Texte complet- format pdf - MOOC introduction à la biochimie

Université de la Méditerranée – Aix-Marseille II
Faculté des sciences de Luminy
Ecole doctorale des sciences de la vie et de la santé
Thèse
pour obtenir le titre de
docteur de l’Université d’Aix-Marseille II
Discipline : Neurosciences
Présentée et soutenue par
Isabelle VIRARD
Le 4 septembre 2006
Gliogenèse dans la neurohypophyse de rongeur
au cours du développement et chez l’adulte
JURY
Professeur André NIEOULLON
Professeur Jean-Marc MIENVILLE
Docteur Jean-Léon THOMAS
Professeur Emmanuel MOYSE
Docteur Pascale DURBEC
Président
Rapporteur
Rapporteur
Examinateur
Directrice de thèse
Je dédie cette thèse à mes parents et à la mémoire de mes grands-parents
ii
Remerciements
Mes premiers remerciements iront aux rapporteurs de cette thèse, Jean-Marc Mienville
et Jean-Léon Thomas, qui m’ont fait l’honneur d’accepter de juger ce travail. Je leur exprime
toute ma gratitude pour le temps qu’ils m’ont consacré et pour leurs commentaires
constructifs. Merci également à Emmanuel Moyse et André Nieoullon, qui ont consenti à
apporter leur expertise pour l’évaluation de ce travail.
Ensuite, cette thèse n’aurait pu voir le jour sans la confiance et la patience de ma
directrice de recherche, Pascale Durbec, à qui j’adresse ma reconnaissance la plus sincère.
Toujours disponible, elle m’a fait profiter de ses vastes connaissances et de sa maîtrise de
nombreux savoir-faire. Alliant imagination et rigueur scientifique, elle développe des projets
solides, et j’aimerais pouvoir continuer à bénéficier de ses précieux conseils dans l’avenir.
Je tiens aussi à remercier tous les membres –passés et présents– de l’équipe Durbec et
des laboratoires voisins, pour leur agréable compagnie et pour les riches échanges –
scientifiques, philosophiques, gastronomiques– que nous avons eus. Je garderai longtemps le
souvenir de Florence (quel dynamisme !), Xavier (l’Homme de l’équipe), Myriam (toujours
zen), Cristina (au rire éclatant), Judith (la vraie Québécoise), Françoise P. (la douce), Mircea
(le moins doux), Gilberte (toujours en forme), Karine (discrète mais rieuse), Vincent (toujours
prêt à offrir des petits gâteaux), Elodie et David (les athlètes), Fabienne (acharnée au travail),
Bernie (échange voiture contre légumes), Paolo (si inspiré par l’hypophyse !), Jean-Paul
(d’une persévérance exemplaire), Sandrine, Carole, Erik, Emilie, Emeline, Elsa, les trois
Céline, Angélique, Claire…
Un merci très chaleureux à tous mes autres amis (Valérie la courageuse relectrice,
Sophie, Gaspard, Marie L., Guillaume, Elodie, Marie C., Daï, plus tous ceux restés outreAtlantique), qui m’ont permis de passer ces années de doctorat dans la bonne humeur. Bien
entendu, je ne saurais terminer cette liste sans adresser un remerciement particulier à Francis,
qui m’a soutenue tout au long de mes interminables études… et qui, je l’espère, continuera à
le faire pendant de nombreuses années.
Ce mémoire marque pour moi la fin d’une époque : l’aboutissement de mes études et
le terme de mon passage à Marseille. Merci à tous d’avoir été à mes côtés durant cette période
de ma vie, et au plaisir de vous revoir, ici ou ailleurs !
iii
Table des matières
REMERCIEMENTS........................................................................................ III
TABLE DES MATIERES ................................................................................IV
PRINCIPALES ABREVIATIONS.............................................................. VIII
LISTES DES FIGURES ET TABLEAUX....................................................... X
INTRODUCTION ............................................................................................... 1
A. LES CELLULES GLIALES ET LA GLIOGENESE.................................... 1
I. La glie, composante majeure du système nerveux central.............................................. 1
1. Macroglie et microglie ........................................................................................................... 2
2. Les différents types de macroglie du SNC ............................................................................. 3
a. Astrocytes......................................................................................................................................... 3
b. Oligodendrocytes ............................................................................................................................. 4
c. Les autres types de cellules gliales................................................................................................... 5
i. Pituicytes ...................................................................................................................................................... 5
ii. Cellules épendymaires ................................................................................................................................. 6
iii. Tanycytes .................................................................................................................................................... 6
iv. Glie de l’épiphyse........................................................................................................................................ 7
v. Glie radiaire................................................................................................................................................. 7
vi. Glie réactionnelle........................................................................................................................................ 8
II. Le développement des cellules gliales du SNC........................................................... 10
1. La spécification des cellules gliales ..................................................................................... 10
a. La neurulation et le développement du tube neural........................................................................ 10
b. Mécanismes moléculaires de l’établissement des axes antéropostérieur et dorsoventral du tube
neural ................................................................................................................................................. 12
i. Polarité antéropostérieure.......................................................................................................................... 12
ii. Polarité dorsoventrale ............................................................................................................................... 13
c. Zones de spécification gliale dans le tube neural ........................................................................... 14
2. Les différents types de précurseurs gliaux du SNC.............................................................. 16
a. Définition des cellules souches et précurseurs neuraux ................................................................. 16
b. Techniques d’identification des cellules souches et précurseurs neuraux...................................... 16
c. Caractéristiques des différents types de cellules souches et de précurseurs gliaux ........................ 19
i. Cellules neuroépithéliales (NEP)................................................................................................................ 20
ii. Précurseurs restreints au lignage glial (Glial Restricted Precursors ou GRP)......................................... 20
iii. Glie radiaire ............................................................................................................................................. 21
iv. Cellules souches sensibles à l’EGF........................................................................................................... 21
v. Progéniteurs O-2A/OPC ............................................................................................................................ 22
vi. Précurseurs d’astrocytes (Astrocyte Precursor Cells ou APC)................................................................. 23
vii. Précurseurs de motoneurones et d’oligodendrocytes (Motor Neuron-Oligodendrocyte Precursors ou
MNOP)........................................................................................................................................................... 23
3. Les lignages gliaux au cours du développement du SNC .................................................... 26
a. Définition du lignage glial : modèle de restriction progressive des potentiels ............................... 26
b. Techniques d’analyse des lignages neuraux................................................................................... 27
c. Quelques relations établies de lignages gliaux ............................................................................... 29
III. Gliogenèse dans le SNC adulte .................................................................................. 32
1. Cellules souches adultes....................................................................................................... 33
2. Cellules NG2+ (« OPC adultes ») ........................................................................................ 34
3. Autres sources de gliogenèse adulte..................................................................................... 37
iv
B. LA NEUROHYPOPHYSE DE RONGEUR COMME MODELE D’ETUDE
DU LIGNAGE GLIAL .................................................................................... 38
I. Brève anatomie de l’hypophyse.................................................................................... 38
1.Neurohypophyse.................................................................................................................... 38
2. Adénohypophyse.................................................................................................................. 38
3. Lobe intermédiaire ............................................................................................................... 39
II. Composition cellulaire de la neurohypophyse............................................................. 40
1. Axones.................................................................................................................................. 40
2. Vaisseaux sanguins .............................................................................................................. 41
3. Pituicytes .............................................................................................................................. 41
III. Formation ontogénique .............................................................................................. 42
1. Développement des lobes..................................................................................................... 42
2. Différenciation des constituants cellulaires de la neurohypophyse...................................... 44
IV. Physiologie de la neurohypophyse............................................................................. 45
1. Hormones neurohypophysaires ............................................................................................ 45
2. Stimulation et plasticité morpho-fonctionnelle dans la neurohypophyse............................. 46
C. HYPOTHÈSES DE TRAVAIL ................................................................... 49
RESULTATS ..................................................................................................... 50
A. ARTICLE 1 : DES PRECURSEURS D’OLIGODENDROCYTES GENERENT DES
PITUICYTES IN VIVO AU COURS DU DEVELOPPEMENT DE LA NEUROHYPOPHYSE
(VIRARD ET AL. 2006)....................................................................................... 50
I. Approche expérimentale ............................................................................................... 50
II. Résumé des résultats.................................................................................................... 50
B. ARTICLE 2 : CARACTERISATION DE POPULATIONS HETEROGENES DE
PITUICYTES ET LEUR IMPLICATION DANS LA GLIOGENESE INDUITE PAR LA
DESHYDRATATION DANS LA NEUROHYPOPHYSE DE RAT ADULTE (VIRARD ET AL.,
EN PREPARATION).............................................................................................. 54
I. Approche expérimentale ............................................................................................... 54
II. Résumé des résultats.................................................................................................... 54
DISCUSSION ET PERSPECTIVES............................................................... 56
A. GENESE DES PITUICYTES AU COURS DU DEVELOPPEMENT DE LA NH ............ 56
I. Etablissement d’une relation de lignage entre OPC périnataux et pituicytes ............... 56
II. Hypothèses sur l’origine et la migration des OPC de la NH périnatale ...................... 57
1. Recherche du site d’origine des OPC de la NH ................................................................... 58
2. Recherche de signaux de migration des OPC dans la NH.................................................... 59
3. Existence possible de sous-populations d’OPC dans la NH périnatale................................ 61
III. Contrôle de la différenciation des OPC périnataux en pituicytes .............................. 62
1. Provenance des facteurs de différenciation en pituicytes..................................................... 63
2. Identité potentielle des facteurs de différenciation............................................................... 64
v
B. LES PITUICYTES ADULTES : UNE POPULATION GLIALE HETEROGENE ET
PROLIFERATIVE ................................................................................................. 66
