 (hE23) segments of 18S rDNA indicated incongruence between these two regions (table IV). By iteratively removing taxa, we observed that this incongruence was because of a lack of phylogenetic signal in the Ploimida conserved region (C1–C2). Therefore, we combine the two conserved stretches (C1 and C2) and helix E23 (hE23) to study the impact of the incongruence of these two regions (detected for the Ploimida) on the topology and the branch length of the tree based on the whole data set. Regardless of the phylogenetic inference method used, both the Rotifera and Acanthocephala were monophyletic. There are, however, topological differences within groups, depending on the sequence segment used (i.e. C1 + C2, hE23, C1 + C2 + hE23). We find that within Acanthocephala, the main difference between trees based on conserved regions and those based on the helix E23 is the position of Eoacanthocephala. In this case, a combined analysis produced a tree similar to that obtained using only the helix E23 stretch (figure 5.b and c). In the case of the order Ploimida, A. priodonta clones and the family Synchaetidae are monophyletic; however, monophyly of the genus Brachionus is not supported. Interestingly, we observed that the helix E23 and conserved regions do not evolve at the same rate within and among Ploimida, 935 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. D. Strict consensus of the eleven most parsimonious trees (395 steps with a C.I. = 0.72 and a R.I. = 0.79) using the helix E23 (positions 187–431). Bdelloidea and Acanthocephala (table V), increasing the heterogeneity in the branch lengths between the different taxa (figure 5.e). The conserved regions show more violation of rate uniformity than the more variable regions. 4. Discussion Species determination and phylogenetic reconstruction of Ploimida–Bdelloidea–Acanthocephala has been a challenge due to: 1) high levels of morphological homoplasy among extant species [1, 22]; and 2) a scarcity of positively identified fossil Rotifera [58–60]. Therefore, molecular phylogenetics provides an additional avenue of research. This approach has been used previously in the 936 study of Rotifera and Acanthocephala [32, 35]; but many questions remain unanswered about Rotifera polyphyly due to a possible long branch attraction to Bdelloidea. We have attempted to resolve these questions by analysing a previously excluded helix E23 with the 18S rDNA. We also used the helix E23 to address family level relationships of the Ploimida (Rotifera) and ordinal and familial relationships of the Acanthocephala. 4.1. Differentiation in Ploimida clones and phylogenetic utility of 18S rDNA for Ploimida The extensive 18S rDNA polymorphism observed in clones for different Ploimida species (Asplanchna sp., Keratella sp., Brachionus sp., Synchæta sp.) is in agreement with previous findings from allozyme [3, 17–19], A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. E. Bootstrap analyses carried out with 1 000 iterations using neighbour joining on a matrix of the Jukes and Cantor model with gamma shape parameter α = 1.22 for the conserved and helix E23 (positions 1–500). genetic [61, 62] and morphological studies ([63], Rougier, pers. comm.). Also, a strict consensus of the eleven most parsimonious trees (figure 5.d) indicated a Brachionidae clade (Brachionus + Keratella) closely related to the Synchaetidae. This clade was the sister group of the A. priodonta clones. The existence of the Brachionidae clade is not surprising since the genus Keratella has traditionally been included within the Brachionidae family (Keratella was originally considered to be in a distinct family due to absence of a foot, but this distinction was considered too tenuous to warrant classification as a separate family [64]). However, these results have bootstrap support only in neighbour joining. Brachionus and Keratella were found in a polytomy with Synchaeta and Asplanchna in parsimony. We found an unexpected 18S sequence difference between two sequences of 18S rDNA from the same cloned B. angularis individual (0.00634). This result is easily reproduced experimentally