I. Hétérogénéité de la population de pituicytes ................................................................ 66
1. Existence de sous-populations de pituicytes définies par des marqueurs astrocytaires ....... 66
2. Découverte de pituicytes pdgfrα+ ........................................................................................ 67
3. Présence de progéniteurs gliaux et absence de cellules souches neurales dans la NH adulte
.................................................................................................................................................. 68
II. Hypothèse quant à l’origine développementale des cellules pdgfrα+ ......................... 69
III. Lignage présumé entre cellules pdgfrα+ et pituicytes S100+ chez l’adulte............... 70
IV. Prolifération et mort cellulaire dans la NH adulte ..................................................... 72
V. Régulation de la prolifération cellulaire dans la NH ................................................... 74
CONCLUSION : APPORTS DE L’ETUDE DE LA NH A LA
COMPREHENSION DE LA GLIOGENESE DANS LE SNC .................... 76
A. INTERETS ET LIMITES DE LA NH COMME MODELE D’ETUDE DE LA
GLIOGENESE : ASPECTS TECHNIQUES ................................................................. 76
B. APPLICATION DES MEMES STRATEGIES A L’ETUDE D’AUTRES ZONES DE
GLIOGENESE ...................................................................................................... 76
C. MISE EN EVIDENCE DE L’HETEROGENEITE DES CELLULES GLIALES ET DE LA
COMPLEXITE DE LEURS LIGNAGES ..................................................................... 77
ANNEXE : RESULTATS COLLABORATIFS ............................................. 79
A. MIGRATION ET DIFFERENCIATION DES CELLULES DE LA ZONE SOUSVENTRICULAIRE DE SOURIS APRES TRANSPLANTATION DANS DIFFERENTES
REGIONS DU CERVEAU ADULTE ......................................................................... 79
I. Introduction................................................................................................................... 79
1. Neurogenèse adulte : le système ZSV-RMS-BO ................................................................. 79
2. Intérêt pour la thérapie cellulaire.......................................................................................... 80
3. Modèle de transplantation hétérotypique pour étudier les potentialités des cellules de ZSV
.................................................................................................................................................. 81
II. Résultats....................................................................................................................... 81
I. Article 3 : Conversion gliale de précurseurs neuronaux issus de la zone sous-ventriculaire
après transplantation ectopique dans le cerveau adulte (Seidenfaden et al. 2006)................... 81
2. Article 4 : Potentiel de migration et de myélinisation de progéniteurs neuraux de la zone
sous-ventriculaire dans les faisceaux de matière blanche du cerveau de rongeur adulte (Cayre
et al. 2006)................................................................................................................................ 82
III. Discussion .................................................................................................................. 84
1. Les cellules de la ZSV migrent efficacement le long des fibres sous-corticales.................. 84
2. Les cellules de la ZSV ont un potentiel neurogénique limité hors du système ZSV-RMS-BO
.................................................................................................................................................. 85
3. Intérêt thérapeutique des cellules de la ZSV pour les maladies démyélinisantes ................ 86
IV. Conclusion ................................................................................................................. 88
vi
B. UTILISATION DE MARQUEURS GLIAUX DANS L’ETUDE DES GLIOMES HUMAINS
.......................................................................................................................... 89
I. Introduction................................................................................................................... 89
1. Définition des gliomes ......................................................................................................... 89
2. Classification des gliomes selon l’OMS .............................................................................. 89
3. Classification de l’hôpital Sainte-Anne................................................................................ 89
4. Approche moléculaire .......................................................................................................... 90
5. Utilisation de marqueurs gliaux dans la classification des gliomes ..................................... 90
II. Résultats....................................................................................................................... 91
1. Article 5 : Expression des gènes olig commune aux gliomes et aux précurseurs
d’oligodendrocytes (Bouvier et al. 2003)................................................................................. 91
2. Article 6 : Pertinence des profils d’expression de filaments intermédiaires et de facteurs de
transcription pour comprendre l’histogenèse des gliomes (Colin et al., soumis)..................... 91
III. Discussion .................................................................................................................. 92
1. Importance diagnostique de profils d’expression de marqueurs gliaux ............................... 92
2. Cellules souches neurales et cellules progénitrices dans les gliomes : présence et rôle
présumé dans l’oncogenèse ...................................................................................................... 93
IV. Conclusion ................................................................................................................. 95
BIBLIOGRAPHIE ............................................................................................ 96
vii
PRINCIPALES ABREVIATIONS
A2B5
Anticorps monoclonal dirigé contre des gangliosides membranaires
AH
AdénoHypophyse
APC
Astrocyte Precursor Cell : précurseur d’astrocyte
ARA-C
β-D-ARAbinofuranosylCytosine
bHLH
basic Helix-Loop-Helix domain : domaine hélice-boucle-hélice basique
BMP
Bone Morphogenetic Proteins : protéines morphogénétiques osseuses
BrdU
BromoDésoxyUridine
BSA
Bovine Serum Albumin : albumine de sérum bovin
CNP
Cyclic Nucleotide Phosphodiesterase : phosphodiestérase de nucléotides cycliques
CNTF
Ciliary NeuroTrophic Factor : facteur neurotrophique ciliaire
dm20
Un transcrit du gène plp
DMEM
Milieu de Eagle modifié par Dulbecco
DNase
DésoxyriboNucléase
E…
Jour Embryonnaire …
EAE
Encéphalomyélite Auto-immune Expérimentale
EGF
Epidermal Growth Factor : facteur de croissance épidermique
FACS
Fluorescence-Activated Cell Sorting : Tri cellulaire à fluorescence
FCS
Fetal Calf Serum : sérum de veau foetal
FGF
Fibroblast Growth Factor : facteur de croissance fibroblastique
GalC
GalactoCérébroside
GFAP
Glial Fibrillary Acidic Protein : protéine gliale fibrillaire acide
GFP
Green Fluorescent Protein : protéine verte fluorescente
GGF
Glial Growth Factor : facteur de croissance glial
GRP
Glial Restricted Precursor : précurseur restreint au lignage glial
IgG, IgM
Immunoglobuline G, M
ILB4
Isolectine B4
lacZ
Gène de la β-galactosidase
LI
Lobe Intermédiaire
MACS
Magnetic Associated Cell Sorting : tri cellulaire magnétique (nom déposé)
MAG
Myelin-Associated Glycoprotein : glycoprotéine associée à la myéline
MBP
Myelin Basic Protein : protéine basique de la myéline
MenB
Anticorps dirigé contre PSA-NCAM
viii
MNOP
Motor Neuron-Oligodendrocyte Precursor : précurseur de motoneurone et
d’oligodendrocyte
MOG
Myelin-Oligodendrocyte Glycoprotein : glycoprotéine de la myéline des
oligodendrocytes
NCAM
Neural Cell Adhesion Molecule : molécule neurale d’adhésion cellulaire
NEP
NeuroEpithelial Precursor : précurseur neuroépithélial
NG2
Nerve/Glial antigen 2 : Antigène nerveux/glial 2
NH
NeuroHypophyse
NRP
Neuronal Restricted Precursor : précurseur restreint au lignage neuronal
NT3
NeuroTrophin 3 : neurotrophine 3
O4
Anticorps dirigé contre des sulfatides membranaires
Olig
Oligodendrocyte LIneage Gene : gène du lignage oligodendrocytaire
OPC
Oligodendrocyte Precursor Cell : précurseur d’oligodendrocyte
P…
Jour Postnatal…
PBS
Phosphate-Buffered Saline : solution saline tamponnée au phosphate
PDGF
Platelet-Derived Growth Factor : facteur de croissance dérivé des plaquettes
PDGFRα
Récepteur alpha du PDGF-AA
PF ou PFA
ParaFormaldéhyde
PLP
ProteoLipid Protein : protéine protéolipidique
pMN
Domaine de spécification des motoneurones dans le tube neural
Progéniteur
Progéniteur d’Oligodendrocyte et d’Astrocyte de type 2
O-2A
PSA-NCAM
Forme polysialylée de NCAM
RMS
Rostral Migratory Stream : courant rostral de migration
Shh
Sonic HedgeHog
SNC
Système Nerveux Central
SVZ
SubVentricular Zone : zone sous-ventriculaire
Tuj1
Anticorps monoclonal dirigé contre la βIII tubuline
TUNEL
Terminal deoxyribonucleotidyl transferase-mediated dUTP Nick End Labeling
(marquage de l’ADN fragmenté des cellules en apoptose)
VEGF
Vascular Endothelial Growth Factor : facteur de croissance de l’endothélium
vasculaire
ZSV
Zone Sous-Ventriculaire
ix
Listes des figures et tableaux
Figure 1 : Le décours temporel des phases de neurogenèse, d’astrogenèse et
d’oligodendrogenèse ................................................................................................................ 10
Figure 2 : Formation du tube neural chez les vertébrés. ......................................................... 11
Figure 3 : Les vésicules du tube neural et leurs structures dérivées chez l’adulte.................. 11
Figure 4 : Induction de l’axe antéropostérieur dans le tube neural. ........................................ 12
Figure 5 : Induction de domaines de spécification des progéniteurs neuraux par l’expression
dorsale des BMP et ventrale de Shh dans la moelle épinière................................................... 13
Figure 6 : Représentation schématique du patron d’expression de plp/dm20 dans l’embryon
de souris à E12,5. ..................................................................................................................... 14
Figure 7 : Origine restreinte des précurseurs d’oligodendrocytes dans le tube neural ventral
de souris à E12,5 ...................................................................................................................... 15
Figure 8 : Spécification des précurseurs d’oligodendrocytes et d’astrocytes dans des régions
distinctes du tube neural........................................................................................................... 15
Figure 9 : Principe d’analyse clonale de neurosphères pour mettre en évidence la présence de
cellules souches neurales.......................................................................................................... 18
Figure 10 : Restriction progressive des potentialités cellulaires au cours d’un lignage ......... 26
Figure 11 : Méthodes in vivo d’analyse des lignages neuraux du SNC .................................. 29
Figure 12 : Relations de lignage possibles entre les différents précurseurs gliaux au cours du
développement du SNC............................................................................................................ 31
Figure 13 : Origine développementale des cellules souches de la ZSV adulte....................... 34
Figure 14 : Anatomie de l’hypophyse..................................................................................... 39
Figure 15 : Développement embryonnaire de l’hypophyse de rongeur.................................. 43
Figure 16 : Stimulation et effets de la sécrétion d’hormones neurohypophysaires ................ 45
Figure 17 : Action des hormones impliquées lors d’une déshydratation ou un excès de sel.. 47
Figure 18 : Changements morphologiques au cours d’une stimulation de la NH .................. 48
Figure 19 : Le lignage oligodendrocytaire .............................................................................. 51
Figure 20 : Analyse du lignage des pituicytes grâce à des souris olig1-cre/RosaLacZ .......... 53
Figure 21 : Analyse du lignage des cellules pdgfrα+ grâce à des souris pdgfrα-creER/Rosa26GFP .......................................................................................................................................... 71
Figure 22 : Hypothèse sur la régulation du nombre de cellules dans la NH adulte ................ 73
Figure 23 : Neurogenèse dans le système olfactif de rongeur adulte...................................... 80
Tableau 1 : Les types de cellules macrogliales du SNC adulte ................................................ 9
Tableau 2 : Correspondance entre les stades de la seconde moitié du développement
embryonnaire chez la souris et le rat........................................................................................ 19
Tableau 3 : Types de cellules souches et précurseurs générant de la glie au cours du
développement du SNC de rongeur ......................................................................................... 25
Tableau 4 : Les types cellulaires de la NH de rat adulte......................................................... 42
Tableau 5 : Classification des gliomes selon l’OMS .............................................................. 89
x
Science is far from a perfect instrument of knowledge. It’s just the best we have.