and may be due to hybridization or ancestral polymorphism. Distinguishing between these possibilities would require further experi- mentation, though doing so was not necessary for the purposes of this study since this divergence within the clone did not affect the tree topology. While phylogenies based on the helix E23 and conserved plus helix E23 regions were consistent with the accepted relationships, only those based on the helix E23 region had high bootstrap support. The weakly supported nodes (based on conserved plus helix E23 regions) could result from non-constant rates of evolution within and among families (table V), and between conserved and helix E23 regions. The high disparity of evolutionary rates was observed in the foraminifera for which an extreme difference was found in rates of molecular evolution [65]. The observed variation in rates of evolution could be erroneous if some species in Ploimida are actually more closely related to basal taxa than to other Ploimida; however, this would suggest that well-supported topologies based on the helix E23, as well as results from morphological, allozyme and other genetic studies, are all grossly and concordantly incorrect. 937 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Figure 5. F. Bootstrap analyses carried out with 1 000 iterations using neighbour joining on a matrix of the Jukes and Cantor model with gamma shape parameter α = 2.69 for the conserved and helix E23 (positions 187–431). 4.2. Systematics of Acanthocephala Regardless of the data subset used for phylogenetic reconstruction (hE23, C1 + C2 + hE23), our results were consistent with the monophyly of Acanthocephala and monophyly of two of the three currently recognized acanthocephalan classes (the third class, Eoacanthacephala, was only represented by one species). Thus, greater phylogenetic resolution was obtained with molecular data when the sequence from the helix E23 region was included, as opposed to the sequence from conserved regions alone. Inclusion of the helix E23 region still did not provide high bootstrap support for inter-family relationships within the order Polymorphida (samples for the other orders consisted of only one or two families). However, our topology was in general agreement with that of Near et al. [36], in which high bootstrap support was found for these relationships by using the complete 18S rDNA sequence. 938 4.3. Systematic position of Bdelloidea and Rotifera– Acanthocephala relationships We have demonstrated that removal of the helix E23 is not justified because it is useful in reconstructing systematic relationships within both Rotifera and Acanthocephala, as separate analysis of the helix E23 provided better intra-group resolution for Ploimida and Acanthocephala than that obtained by analysis of the conserved regions alone. We observed that the helix E23 and conserved regions do not evolve at the same rate within and among Ploimida, Bdelloidea and Acanthocephala (table V, figure 5.e and f), inducing an heterogeneity in the branch lengths between these three groups when we combine the two regions. The fact that no saturation effects were observed between different substitution patterns (figure 4) removes the possibility of an artefact in the estimation of the substitution rate [66]. In this case using [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] Brachionus plicatilis1 Brachionus plicatilis2 Brachionus plicatilis3 Keratella quadrata1 Keratella quadrata2 Brachionus calyciflorus Brachionus angularis1 Brachionus angularis2 Synchaeta sp.1 Synchaeta tremula1 Synchaeta tremula2 Synchaeta sp.2 Asplanchna priodonta1 Asplanchna priodonta 2 Asplanchna priodonta3 Asplanchna priodonta4 Asplanchna priodonta5 1 2 3 0.002 1 0.004 2 0.038 1 0.036 0 0.034 0 0.019 1 0.012 7 0.016 9 0.023 3 0.025 4 0.027 5 0.023 3 0.029 6 0.035 9 0.035 9 0.027 5 0.002 1 0.003 0 0.002 1 0.002 1 0.035 9 0.038 0 0.033 8 0.031 7 0.031 8 0.029 7 0.016 9 0.014 8 0.010 6 0.008 5 0.014 8 0.016 9 0.021 1 0.019 0 0.023 2 0.025 3 0.025 3 0.027 4 0.021 1 0.023 2 0.027 4 0.029 5 0.033 8 0.031 6 0.033 8 0.031 6 0.025 3 0.027 4 4 5 6 0.008 8 0.008 6 0.008 3 0.008 5 0.008 3 0.008 1 0.008 8 0.008 1 0.007 8 0.006 6 0.009 7 0.021 1 0.007 8 0.046 6 0.029 7 0.038 1 0.027 5 0.023 4 0.031 7 0.025 4 0.021 2 0.029 5 0.027 5 0.033 9 0.033 8 0.029 6 0.036 0 0.038 0 0.031 7 0.038 1 0.035 9 0.035 9 0.044 5 0.035 9 0.033 8 0.044 5 0.038 0 0.035 9 0.048 7 0.048 5 0.040 2 0.046 6 0.046 4 0.040 2 0.053 0 0.040 1 0.038 1 0.048 7 7 8 9 0.006 3 0.005 9 0.005 6 0.008 8 0.007 5 0.007 0 0.005 2 0.004 7 0.004 2 0.008 1 0.007 2 0.006 6 0.003 7 0.005 9 0.005 5 0.005 9 0.007 8 0.007 5 0.008 3 0.005 9 0.004 7 0.006 3 0.016 9 0.019 0 0.021 1 0.027 5 0.027 5 0.029 6 0.035 9 0.031 7 0.031 7 0.010 6 0.012 7 0.019 0 0.021 1 0.021 1 0.027 5 0.029 6 0.029 6 0.025 4 0.006 3 0.008 4 0.010 5 0.014 8 0.021 1 0.027 4 0.027 4 0.019 0 10 0.006 9 0.006 6 0.006 3 0.008 3 0.007 8 0.008 6 0.006 3 0.005 1 0.003 6 0.010 5 0.016 9 0.021 1 0.027 4 0.029 5 0.029 5 0.025 3 11 0.007 2 0.006 9 0.007 2 0.008 8 0.008 1 0.008 8 0.006 6 0.006 3 0.004 2 0.004 7 0.019 0 0.023 2 0.029 5 0.035 9 0.035 9 0.027 4 12 0.007 5 0.007 2 0.007 5 0.008 5 0.008 6 0.009 5 0.007 5 0.006 6 0.004 7 0.005 9 0.006 3 0.025 3 0.031 6 0.038 0 0.033 8 0.029 5 13 0.006 9 0.006 6 0.006 9 0.008 5 0.008 3 0.009 5 0.007 5 0.006 6 0.005 5 0.006 6 0.006 9 0.007 2 14 0.007 8 0.007 5 0.007 8 0.008 8 0.008 6 0.009 9 0.007 8 0.007 5 0.006 6 0.007 5 0.007 8 0.008 0 0.003 6 15 0.008 6 0.008 3 0.008 0 0.009 9 0.009 0 0.009 7 0.008 6 0.007 8 0.007 5 0.007 8 0.008 5 0.008 8 0.005 1 0.006 3 16 0.008 6 0.008 3 0.008 0 0.009 7 0.009 0 0.010 3 0.008 1 0.007 8 0.007 5 0.007 8 0.008 5 0.008 3 0.005 1 0.005 5 0.006 6 0.006 3 0.012 7 0.019 0 0.012 7 0.014 8 0.021 1 0.004 2 0.010 5 0.016 9 0.012 7 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 Appendix. Pairwise comparisons of nucleotide divergences (below the diagonal) and standard errors estimated according to p-distance (above the diagonal) for the different Ploimida clones analysed. 939 A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 the complete 18S rDNA without congruence test between the regions could involve a long branch attraction phenomenon [67, 68]. Nevertheless, there was still sufficient phylogenetic signal to allow reconstruction of evolutionary relationships within Acanthocephala but this phylogenetic signal decreased within Ploimida. Compared to a strict consensus between incongruent data sets (conserved versus helix E23), a combination of regions provided greater resolution at the inter- and intra-phylum levels. However, this procedure was not free of drawbacks. When helix E23 and conserved regions were combined, it was not possible to resolve the intra-Ploimida phylogeny, possibly due to dilution of phylogenetic signal contained in the helix E23 by inclusion of homoplasic positions located in conserved regions (this incongruence is well detected by the partition homogeneity test, table V). 5. Conclusion Several studies addressing Metazoan relationships with 18S rDNA have only used conserved regions because of ambiguities encountered in aligning the helix E23 region at high taxonomic level [21, 33, 37, 69]. This approach has also been considered warranted since conserved regions are generally considered less subject to saturation than the faster evolving helix E23, which would have accumulated greater levels of saturation over such long References [1] Nogrady T., Wallace R.L., Snell T.W., Rotifera Vol. 1: Biology, ecology and systematics, in: Guides of the Identification of the Microinvertebrates of the Continental Waters of the World, SPB Academic Publishing, The Hague, The Netherlands, 1993. [2] Wallace R.L., Snell T.W., Rotifera, in: Ecology and Classification of North American Freshwater Invertebrates, Academic Press, Inc., 1991, pp. 187–248. [3] Gomez A., Temprano M., Serra M., Ecological genetics of a cyclical parthenogen in temporary habitats, J. Evol. Biol. 8 (1995) 601–622. [4] Serra M., Galiana A., Gomez A., Speciation in Monogonont rotifers, Hydrobiologia 358 (1997) 63–70. [5] Pejler B., Introgression in planktonic Rotatoria with some points of view on its causes and conceivable results, Evolution 10 (1956) 246–261. [6] Clément P., Ultrastructural research on Rotifers, Arch. Hydrobiol. Beih. Ergebn. Limnol. 