Carl Sagan
The Demon-Haunted World
xi
INTRODUCTION
Longtemps négligées au profit des neurones, les cellules gliales jouent pourtant des
rôles fondamentaux dans le fonctionnement du système nerveux. A présent, de nombreuses
recherches sont en cours pour dévoiler les mystères de ces cellules, tant au niveau de leur
fonction que de leur développement.
Lors de mes études doctorales, je me suis particulièrement intéressée aux progéniteurs
gliaux, en prenant comme modèle le lobe postérieur de l’hypophyse, ou neurohypophyse
(NH). J’ai d’abord cherché à comprendre l’origine développementale des pituicytes, les
cellules gliales de la NH. Par ailleurs, dans certaines conditions physiologiques, la NH adulte
subit des changements morphologiques et fonctionnels importants, accompagnés par la
formation de nouvelles cellules gliales. J’ai donc voulu tester l’hypothèse que cette structure
pourrait constituer une source de cellules souches ou progénitrices, responsables de cette
gliogenèse adulte.
Afin de situer ce travail, il convient dans un premier temps de résumer les
connaissances actuelles sur les cellules gliales et en particulier sur leur origine
développementale. J’aborderai dans un second temps l’anatomie et l’histologie de la NH, le
développement de ses constituants, ainsi que ses propriétés physiologiques particulières.
Suivront alors un exposé et une discussion de mes résultats principaux sur les progéniteurs
gliaux trouvés dans la NH au cours du développement et chez l’adulte.
Pour terminer, je présenterai des travaux faits dans le cadre de collaborations. Ils
s’inscrivent dans la continuité de mes études sur les cellules progénitrices et les lignages
gliaux dans la NH, tout en y ajoutant une dimension clinique. En effet, ils concernent d’une
part les cellules souches de la zone sous-ventriculaire (ZSV) et leur utilisation potentielle pour
le traitement de maladies neurodégénératives et, d’autre part, l’utilisation de marqueurs gliaux
dans l’analyse des gliomes humains.
A. LES CELLULES GLIALES ET LA GLIOGENESE
I. La glie, composante majeure du système nerveux central
Le terme de « cellules gliales », ou encore « neurogliales », désigne les cellules non
neuronales du système nerveux. Dans le système nerveux central (SNC) des vertébrés, elles
surpassent en nombre les neurones, dans une proportion de 10 à 50 cellules gliales par
neurone (Kandel & Schwartz 1985). C’est Rudolf Virchow qui, au XIXe siècle, les a baptisées
« neuroglie » (Nervenkitt), pensant qu’elles constituaient une sorte de glue pour maintenir
1
l’assemblage des neurones (Virchow 1859, cité dans Dermietzel & Spray 1998). Comme les
cellules gliales ne présentent pas de propriétés électrophysiologiques aussi manifestes que
celles des neurones, on a longtemps cru que leur fonction consistait principalement à soutenir
les neurones, à leur apporter des éléments nutritifs et à maintenir l’homéostasie du système
nerveux pour protéger les neurones fragiles (Kandel & Schwartz 1985). Cependant, des
recherches récentes ont révélé leur rôle actif dans d’autres processus fondamentaux, par
exemple la neurotransmission et la plasticité synaptique (Yang et al. 2003; Araque & Perea
2004). De plus, plusieurs équipes ont montré que les cellules souches qui permettent la genèse
de nouveaux neurones chez l’animal jeune et adulte ont des caractéristiques de cellules gliales
(Doetsch et al. 1999; Alvarez-Buylla et al. 2001; Namba et al. 2005). Depuis ces travaux,
l’étude de la glie est l’objet d’un intérêt sans cesse grandissant. La présente thèse porte sur des
cellules gliales particulières du SNC, les pituicytes, et plus précisément sur le lignage dont
elles seraient issues au cours du développement et chez l’adulte.
1. Macroglie et microglie
On classe les cellules gliales en deux grandes catégories : la microglie et la macroglie.
Comme leur nom le laisse supposer, cette distinction est fondée sur une différence de taille
entre ces deux types cellulaires.
Capable de phagocytose, la microglie serait l’équivalent des macrophages dans le
SNC. Lors d’une lésion au cerveau ou à la moelle épinière, son taux de prolifération
augmente de façon significative (Graeber et al. 1988). Les cellules microgliales alors activées
migrent pour atteindre le lieu de la blessure et aider à sa réparation (Kreutzberg 1996; Streit
2000). L'anticorps monoclonal OX42 et l’isolectine B4 tirée de Griffonia simplicifolia (ILB4)
marquent la microglie aussi bien activée phagocytaire que quiescente (Robinson et al. 1986;
Streit & Kreutzberg 1987; Ling et al. 1990).
A la différence des cellules macrogliales, qui dériveraient de l’ectoderme, la microglie
proviendrait probablement des précurseurs des monocytes du sang et donc du mésoderme
(Streit 2001). De par cette origine distincte, on exclut souvent la microglie de l’ensemble des
cellules gliales et le mot « glie » est alors utilisé au lieu de « macroglie ». Le présent travail de
thèse portant sur un type particulier de macroglie, je n’approfondirai pas davantage la
présentation de la microglie.
Par ailleurs, le terme « cellule neurale » est employé pour englober à la fois les
neurones et les cellules macrogliales, donc toutes les cellules du système nerveux à
l’exclusion de la microglie et des cellules des vaisseaux sanguins.
2
2. Les différents types de macroglie du SNC
Il existe une grande diversité de cellules macrogliales, dont les deux principaux types
sont les astrocytes et les oligodendrocytes. Par souci de clarté, je ne détaillerai ici que les
cellules macrogliales du SNC et omettrai volontairement les cellules de Schwann et les
cellules satellites du système nerveux périphérique. Je tiens à souligner que, comme pour
toute classification, cette présentation synthétique ne rend pas bien compte de l’hétérogénéité
importante qui peut exister au sein de chaque catégorie de cellules gliales.
a. Astrocytes
Cellules macrogliales les plus abondantes, les astrocytes tirent leur nom de leur forme
étoilée. Ce sont en effet des cellules très ramifiées, dont les prolongements sont souvent
apposés aux vaisseaux sanguins (Raine 1999). Elles peuvent ainsi contrôler la
vasoconstriction (Koehler et al. 2006) et constituent un élément clé de la barrière
hématoméningée (Abbott 2002), frontière de nature physico-chimique qui restreint le passage
des cellules immunitaires et la diffusion des molécules hydrosolubles entre la circulation
sanguine et le SNC (Ganong 1977; Prat et al. 2001). Les astrocytes ont aussi une fonction
nourricière envers les neurones et les oligodendrocytes (Deitmer 2001; Goldman 2004). Ils
régulent également l’environnement chimique des neurones : par exemple, ils en retirent les
ions K+ en excès et recyclent les neurotransmetteurs libérés durant la transmission synaptique
(Kandel & Schwartz 1985; Simard & Nedergaard 2004). En fait, il est maintenant établi que
les astrocytes modulent grâce à des gliotransmetteurs la formation des synapses au cours du
développement (Ullian et al. 2004), ainsi que leur maintien et leur efficacité chez l’adulte
(Kang et al. 1998; Araque et al. 1999; Ullian et al. 2001).