8 (1977) 270–297. [7] Clément P., Phylogenetic relationships of Rotifers as derived from photoreceptor morphology and other ultrastructural analyses, in: Dumont H.J., Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk Publishers, The Hague, 1980, pp. 93–117. [8] Clément P., Amsellem J., Cornillac A.M., Luciani A., Ricci C., Ultrastructural approach to feeding behaviour in Philodina roseola and Brachionus calyciflorus (Rotifers), I- The buccal velum, in: Dumont H.J., Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk Publishers, The Hague, 1980, pp. 127–131. [9] Clément P., Amsellem J., Cornillac A.M., Luciani A., Ricci C., Ultrastructural approach to feeding behaviour in Philodina roseola and Brachionus calyciflorus (Rotifers), II- The oesophagus, in: Dumont H.J., Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk Publishers, The Hague, 1980, pp. 133–136. [10] Wallace R.L., Colburn R.A., Phylogenetic relationships within phylum Rotifera: orders and genus Notholca, Hydrobiologia 186/187 (1989) 311–318. 940 time scales. However, we found that exclusion of the helix E23 region introduces limitations to reconstruction of intraphylum relationships in the Rotifera. Consideration of only conserved regions tends to produce basal polytomies, compromising resolution of phyla-level relationships. Furthermore, combination of the helix E23 region with the conserved region increases the resolution within the Acanthocephalans. Unfortunately, it is not the case for the Rotifers, for which some incongruence was detected between these two regions. On the other hand, even if sites that have experienced an inordinate number of substitutions are eliminated, weak resolution still results due to unintended removal of informative sites [34]. Our results indicate that resolution of Rotifera, Bdelloidea and Acanthocephala inter-relationships will require analysis of additional nuclear genes, such as hox cluster [70, 71], to corroborate the validity of the phylogenetic signal contained in the helix E23 region which has provided robust inference of within-phylum relationships of the Rotifera– Acanthocephalan clades. Acknowledgements. We thank N. Angeli, P. Clément, C. Cunningham, J. Deutsch, J.-L. d’Hondt, T.E. Dowling, S. Gadagkar, S. Kumar, H. Philippe, R. Pourriot, C. Rougier, C. Secor and A. Vaquer for useful comments and/or technical support. We are grateful to J. Garey for sending us a preprint. [11] Clément P., Wurdak E., Rotifera, in: Harrison F.W., Ruppert E.E. (Eds.), Microscopic Anatomy of Invertebrates, Vol.4: Aschelminthes, Wiley-Liss Inc, 1991, pp.219–296. [12] Ahlrichs W.H., Epidermal ultrastructure of Seison nebalia and Seison annulatus, and a comparison of epidermal structures within the Gnathifera, Zoomorphology 117 (1997) 41–48. [13] Snell T.W., Hawkinson C.A., Behavioral reproductive isolation among populations of the rotifer Brachionus plicatilis, Evolution 37 (1983) 1294–1305. [14] Rico-Martinez R., Snell T.W., Mating behavior and mate recognition pheromone blocking of male receptors in Brachionus plicatilis Müller (Rotifera), Hydrobiologia 313/314 (1995) 105–110. [15] Gomez A., Serra M., Mate choice in male Brachionus plicatilis rotifers, Funct. Ecol. 10 (1996) 681–687. [16] Rico-Martinez R., Snell T.W., Mating behavior in eight rotifer species: using cross-mating tests to study species boundaries, Hydrobiologia 356 (1997) 165–173. [17] Fu Y., Hirayama K., Natsukari Y., Genetic divergence between S and L type strains of the rotifer Brachionus plicatilis O.F. Müller, J. Exp. Mar. Biol. Ecol. 151 (1991) 43–56. [18] Hagiwara A., Kotani T., Snell T.W., Assava-Aree M., Hirayama K., Morphology, reproduction, genetics, and mating behavior of small, tropical marine Brachionus strains (Rotifera), J. Exp. Mar. Biol. Ecol. 194 (1995) 25–37. [19] Gomez A., Snell T.W., Sibling species and cryptic speciation in the rotifer Brachionus plicatilis species complex (Rotifera), J. Evol. Biol. 9 (1996) 953–964. [20] Raff R.A., Marshall C.R., Turbeville J.M., Using DNA sequences to