Classiquement, la morphologie permet de différencier les astrocytes protoplasmiques
et les astrocytes fibreux. Ces derniers comptent de nombreux filaments intermédiaires tandis
que les astrocytes protoplasmiques ont des prolongements courts et plus épais qui contiennent
peu de filaments. En ce qui concerne leur distribution, les astrocytes fibreux semblent
concentrés dans la substance blanche et les protoplasmiques, dans la substance grise, où ils
sont spécialement associés aux synapses (Kandel & Schwartz 1985). En plus de cette
classification morphologique, il n’est pas impossible qu’il existe une certaine diversité parmi
les astrocytes, notamment selon les régions étudiées, mais elle demeure méconnue (Rao
2004a). De manière générale, les astrocytes sont répartis dans tout le SNC, avec leurs corps
cellulaires séparés dans l’espace, chaque astrocyte couvrant un domaine propre (Bushong et
al. 2002). Les astrocytes forment en fait une « matrice », un réseau de cellules connectées
3
entre elles par des jonctions communicantes qui permettent le passage du calcium et d’autres
petites molécules (pour une revue, voir Saez et al. 2003). Par conséquent, la stimulation d’un
astrocyte à un endroit précis (par exemple par du glutamate en provenance de neurones
voisins) peut entraîner une vague calcique qui se propage de cellule en cellule (Haydon 2001).
La protéine gliale fibrillaire acide (Glial Fibrillary Acidic Protein, GFAP) est de loin
le marqueur le plus utilisé pour identifier les astrocytes (Bignami et al. 1972), bien qu’elle
soit exprimée moins fortement dans les astrocytes protoplasmiques de la substance grise.
D’autres marqueurs fréquents, considérés comme moins spécifiques que GFAP, sont la
protéine liant le calcium S100B, la synthétase de glutamine (GS) et les transporteurs de
glutamate GLAST et GLT-1 (EAAT2 chez l’humain). Il existe aussi en culture des astrocytes
dits de type 2, distincts des autres astrocytes (de type 1) par leur morphologie étoilée et leur
expression conjointe de GFAP, de vimentine et de l’antigène d’A2B5 (Raff et al. 1983a; Raff
et al. 1984). Soulignons que certaines cellules dont la morphologie rappelle celle des
astrocytes n’expriment pas tous ces marqueurs et, inversement, que ces molécules sont parfois
retrouvées dans des cellules très différentes des astrocytes (Kimelberg 2004). Pour cette
raison, il est indispensable d’utiliser une combinaison de marqueurs pour identifier clairement
une population cellulaire donnée.
b. Oligodendrocytes
Les oligodendrocytes sont de petites cellules gliales munies elles aussi de
prolongements. Ils forment une gaine de myéline en entourant ces prolongements autour des
axones du SNC. La myéline, constituée de lipides et de protéines, a pour fonction d’isoler les
axones et ainsi d’améliorer la conduction de l’influx nerveux (Kandel & Schwartz 1985).
Les oligodendrocytes sont présents dans tout le SNC mais sont moins abondants dans
la substance grise que dans la blanche, qui tire d’ailleurs son nom de la couleur de la myéline.
Différents sous-types d’oligodendrocytes sont définis d’après des caractéristiques
morphologiques et biochimiques, notamment le diamètre des axones qu’ils myélinisent
(détaillées dans les revues de Miller (2002) et Le Bras et al. (2005)).
D’une manière générale, les oligodendrocytes matures myélinisants sont reconnus par
des marqueurs de constituants de la myéline, en particulier la protéine basique de la myéline
(Myelin Basic Protein, MBP), le protéolipide PLP (ProteoLipid Protein), les glycoprotéines
MOG (Myelin Oligodendrocyte Glycoprotein) et MAG (Myelin-Associated Glycoprotein) et
la phosphodiestérase CNP (2’,3’-Cyclic Nucleotide 3’-Phosphodieserase) (Lazzarini 2004). Il
existe aussi des gènes exprimés à la fois par les oligodendrocytes matures et leurs précurseurs
4
qui servent donc de marqueurs pour tout le lignage oligodendrocytaire, comme ceux des
facteurs de transcription Sox10, Olig1 et Olig2 (Wegner 2001). Enfin, d’autres marqueurs
sont essentiellement utilisés sur des oligodendrocytes maintenus en culture, par exemple les
anticorps O4 et GalC (GalactoCerebroside) (Sommer & Schachner 1981; Ranscht et al.
1982).
c. Les autres types de cellules gliales
Plusieurs types de cellules gliales ont des propriétés qui les distinguent au moins
partiellement des astrocytes et des oligodendrocytes. Elles sont présentes dans une fenêtre de
temps limitée au cours du développement ou alors dans des zones restreintes du SNC. C’est
notamment le cas des pituicytes, les cellules gliales de la neurohypophyse, sujet central de la
présente thèse.
Mentionnons que certaines de ces populations gliales particulières, à savoir les
pituicytes, les tanycytes, la glie de l’épiphyse et les glies de Bergmann et de Müller, ainsi que
la glie engainante du système olfactif (appartenant au système nerveux périphérique), sont
parfois regroupées sous le terme d’aldynoglie, en référence à leur capacité à favoriser la
pousse neuritique (Gudino-Cabrera & Nieto-Sampedro 1999).
i. Pituicytes
Le terme « pituicytes » désigne les cellules de la glande pituitaire, l’hypophyse, et plus
spécifiquement les cellules gliales de sa partie postérieure, aussi appelée neurohypophyse
(NH) (Bucy 1932). Situées notamment au niveau des contacts entre les terminaisons
axoniques hypothalamiques et les vaisseaux sanguins, elles joueraient un rôle de régulation de
la sécrétion de neurohormones qui sera détaillé dans la deuxième partie de cette introduction.
Au vu de colorations histologiques classiques, les pituicytes ont d’abord été considérés
comme des cellules bien distinctes des astrocytes (Bucy 1932). Cependant, la tendance
actuelle veut qu’ils soient des astrocytes spécialisés puisqu’ils expriment des marqueurs
retrouvés dans les cellules du lignage astrocytaire tels GFAP (Salm et al. 1982; Velasco et al.
1982), S100B (Cocchia & Miani 1980) ou vimentine (Marin et al. 1989).
5
ii. Cellules épendymaires
Les cellules épendymaires constituent un deuxième exemple de cellules gliales
particulières. De morphologie variée, mais souvent ciliée, les cellules épendymaires sont
reconnaissables à leur localisation. Elles forment en effet une monocouche qui borde les
parois des ventricules cérébraux et du canal central de la moelle épinière (Kandel & Schwartz
1985).
Leur fonction première est de constituer une barrière entre le liquide céphalorachidien
(LCR) et le fluide extracellulaire du SNC, mais elles semblent également remplir d’autres
rôles (Bruni 1998). Par exemple, en faisant battre leurs cils, ces cellules aident à la circulation
du LCR (Worthington & Cathcart 1963; Cathcart & Worthington 1964). De ce fait, elles
servent à établir un gradient de molécules de guidage qui oriente la migration vers le bulbe
olfactif des progéniteurs neuronaux issus de la zone sous-ventriculaire (ZSV) antérieure
adulte (Sawamoto et al. 2006). Elles procèderaient aussi à la filtration du LCR (Del Bigio
1995). D’après le laboratoire de Jonas Frisen, certaines cellules épendymaires pourraient
également être des cellules souches dans la ZSV adulte (Johansson et al. 1999), une
hypothèse très controversée et désormais largement écartée (Chiasson et al. 1999).
Les molécules GFAP, vimentine, S100 et kératine font partie des marqueurs retrouvés
dans au moins certaines cellules épendymaires mais ces observations varient d’une étude à
l’autre, notamment en fonction de l’espèce, de la zone anatomique et du stade de
développement analysés (Bruni 1998).
iii. Tanycytes
Intercalées parmi les cellules de l’épendyme se trouvent des cellules différentes par
leur morphologie et, sans doute, leur fonction : ce sont les tanycytes. La caractéristique
morphologique des tanycytes consiste en un long prolongement basal qui plonge dans le tissu
nerveux sous-jacent, où il contacte des vaisseaux sanguins, des neurones ou d’autres cellules
gliales (Bruni 1998). Chez les mammifères adultes, la localisation des tanycytes est restreinte
à certaines zones, notamment le plancher du quatrième ventricule, l’aqueduc de Sylvius, les
organes périventriculaires et les parois latérales du troisième ventricule (Flament-Durand &
Brion 1985). Comme les astrocytes, les cellules épendymaires et les tanycytes sont assemblés
en un réseau interconnecté par des jonctions communicantes (Jarvis & Andrew 1988).
Le rôle des tanycytes, encore méconnu, varie selon la sous-population étudiée et serait
lié à différentes fonctions : le maintien d’un certaine forme de barrière entre le LCR et le
sang, ou encore la régulation de la sécrétion d’hormones de l’adénohypophyse (Rodriguez et
6
al. 2005). Une particularité intrigante des tanycytes concerne les contacts privilégiés, parfois
synaptoïdes, que certains établissent avec des neurones et qui laissent supposer que leur
fonction serait sous contrôle de l’activité neuronale (Bruni 1998).
De nombreuses molécules ont été décrites comme étant exprimées dans les tanycytes,
notamment GFAP, S100, vimentine et RC1, un marqueur de glie radiaire (voir Rodriguez et
al. 2005 pour une revue). Il existe cependant plusieurs sous-types de tanycytes de localisation
et de morphologie variables et reconnus par différentes combinaisons de marqueurs
(Rodriguez et al. 2005).
iv. Glie de l’épiphyse
L’épiphyse constitue une glande endocrine attachée à la partie postérieure du troisième
ventricule cérébral et située hors de la barrière hématoméningée. Elle est responsable de la
sécrétion de nombreuses hormones telles la mélatonine et la sérotonine, qui interviennent
notamment dans la régulation des rythmes biologiques (Nussey & Whitehead 2001). En plus
des cellules sécrétrices (les pinéalocytes), cette structure renferme des cellules gliales, dont la
fonction serait de réguler la synthèse et la sécrétion d’hormones (Echigo & Moriyama 2004).
Elles sont souvent considérées comme des astrocytes parce qu’elles expriment GFAP, S100B
et vimentine. Notons que l’expression de ces marqueurs semble hétérogène (Kofler et al.
2002).
v. Glie radiaire
La glie radiaire a surtout été caractérisée au cours du développement. Elle tire son nom
de la forme et de la position de ses cellules : allongées, elles ont deux prolongements reliant
les surfaces luminale et piale du tube neural. La glie radiaire forme ainsi une sorte
d’échafaudage le long duquel les neurones nouvellement formés migrent pour atteindre leur
localisation finale dans le SNC (Rakic 1972; Alberts et al. 2002). En fin d’embryogenèse, elle
présente aussi des caractéristiques de cellules souches, puisqu’elle génère des astrocytes, des
neurones et des oligodendrocytes (voir la section ultérieure sur les types de précurseurs gliaux
au cours du développement du SNC).
Dans le cerveau mature, la glie radiaire ne subsiste qu’à deux endroits : le cervelet et
la rétine. Dans le cervelet, elle prend le nom de « glie de Bergmann » et régule la plasticité
synaptique (Muller & Kettenmann 1995). Dans la rétine, les « cellules de Müller » modulent
l’environnement cellulaire (Nilius & Reichenbach 1988) et communiquent de façon
bidirectionnelle avec les neurones, contribuant ainsi à réguler le traitement de l’information
7
visuelle (Newman 2004). De plus, chez certains vertébrés comme le poulet, la glie de Müller
peut également servir de précurseur neuronal et donc participer à la régénération de la rétine
(Fischer & Reh 2001).
Des marqueurs classiques de la glie radiaire sont RC1 et RC2, mais ils ne sont pas
maintenus chez l’adulte (Misson et al. 1988; Edwards et al. 1990). Par contre, on retrouve
GFAP, S100B, vimentine et GLAST dans la glie radiaire adulte (Shaw et al. 1981; Bignami
1984; Landry et al. 1989; Muller 1992; Rothstein et al. 1994; Derouiche & Rauen 1995).
vi. Glie réactionnelle
Enfin, un dernier type de macroglie n’apparaît dans le SNC qu’après une lésion : c’est
la glie réactionnelle. Lors d’une atteinte au SNC provoquée par exemple par une ischémie,
des maladies neurodégénératives ou une tumeur, on observe localement des astrocytes
hypertrophiés, qui prolifèrent (on parle alors de « gliose réactionnelle ») et expriment des
niveaux importants de plusieurs marqueurs astrocytaires, notamment GFAP (Eng et al. 2000).
La cicatrice gliale qui en résulte est souvent considérée comme un obstacle à la repousse
axonique mais pourrait en fait avoir pour fonction de circonscrire la zone lésée pour éviter
que les dommages se propagent (Kimelberg 2004; Pekny & Nilsson 2005).
Le tableau 1 ci-après résume les principales caractéristiques de chaque type de
macroglie du SNC adulte, en incluant les cellules NG2+ décrites plus tard, dans la section sur
la gliogenèse adulte.
8
Tableau 1 : Les types de cellules macrogliales du SNC adulte
Nom
Morphologie
Distribution
Fonction
Astrocytes
Etoilée.
Protoplasmiques :
prolongements
courts, épais et
très branchés.
Fibreux :
prolongements
longs et fins
Petites cellules,
prolongements
entourant les
axones
Variée.
Prolongements.
Uniforme dans tout
le SNC
(protoplasmiques :
matière grise;
fibreux : matière
blanche)
Barrière
hématoméningée,
régulation de
l’environnement
chimique, modulation
des synapses…
Préférentielle dans
la matière blanche
Myélinisation
Neurohypophyse
Modulation de la
neurosécrétion ?
Cellules
épendymaires
Variée, souvent
ciliée. Forment
une monocouche.
Tanycytes
Long
prolongement
basal
Barrière entre le SNC et
le LCR, circulation et
filtration du LCR,
guidage des précurseurs
neuronaux de la ZSV
Méconnue : lien entre le
LCR et le sang,
régulation de la
sécrétion d’hormones
Glie de
l’épiphyse
Etoilée
Parois des
ventricules
cérébraux et du
canal central de la
moelle épinière
Intercalée parmi les
cellules
épendymaires, dans
des zones
restreintes du SNC
Epiphyse
Glie de
Bergmann
Radiaire
Cervelet
Glie de Müller
Radiaire
Rétine
Glie
réactionnelle
Hypertrophiée
Glie NG2+
2 types :
soit uni- ou
bipolaire, soit
multipolaire et très
ramifiée
Oligodendrocytes
Pituicytes
Régulation de la
synthèse et de la
sécrétion de mélatonine
Régulation de la
plasticité synaptique
Modulation de
l’environnement
cellulaire,
communication avec les
neurones
Au site d’une lésion Circonscription de la
lésion
Uniforme dans tout
le SNC
Méconnue : genèse
d’oligodendrocytes, de
neurones, de la glie
réactionnelle, mise en
place et stabilisation des
synapses et des nœuds
de Ranvier…
Exemples de
marqueurs
GFAP,
GLAST,
GLT-1, GS,
S100B
CNP, MAG,
MBP, MOG,
Olig1/2,
PLP, Sox10
GFAP, PSANCAM,
S100B,
vimentine
GFAP,
kératine,
S100B,
vimentine
GFAP, RC1,
S100,
vimentine
GFAP,
S100B,
vimentine
GFAP,
GLAST,
S100B,
vimentine
GFAP,
GLAST,
S100B,
vimentine
GFAP,
S100B,
vimentine
NG2,
PDGFRα,
Olig1/2
9
II. Le développement des cellules gliales du SNC
Une question particulièrement étudiée ces dernières années concerne l’origine de la
glie et les relations de lignage qui lient les différents types de cellules gliales.
1. La spécification des cellules gliales
Au cours du développement, les principaux types de cellules neurales apparaissent
séquentiellement chez l’embryon (Figure 1) : d’abord les neurones, puis les astrocytes, et
enfin les oligodendrocytes, dont la maturation persiste après la naissance (Sauvageot & Stiles
2002).
Figure 1 : Le décours temporel des phases de neurogenèse,
d’astrogenèse et d’oligodendrogenèse
Au cours du développement du cerveau, la formation des trois principaux types cellulaires se
déroule séquentiellement selon trois phases partiellement chevauchantes dans le temps. Dans
le cerveau antérieur de rat, la neurogenèse connaît un pic au 14e jour de gestation (E14),
l’astrogenèse au deuxième jour postnatal (P2), et l’oligodendrogenèse à P14.
Tiré de Sauvageot & Stiles 2002
Cependant, même si les cellules gliales apparaissent tardivement, il est désormais
établi que leur identité est déterminée bien plus tôt d’après la position de leurs précurseurs au
sein du tube neural.
a. La neurulation et le développement du tube neural
Après la gastrulation, où se forment les trois feuillets embryonnaires (endoderme,
mésoderme et ectoderme), le système nerveux se met en place au cours d’une étape du
développement appelée « neurulation ». Chez le rat, elle a lieu à E9 (Ayer-Le Lievre et al.
1995). Sous l’influence de substances inductrices sécrétées par le mésoderme, les cellules
ectodermiques sus-jacentes se transforment en cellules neurales. La région dorsale de
10
l'ectoderme s'épaissit alors pour former la plaque neurale, qui se referme ensuite en gouttière
puis en un tube détaché de l'ectoderme : c’est le tube neural (Figure 2) (Gilbert 2000).
Figure 2 : Formation du tube neural chez les vertébrés.
De manière simplifiée, la formation du tube neural est ici présentée en trois étapes.
A. Le mésoderme (Msd) induit dans l’ectoderme (Ecd) sus-jacent la spécification de la
plaque neurale (PN).
B. La plaque neurale s’invagine et prend la forme d’une gouttière (G) tandis que la
notochorde (Nc) apparaît ventralement dans le mésoderme.
C. La gouttière se referme en un tube, le tube neural (TN).
S : somites; CN : crête neurale
Tiré de Bongarzone 2002
Par la suite, la partie antérieure du tube neural présente un renflement qui correspond
au futur encéphale. Progressivement, cette vésicule se subdivise, ce qui mène à la formation
de trois, puis cinq vésicules. Chacune donne naissance à des structures bien précises du SNC.
La figure 3 illustre ces divisions du tube neural et les dérivés du futur SNC qu’elles génèrent
(Gilbert 2000).
Figure 3 : Les vésicules du tube neural et leurs structures dérivées chez l’adulte
Dans sa partie antérieure, le tube neural des vertébrés est d’abord subdivisé en trois vésicules
primaires, puis en cinq vésicules secondaires. Chez les mammifères, ces vésicules génèrent
ensuite les structures indiquées à droite.