unravel the Cambrian radiation of the animal phyla, Annu. Rev. Ecol. Syst. 25 (1994) 351–375. [21] Winnepenninckx B., Backeljau T., Mackey L.Y., Brooks J.M., De Wachter R., Kumar S., Garey J.R., 18S rRNA data indicate that the Aschelminthes are polyphyletic in origin and consist of at least three distinct clades, Mol. Biol. Evol. 12 (1995) 1132–1137. [22] Conway-Morris S., Crompton D.W.T., The origins and evolution of Acanthocephala, Biol. Rev. 57 (1982) 85–115. A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941 [23] Amin O.M., Classification, in: Crompton D.W.T., Nickol B.B. (Eds.), Biology of the Acanthocephala, Cambridge University Press, Cambridge, 1985, pp. 27–72. [24] Whitfield P.J., Phylogenetic affinities of Acanthocephala: an assessment of ultrastructural evidence, J. Parasitol. 63 (1971) 49–58. [25] Storch V., Contributions of comparative ultrastructural research to problems of invertebrate evolution, Am. Zool. 19 (1979) 637–645. [26] Clément P., The relationships of rotifers, in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origins and Relationships of Lower Invertebrates, System. Assoc. Clarendon Press, Oxford, 1985, pp. 224– 247. [27] Lorenzen S., Phylogenetic aspects of pseudocoelomate evolution, in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origins and Relationships of Lower Invertebrates, System. Assoc. Clarendon Press, Oxford, 1985. [28] Ruppert E.E., Introduction to the Aschelminthes phyla: a consideration of mesoderm, body cavities and cuticle, in: Harrison F.W., Ruppert E.E. (Eds.), Microscopic Anatomy of Invertebrates, Vol.4: Aschelminthes, Wiley-Liss Inc., 1991, pp. 1–17. [29] Schram F.R., Ellis W.N., Metazoan relationships: a rebutal, Cladistics 10 (1994) 331–337. [30] Nielsen C., Animal Evolution, Oxford University Press, 1995. [31] Nielsen C., Scharff N., Eibye-Jacobsen D., Cladistic analyses of the animal kingdom, Biol. J Linn. Soc. 57 (1996) 385–410. [32] Garey J.R., Near T.J., Nonnemacher M.R., Nadler S.A., Molecular evidence for Acanthocephala as a subtaxon of Rotifera, J. Mol. Evol. 43 (1996) 287–292. [33] Zrzavy J., Mihulka S., Kepka P., Bezdek A., Phylogeny of the Metazoa based on morphological and 18S ribosomal DNA evidence, Cladistics 14 (1998) 249–285. [34] Abouheif E., Zardoya R., Meyer A., Limitations of Metazoan 18S rRNA sequence data: Implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the Cambrian explosion, J. Mol. Evol. 47 (1998) 394–405. [35] Garey J.R., Schmidt-Rhaesa A., Near T.J., Nadler S.A., The evolutionary relationships of Rotifers and Acanthocephalans, Hydrobiologia 387/388 (1998) 83–91. [36] Near T.J., Garey J.R., Nadler S.A., Phylogenetic relationships of the Acanthocephala inferred from 18S ribosomal DNA sequences, Mol. Phyl. Evol. 10 (3) (1998) 287–298. [37] Winnepenninckx B., Backeljau T., Kristensen R.M., Relations of the new phylum Cycliophora, Nature 393 (1998) 636–638. [38] Koste W., Rotatoria, Die Rädertiee Citteleuropas, 2 vols, Gebrüder Borntraeger, Berlin, 1978. [39] King C.E., Snell T.W., Sexual recombination in rotifers, Heredity 39 (1977) 357–360. [40] Starkweather P.L., Gilbert J.J., Radiotracer determination of feeding in Brachionus calyciflorus: influence of gut passage times, Arch. Hydrobiol. Beih. Ergebn. Limnol. 8 (1977) 261–263. [41] Taberlet P., Bouvet J., A single plucked feather as a source of DNA for bird genetic studies, The AUK 108 (1991) 58. [42] Philippe H., MUST: a computer package of management utilities for sequences and trees, Nucleic Acids Res. 21 (1993) 5264–5272. [43] Van de Peer Y., Caers A., De Rijk P., De Wachter R., Database on the structure of small ribosomal subunit RNA, Nucleic Acids Res. 26 (1998) 179–182. [44] De Rijk P., De Wachter R., RnaViz, a program for the visualisation of RNA secondary structure, Nucleic Acids Res. 25 (1997) 4679–4684. [45] Saitou N., Nei M., The neighbor-joining method: a new method for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406–425. [46] Jukes T.H., Cantor C.R., Evolution of protein molecules, in: Munro H.H. (Ed.), Mammalian Protein Metabolism, Academic Press, New York, 1969, pp. 21–132. [47] Kumar S., Tamura