Tiré de Gilbert 2000
11
b. Mécanismes moléculaires de l’établissement des axes antéropostérieur et
dorsoventral du tube neural
Des mécanismes moléculaires complexes contrôlent le développement du tube neural,
tant au niveau de l'induction que de la prolifération, de la migration et de la différenciation
cellulaires. En particulier, ces différents processus dépendent de signaux moléculaires qui
proviennent notamment des tissus adjacents et qui façonnent la polarité antéropostérieure et
dorsoventrale du tube neural. C’est en effet la position d’une cellule dans le tube qui
détermine son identité.
i. Polarité antéropostérieure
L’expression des gènes Hox, qui contrôlent l’établissement de l’axe antéropostérieur
dans tout l’organisme, régule aussi l’identité cellulaire dans le cerveau postérieur et la moelle
épinière. La formation des vésicules neurales le long de l’axe antéropostérieur implique
également les Fibroblast Growth Factors (FGF), Wnt, engrailed et l’acide rétinoïque, en
provenance du mésoderme voisin et de l’organisateur isthmique (région antérieure à la
constriction qui sépare les vésicules mésencéphalique et rhombencéphalique). Au niveau du
prosencéphale, c'est la plaque préchordale qui joue le rôle d'inducteur avec l'expression de
facteurs de transcription tels que Emx, Lim et Otx (Altmann & Brivanlou 2001 et site
www.embryology.ch).
Figure 4 : Induction de l’axe antéropostérieur dans le tube neural.
La régionalisation antéropostérieure du tube neurale résulte de l’effet inducteur de différents
signaux en provenance de la plaque préchordale (en bleu), de l’organisateur isthmique (en
rouge), de la notochorde (en jaune) et du mésoderme dorsal (en vert).
en : engrailed ; M : mésencéphale ; P : prosencéphale ; R, rhombencéphale ; TN : tube
neural.
Tiré du site www.embryology.ch
12
ii. Polarité dorsoventrale
Deux types de molécules ont été identifiées comme des acteurs majeurs de la
régionalisation dorsoventrale du tube : Sonic Hedgehog (Shh) et les Bone Morphogenetic
Proteins (BMP). Shh, molécule sécrétée par la notochorde puis également par le plancher du
tube neural, induit la spécification des types cellulaires ventraux. En effet, différentes
concentrations de Shh induiraient l’expression de facteurs de transcription, qui, par des
répressions mutuelles, établissent une succession de domaines ventraux. Dans chaque
domaine se développent un ou plusieurs sous-types spécifiques de progéniteurs neuronaux,
par exemple les motoneurones dans le domaine pMN de la moelle. De la même manière, du
côté dorsal, les BMP du toit du tube neural sont responsables de la formation de domaines
d’expression de facteurs de transcription qui définissent l’identité des types cellulaires
dorsaux (Bongarzone 2002; Wilson & Maden 2005).
Figure 5 : Induction de domaines de spécification des progéniteurs neuraux
par l’expression dorsale des BMP et ventrale de Shh dans la moelle épinière
A. La sécrétion ventrale de Shh et celle, dorsale, de BMP et d’autres molécules dorsalisantes
(dorsaline, activine) mènent à la formation de deux gradients contraires de morphogènes. Ces
gradients induisent la création d’une série de domaines de spécification des cellules neurales.
B. Ces domaines de spécification sont définis par l’expression de différents facteurs de
transcription (à gauche sont présentés certains facteurs exprimés chez la souris). Les
pointillés indiquent que les frontières de ces domaines changent au cours du développement.
Par exemple, l’expression de Nkx2.2 s’étend dorsalement. Dans chacun de ces domaines sont
spécifiés des types de neurones différents, notamment les motoneurones dans le pMN.
dP1–dP6 : domaines dorsaux; pMN et p0–p3 : domaines ventraux.
Tiré de Gilbert 2000 et Richardson et al. 2006
13
c. Zones de spécification gliale dans le tube neural
Comme pour les neurones, l’identité des cellules gliales est régie par leur position dans
le tube neural. Ainsi, les oligodendrocytes ne naissent que dans des régions bien précises du
tube. En effet, l’expression de marqueurs du lignage oligodendrocytaire comme pdgfrα et
plp/dm20 est d’abord restreinte à quelques zones focales de la moelle et du cerveau (Figure
6), puis s’étend à tout le tube neural au fur et à mesure que les cellules qui les expriment
migrent dans le SNC.
Figure 6 : Représentation schématique du patron d’expression de plp/dm20
dans l’embryon de souris à E12,5.
Chez l’embryon de souris, plp/dm20 est exprimé dans des territoires (en rouge) très restreints
et discontinus le long de l’axe antéropostérieur. En particulier, ces transcrits sont détectés
dans l’aire entopédonculaire (aep), le diencéphale (notamment dans la zona limitans
intrathalamica (zli)), les rhombomères r1, r2, r6 et r7 et dans deux colonnes continues dans
la moelle épinière (non montré), mais pas dans le mésencéphale (més) ni dans les
rhombomères r3 à r5.
p(n): prosomère; r(n): rhombomère
Tiré de Spassky et al. 2000
De plus, dans l’axe dorsoventral, la formation initiale des oligodendrocytes nécessite
l’action de Shh et a donc lieu dans des domaines de spécification ventraux. Par exemple, dans
la moelle, les précurseurs d’oligodendrocytes proviennent d’abord du domaine ventral de
détermination des motoneurones (pMN) et, dans le télencéphale, de régions ventrales comme
l’éminence ganglionnaire médiane (Figure 7). Ces précurseurs migrent ensuite dorsalement et
latéralement avant de se différencier en oligodendrocytes. Des travaux récents ont également
montré qu’une seconde vague d’oligodendrocytes naît dans la partie dorsale de la moelle
vers E13,5-E15 chez la souris (Cai et al. 2005; Vallstedt et al. 2005).
14
Figure 7 : Origine restreinte des précurseurs d’oligodendrocytes
dans le tube neural ventral de souris à E12,5
Chez la souris, les précurseurs d’oligodendrocytes (points bleus) émergent vers E12,5 dans
des zones ventrales du tube neural, tels le domaine pMN dans la moelle épinière (A) et
l’éminence ganglionnaire médiane et l’aire entopédonculaire dans le télencéphale (B).
Tiré de Rowitch 2004
La spécification des astrocytes a été moins étudiée, notamment faute de marqueur
précoce de leur lignage. Toutefois, des études génétiques semblent indiquer que ces cellules
sont générées tout le long de l’axe antéropostérieur du tube neural mais dans des zones
restreintes selon l’axe dorsoventral. Il s’agit de régions distinctes des zones de spécification
des oligodendrocytes, à savoir le domaine ventral p2 dans la moelle et un domaine dorsal dans
le télencéphale (Zhou 2003; Rowitch 2004; Muroyama et al. 2005).
Figure 8 : Spécification des précurseurs d’oligodendrocytes et d’astrocytes
dans des régions distinctes du tube neural
Avant de migrer hors de la zone ventriculaire, les précurseurs d’oligodendrocytes et
d’astrocytes sont sans doute spécifiés dans des domaines distincts du tube neural.
A. Chez les rongeurs, les oligodendrocytes émergent en effet du domaine pMN de la moelle
épinière alors que les astrocytes seraient spécifiés dans le domaine p2 plus dorsal.
B. Dans le télencéphale, les astrocytes naîtraient dans une région dorsale où sont générés les
neurones pyramidaux tandis que les précurseurs d’oligodendrocytes émaneraient
essentiellement de régions ventrales comme les éminences ganglionnaires médiane (EGM) et
latérale (EGL), c’est-à-dire près d’une source de Sonic hedgehog (Shh).
BMP : Bone Morphogenetic Proteins
Tiré de Rowitch 2004
15
2. Les différents types de précurseurs gliaux du SNC
Plusieurs types de cellules souches ou progénitrices présentes dans le SNC en
développement ont été identifiés comme étant capables de générer des cellules gliales. Avant
de présenter leurs différentes propriétés, la nécessité de définir les cellules souches et
progénitrices s’impose, ainsi qu’un bref exposé des techniques utilisées pour leur
caractérisation et l’établissement de leur lignage.
a. Définition des cellules souches et précurseurs neuraux
Le terme « cellules souches neurales » ne s’applique qu’aux cellules qui possèdent les
cinq propriétés suivantes (Reynolds & Weiss 1996) :
1) elles sont prolifératives, même si leur cycle de division peut être relativement long ;
2) elles ont la capacité de s’auto-renouveler, c’est-à-dire qu’elles peuvent produire des
cellules filles identiques à la cellule mère et ce, indéfiniment. Cela implique que la population
de cellules souches ait la capacité de se diviser de façon asymétrique, afin de générer des
progéniteurs engagés vers une voie de différenciation tout en maintenant un réservoir de
cellules souches indifférenciées.
3) elles sont multipotentes, autrement dit capables de générer des cellules différenciées
des trois principaux types cellulaires du SNC (neurones, astrocytes, oligodendrocytes) ;
4) elles maintiennent cette multipotentialité au cours du temps ;
5) elles doivent en principe permettre la restauration du tissu nerveux après une lésion.
Cependant, cette propriété est rarement utilisée pour définir une cellule souche.
On parle plutôt de « précurseur multipotent » quand une cellule a la possibilité de se
différencier en au moins deux lignages différents mais possède une capacité à s’autorenouveler limitée. Il existe aussi des précurseurs engagés dans un lignage donné, par
exemple des précurseurs d’astrocytes ou des précurseurs d’oligodendrocytes. J’utiliserai ici
indifféremment les termes « précurseur » et « progéniteur ».
b. Techniques d’identification des cellules souches et précurseurs neuraux
L’identification de cellules souches résulte généralement d’une combinaison de tests
fonctionnels in vivo et in vitro (Noble et al. 2004; Ming & Song 2005).
Premièrement, l’étude de la prolifération de ces cellules peut se faire in vivo, grâce à
des marqueurs de cellules en division. Pour les repérer, on injecte ou on fait ingérer à l’animal
des agents intercalants qui s’intègrent dans l’ADN au cours d’un cycle cellulaire.
Typiquement, il s’agit de la thymidine marquée radioactivement ou de ses analogues -le plus
16
courant étant la bromodésoxyuridine (BrdU)- que l’on détecte par autoradiographie ou
immunocytochimie. Des marqueurs spécifiques de certaines phases du cycle cellulaire
(PCNA, Ki67, phospho-histone H3) ont également été découverts et servent à identifier les
cellules non quiescentes (Miyachi et al. 1978; Gerdes et al. 1984; Celis et al. 1986; Bacchi &
Gown 1993).
En ce qui concerne la capacité de différenciation des cellules souches ou progénitrices,
elle est souvent analysée in vitro. Les cellules sont pour cela dissociées, puis parfois
sélectionnées, par exemple sur un gradient de centrifugation, par sélection par le milieu de
culture, ou par tri cellulaire magnétique (MACS) ou à fluorescence (FACS). Après la mise en
culture, on détermine le phénotype des cellules qu’elles génèrent d’après leur morphologie,
l’expression de marqueurs ou encore par analyse de leurs propriétés électrophysiologiques.
Des transplantations peuvent aussi servir à démasquer le potentiel de différenciation des
cellules. Cependant, si les potentiels de différenciation ainsi mis en évidence in vitro ou après
transplantation révèlent la capacité d’une cellule donnée à générer telle ou telle cellule mature
dans ces conditions, ils ne permettent pas de savoir si cette cellule se différencie
effectivement dans ces types cellulaires in vivo dans son environnement naturel.
Ensuite, l’auto-renouvellement des cellules souches et des précurseurs est le plus
fréquemment déterminé in vitro. En particulier, les cellules souches dissociées et maintenues
en cultures flottantes constituent des structures en forme de boules, des « neurosphères », au
fur et à mesure qu’elles se divisent en réponse à l’Epidermal Growth Factor (EGF) et/ou au
FGF-2 (Reynolds & Weiss 1992). La capacité à former des neurosphères en tant que telle ne
démontre pas l’existence de cellules souches, simplement la présence de cellules en division.
En fait, les neurosphères sont composées d’une proportion de cellules souches souvent faible,
le reste étant des précurseurs aux potentiels de prolifération et de différenciation plus ou
moins restreints. Pour démontrer qu’un tissu contient des cellules souches capables de s’autorenouveler, une analyse clonale est nécessaire : les neurosphères dites primaires sont alors
dissociées et remises en culture et, dans ces conditions, seules les cellules souches survivent
pour former à nouveau des neurosphères, dites secondaires. Après transfert dans des
conditions adéquates, on vérifie que ces neurosphères secondaires se différencient en cellules
des trois lignages neuraux (neuronal, astrocytaire et oligodendrocytaire). Ces expériences sont
ensuite répétées sur plusieurs générations de sphères, ce qui permet d’établir que les cellules
conservent leur capacité à s’auto-renouveler et maintiennent leur multipotentialité au cours du
temps (Figure 9).
17
Figure 9 : Principe d’analyse clonale de neurosphères
pour mettre en évidence la présence de cellules souches neurales
1. Après dissociation, les cellules du tissu nerveux sont cultivées en présence d’EGF. Les
cellules souches neurales survivent et prolifèrent pour former des clones de cellules non
différenciées flottant dans le milieu, les neurosphères primaires.
2. Sur un support permettant leur adhésion, les cellules composant les neurosphères se
différencient pour générer les trois types cellulaires majeurs du système nerveux central:
neurones, astrocytes et oligodendrocytes.
3. En cultivant les cellules composant les neurosphères en condition clonale (1 cellule par
puits), seule une minorité des cellules forme de nouvelles neurosphères (dites secondaires)
capables de se différencier en neurones, astrocytes et oligodendrocytes. Ces cellules
sélectionnées par l’EGF, capables d’auto-renouvellement et multipotentes sont des cellules
souches neurales.
4. Si les neurosphères primaires contiennent effectivement des cellules souches, alors après
dissociation et mise en culture dans un seul puits, elles doivent aussi pouvoir donner
naissance à des neurosphères secondaires, elles aussi multipotentes, et ainsi de suite pendant
de nombreux passages. Cela montre que les propriétés des cellules souches sont maintenues
au fil du temps.
Tiré de Bouissac 2005, adapté de Reynolds & Weiss 1996
Pour terminer, je mentionnerai que plusieurs marqueurs de précurseurs gliaux ont été
identifiés (voir plus bas) mais qu’on ne connaît pas de marqueur universel de cellules souches
18
neurales, qui faciliterait grandement leur étude. Malgré tout, certains auteurs ont identifié des
cellules immatures qu’ils ont souvent qualifiées de cellules souches neurales grâce à
l’expression de nestine (Lendahl et al. 1990; Yamaguchi et al. 2000), Sox2 (D'Amour & Gage
2003; Ferri et al. 2004; Episkopou 2005), Musashi-1 (Kaneko et al. 2000), ssea1/LeX (Capela
& Temple 2002) ou bien GFAP (Doetsch et al. 1999). Cependant, ces marqueurs n’ont sans
doute qu’une spécificité partielle, reconnaissant plutôt des sous-types de cellules souches ou
progénitrices (Emsley et al. 2005). Par ailleurs, une technique d’isolement des cellules
souches consiste à utiliser le marqueur nucléaire Hoechst 33342 : les cellules souches ont
tendance à l’exclure par le biais d’un transporteur membranaire et sont donc reconnaissables à
leur profil de fluorescence particulier lorsqu’elles sont triées par FACS (Hulspas &
Quesenberry 2000; Engstrom et al. 2002; Bhattacharya et al. 2003; Kim & Morshead 2003).
c. Caractéristiques des différents types de cellules souches et de précurseurs gliaux
Les techniques détaillées ci-dessus ont permis d’identifier et de caractériser plusieurs
types de cellules souches et de précurseurs neuraux qui génèrent des cellules gliales au cours
du développement du SNC. Leurs propriétés caractéristiques sont décrites ici et récapitulées
plus bas dans le tableau 3. Il est important de souligner que cette liste n’est en rien exhaustive
ni applicable directement à tout le SNC. Certaines régions, notamment la moelle épinière et le
cortex cérébral, ont été plus étudiées. On présume souvent que le développement des autres
régions leur est en grande partie similaire (Rao 2004a) mais c’est probablement incorrect : il
est tout à fait probable qu’il existe de nombreuses particularités locales. De plus, chaque étude
présente rarement toute la batterie des tests exposés plus haut. Ainsi, un progéniteur n’a peutêtre pas été trouvé in vivo, ou bien on ne connaît pas entièrement son potentiel de
différenciation. Bref, les données sur chaque précurseur sont souvent parcellaires. Ce n’est
que petit à petit qu’elles permettront d’obtenir une représentation complète des différents
progéniteurs gliaux.
Avant tout, comme certaines de ces études ont été faites chez la souris et d’autres chez
le rat, je précise dans le tableau 2 la correspondance entre les stades de développement
embryonnaire chez ces deux espèces.
Tableau 2 : Correspondance entre les stades de la seconde moitié
du développement embryonnaire chez la souris et le rat
Souris E…
Rat
9
9,5
10 10,5 11 11,5 12 12,5 13 13,5 14 14,5 15 15,5 16 18,5
E… 10,5 11 11,5 12 12,5 13 13,5 14 14,5 15 15,5 16 16,5 17 17,5 20
Tiré du site http://embryology.med.unsw.edu.au/OtherEmb/Rat.htm
19
i. Cellules neuroépithéliales (NEP)
Lors de la formation du SNC, le tube neural précoce se présente comme une
monocouche de cellules en prolifération appelées précurseurs neuroépithéliaux (NEP, pour
NeuroEpithelial Precursors). Chez l’embryon de rat1 à 10,5 jours de gestation (E10,5), elles
constituent l’essentiel du tube. Ce sont des cellules souches multipotentes (Davis & Temple
1994; Kalyani et al. 1997; Cai et al. 2002) qui dépendent du FGF in vitro (Kalyani et al.
1997). Elles expriment des marqueurs tels nestine, Musashi-1, Sox2 et sont immunonégatives
pour PSA-NCAM, A2B5, GFAP et d’autres marqueurs de cellules différenciées (Kaneko et
al. 2000; Rao 2004a). Bien que les NEP semblent tous identiques dans leur capacité à
proliférer et dans leur multipotentialité, ils présentent une certaine régionalisation en termes
de potentiel de migration et d’expression de certains marqueurs (Hitoshi et al. 2002).
Avec l’âge, la proportion de NEP diminue à mesure qu’augmente celle des
progéniteurs plus restreints (Levison & Goldman 1997). Ainsi, à E14,5, les NEP ne
représentent plus que 10% des cellules du tube neural, comme l’indiquent des études
d’expression de marqueurs et des analyses clonales (Kalyani et al. 1997; Mayer-Proschel et
al. 1997; Rao 2004a). Les autres cellules du tube neural sont alors des précurseurs neuronaux
(NRP, pour Neuronal Restricted Precursors) et gliaux (cellules de la glie radiaire et GRP,
pour Glial Restricted Precursors) (Mayer-Proschel et al. 1997; Kalyani et al. 1998; Rao et al.
1998).
ii. Précurseurs restreints au lignage glial (Glial Restricted Precursors ou GRP)
Dès E12, des cellules progénitrices engagées vers une destinée gliale peuvent être
isolées du tube neural de rat, à tous les niveaux rostrocaudaux : ce sont les GRP (Rao et al.