K., Nei M., MEGA: Molecular Evolutionary Genetics Analysis, Pennsylvania State University, University Park, PA, 1993. [48] Cunningham C.W., Zhu H., Hillis D.M., Best-fit maximum likelihood models for phylogenetic inference: empirical tests with known phylogenies, Evolution 52 (1998) 978–987. [49] Kim J., Kim W., Cunningham C.W., A new perspective on lower Metazoan relationships from 18S rDNA sequences, Mol. Biol. Evol. 16 (3) (1999) 423–427. [50] Felsenstein J., Evolutionary trees from DNA sequences: a maximum likelihood approach, J. Mol. Evol. 17 (1981) 368–376. [51] Olsen G.J., Matsuda H., Hagstrom R., Overbeek R., FastDNAML: a tool for construction of phylogenetic trees of DNA sequences using maximum likelihood, Comput. Appl. Biosci. 10 (1994) 41–48. [52] Farris J.S., Källersjö M., Kluge A., Bult C., Testing significance of congruence, Cladistics 10 (1995) 315–320. [53] Bremer K., The limits of amino acid sequence data in Angiosperm phylogenetic reconstitution, Evolution 42 (1988) 795–803. [54] Templeton A.R., Convergent evolution and non-parametric inferences from restriction fragment and DNA sequence data, in: Weir B. (Ed.), Statistical Analysis of DNA Sequence Data, Marcel Dekker, New York, 1983, pp. 151–179. [55] Kishino H., Hasegawa M., Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order of the Hominoidea, J. Mol. Evol. 29 (1989) 170–179. [56] Kumar S., PHYLTEST: a program for testing phylogenetic hypotheses, Pennsylvania State University, University Park, PA, 1996. [57] Vawter L., Brown W.M., Rates and patterns of base change in the small subunit ribosomal RNA gene, Genetics 134 (1993) 597–608. [58] Conway-Morris S., Non-skeletalized lower invertebrate fossils: a review, in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origin and Relationships of Lower Invertebrates, System. Assoc. Clarendon Press, Oxford, 1985, pp. 343–359. [59] Warner B.G., Chengalath R., Holocene fossil Habrotrocha angusticollis (Bdelloidea: Rotifera) in North America, J. Paleolimnol. 1 (1988) 141–147. [60] Waggoner B.M., Poinar G.O., Fossil Habrotrochid rotifers in Dominican amber, Experientia 49 (1993) 354–357. [61] Birky C.W., Studies on the physiology and genetics of the rotifer Asplanchna, III, Results of outcrossing, selfing, and selection, J. Exp. Zool. 165 (1967) 104–116. [62] King C.E., Genetics of reproduction, variation, and adaptation in rotifers, Arch. Hydrobiol. Beih. 8 (1977) 187–201. [63] Pejler B., Variation in the genus Keratella, Hydrobiologia 73 (1980) 207–213. [64] De Beauchamp P.M., Recherches sur les rotifères : les formations tégumentaires et l’appareil digestif, Arch. Zool. Exp. Gen. 10 (1909) 1–410. [65] Pawlowski J., Bolivar I., Fahrni J.F., de Vargas C., Gouy M., Zaninetti L., Extreme differences in rates of molecular evolution of foraminifera revealed by comparison of ribosomal DNA sequences and the fossil, Mol. Biol. Evol. 14 (1997) 498–505. [66] Philippe H., Laurent J., How good are deep phylogenetic trees? Curr. Opin. Genet. Dev. 8 (6) (1998) 616–623. [67] Brinkmann H., Philippe H., Archaea sister group of bacteria? Indications from tree reconstruction artifacts in ancient phylogenies, Mol. Biol. Evol. 16 (6) (1999) 817–825. [68] Philippe H., Chenuil A., Adoutte A., Can the Cambrian explosion be inferred through molecular phylogeny? Development Suppl., 1994, pp. 15–25. [69] Telford M.J., Holland P.W.H., The phylogenetic affinities of the Chaetognaths: a molecular analysis, Mol. Biol. Evol. 10 (1993) 660–676. [70] Adoutte A., Balavoine G., Lartillot N., de Rosa R., Animal evolution - the end of the intermediate taxa? Trends Genet. 15 (3) (1999) 104–108. [71] De Rosa R., Grenier J.K., Andreeva T., Cook C.E., Adoutte A., Akam M., Carroll S.B., Balavoine G., Hox genes in brachiopods and priapulids and protostome evolution, Nature 399 (1999) 772–776. [72] Yang Z., Kumar S., Approximate methods for estimating the pattern of nucleotide substitution rates among sites, Mol. Biol. Evol. 13 (1996) 650–659. [73] Takezaki N., Rzhetsky A., Nei M., Phylogenetic test of the molecular clock and linearized trees, Mol. Biol. Evol. (12) 5 (1995) 823–833. 941