1998; Gregori et al. 2002; Rao 2004a). In vitro et in vivo après transplantation, les GRP
peuvent donner naissance à des oligodendrocytes et à deux types d’astrocytes (de types 1 et
2), mais pas à des neurones (Rao et al. 1998; Herrera et al. 2001). Les astrocytes de type 1 ont
une morphologie aplatie en culture et expriment S100B et GFAP mais pas l’antigène d’A2B5,
alors que les astrocytes de type 2, de forme étoilée, sont aussi GFAP+ mais également A2B5+
et parfois O4+ (Raff et al. 1983a; Ingraham et al. 1999). On reconnaît les GRP à leur
expression de l’antigène d’A2B5 et de nestine. D’autres marqueurs semblent définir deux
sous-types de GRP, présents dans des domaines distincts de la moelle embryonnaire : le
premier exprimant Olig1, Olig2 et Sox10, le second dm20, Ngn3, Nkx2.2 et Sox2 (Liu et al.
1
A moins d’indication contraire, les âges correspondent au développement chez le rat.
20
2002). Par contre, les GRP n’expriment initialement pas PDGFRα, le récepteur α du PlateletDerived Growth Factor-AA (PDGF-AA) (Rao 2004a).
iii. Glie radiaire
Quand les NEP commencent à générer des précurseurs neuraux, ceux-ci migrent hors
de la zone ventriculaire (centrale) du tube neural et forment ce qu’on appelle la zone du
manteau, autour de la zone ventriculaire où subsistent les NEP. C’est dans ce manteau que
débute la différenciation des neurones et de la glie radiaire, cette dernière servant de guide
pour la migration des neurones nouvellement formés (Rakic 1972). Traditionnellement, les
cellules de la glie radiaire sont considérées comme les premières cellules gliales différenciées
qui peuvent être distinguées dans le tube neural. Cependant, le rôle des cellules de la glie
radiaire comme précurseurs d’astrocytes, de neurones, d’oligodendrocytes et de cellules
épendymaires est désormais établi (Schmechel & Rakic 1979; Levitt & Rakic 1980; Choi &
Kim 1985; Hirano & Goldman 1988; Voigt 1989; Malatesta et al. 2000; Miyata et al. 2001;
Noctor et al. 2001; Fogarty et al. 2005; Spassky et al. 2005). Il semblerait qu’elles soient
aussi à l’origine des cellules souches du SNC adulte (Merkle et al. 2004). Des marqueurs
fréquemment utilisés pour détecter la glie radiaire sont RC1 et RC2, GLAST, nestine,
vimentine et zébrine-2 (Shibata et al. 1997; Goldman 2004), RC1 étant par exemple présent à
partir de E13,5 dans le tube neural de rat (Liu et al. 2002). Il existe cependant des variations
dans l’expression de ces marqueurs dans la glie radiaire, ce qui suggère qu’elle serait plus
hétérogène qu’on ne le supposait (Campbell & Gotz 2002).
iv. Cellules souches sensibles à l’EGF
Une autre population de cellules fait son apparition à partir de E14 chez la souris
(donc vers E15,5 chez le rat), soit juste après la différenciation de la glie radiaire et des
premiers neurones, et avant l’expression de marqueurs gliaux comme NG2 ou GFAP : il
s’agit des cellules souches dépendantes de l’EGF (Reynolds et al. 1992; Morshead et al.
1994), alors que nous avons vu que les NEP ont une dépendance trophique au FGF (Kalyani
et al. 1997; Rao 2004a). Probablement situées dans la zone sous-ventriculaire (ZSV), elles
sont multipotentes in vitro, où elles peuvent former des neurosphères. Cependant,
contrairement aux NEP, elles semblent perdre cette multipotentialité au fil de leurs divisions,
du moins en cultures de neurosphères (Rao 2004b). Les cellules souches sensibles à l’EGF
représentent 1-3% des cellules du SNC de souris à E14 (Reynolds & Weiss 1996). A ma
connaissance, seuls les récepteurs de l’EGF pourraient servir de marqueur pour les distinguer
21
des NEP, avec lesquelles elles coexistent. Ces deux types de cellules souches peuvent
contribuer à la gliogenèse mais leur participation respective réelle est difficile à estimer (Rao
2004a).
v. Progéniteurs O-2A/OPC
Historiquement, le précurseur glial caractérisé le premier fut le progéniteur O-2A,
ainsi baptisé parce qu’il génère en culture des oligodendrocytes et des astrocytes de type 2
(Raff et al. 1983b). Comme il n’a jamais été clairement démontré que les progéniteurs O-2A
donnent naissance à des astrocytes in vivo au cours du développement normal (Skoff 1990;
Fulton et al. 1991; Fulton et al. 1992; Espinosa de los Monteros et al. 1993; Franklin &
Blakemore 1995), les progéniteurs O-2A sont désormais appelés précurseurs d’oligodendrocytes ou OPC (Oligodendrocyte Precursor Cells).
Ces cellules ont été abondamment caractérisées in vitro, notamment à partir de nerf
optique périnatal. Par exemple, de nombreuses études ont montré la dépendance des OPC visà-vis-de différents facteurs (voir Miller 2002 pour une revue). Notamment, le FGF-2, le
PDGF-AA et la neurotrophine-3 (NT3) sont importants dans la régulation de leur croissance,
leur survie et leur migration (Noble et al. 1988; Richardson et al. 1988; Armstrong et al.
1990; Bogler et al. 1990; McKinnon et al. 1990; Noble et al. 1990; Barres et al. 1993; Barres
et al. 1994). Mentionnons aussi les travaux de Kondo et Raff, qui ont démontré que des OPC
maintenus en culture peuvent générer des astrocytes de type 2, qui à leur tour donnent
naissance à des cellules souches neurales (Kondo & Raff 2000).
Les cultures d’OPC ont également permis de définir des marqueurs caractéristiques
des OPC, notamment PDGFRα (Hall et al. 1996) et le protéoglycane NG2 (Nishiyama et al.
1996b), ainsi que l’antigène de surface reconnu in vitro par l’anticorps A2B5 (Raff et al.
1983b). D’autres marqueurs de l’ensemble du lignage oligodendrocytaire se retrouvent dans
les OPC : Sox10, un facteur de transcription essentiel à la différenciation terminale des
oligodendrocytes (Kuhlbrodt et al. 1998; Zhou et al. 2000), Olig1 et Olig2, deux facteurs de
transcription de la famille bHLH nécessaires à l’engagement des OPC et à la spécification du
lignage oligodendrocytaire (Lu et al. 2000; Zhou et al. 2000), et les transcrits plp/dm20 et cnp
des protéines PLP et CNP (Yu et al. 1994; Spassky et al. 1998), des composants de la
myéline.
In vivo, il n’est souvent pas aisé de déterminer si les cellules qui expriment ces
marqueurs sont des OPC ou bien des GRP, dont l’existence n’a été mise en évidence que bien
plus tard, ou encore d’autres types de précurseurs non identifiés. Seule l’expression de pdgfrα
serait caractéristique des OPC, les GRP ne l’exprimant qu’après un certain temps en culture
22
(Noble et al. 2004; Rao 2004a). Comme pdgfrα n’apparaît que vers E13 dans la moelle
épinière de rat (Pringle & Richardson 1993; Hall et al. 1996), on suppose que l’expression
plus précoce d’autres marqueurs (Olig1, Olig2, plp/dm20, sox10) pourrait en fait correspondre
aux GRP ou même à d’autres précurseurs neuraux qu’il reste à caractériser (Timsit et al.
1995; Lu et al. 2000; Zhou et al. 2000; Liu et al. 2002). Notons qu’un autre problème vient
compliquer la question : tous les OPC ne semblent pas identiques : des sous-populations
peuvent être distinguées par leur expression soit de plp/dm20, soit de pdgfrα (Spassky et al.
1998). Les OPC plp/dm20+ ne sont probablement pas des GRP puisque des cellules GFP+
isolées à partir de diencéphale de souris plp-GFP à E9,5-E10,5 ne peuvent pas générer
d’astrocytes (Le Bras et al. 2005). Bref, la caractérisation comparée des GRP et des OPC in
vivo demeure incomplète. Il faut donc se méfier du terme de « progéniteur
d’oligodendrocyte », trop fréquemment employé pour désigner in vivo toute cellule immature
exprimant des marqueurs précoces du lignage oligodendrocytaire.
vi. Précurseurs d’astrocytes (Astrocyte Precursor Cells ou APC)
De la même façon que les OPC ont un potentiel de différenciation restreint au lignage
oligodendrocytaire, il existerait des cellules qui ne génèrent que des astrocytes. De tels
précurseurs d’astrocytes (APC, pour Astrocyte Precursor Cells) ont été isolés à partir d’une
lignée dérivée de cervelet de souris à E16 (Seidman et al. 1997). Ils n’expriment ni A2B5, ni
GFAP et sont sensibles à l’EGF mais pas au PDGF (Pringle et al. 1992; Seidman et al. 1997).
En culture, ils se différencient en astrocytes de type 1 GFAP+ mais pas en oligodendrocytes
(Seidman et al. 1997). Des cellules semblables, mais marquées par l’anticorps A2B5, ont par
ailleurs été identifiées dans des cultures de moelle épinière de rat nouveau-né et dans le nerf
optique de rat embryonnaire ou néonatal (Fok-Seang & Miller 1992; Mi & Barres 1999).
D’autres marqueurs d’APC seraient CD44, fgfr3, nestine, vimentine et Pax2 (Mi & Barres
1999; Pringle et al. 2003; Liu et al. 2004). Il n’a pas été clairement établi si le marqueur
S100B, exprimé dans les astrocytes matures, est également retrouvé dans les APC (Mi &
Barres 1999; Liu et al. 2004). Des études tentent à présent de combiner des techniques de
culture et de marquages in situ afin d’identifier in vivo les APC caractérisés in vitro (voir par
exemple Pringle et al. 2003 ou Liu et al. 2004).
vii. Précurseurs de motoneurones et d’oligodendrocytes (Motor Neuron-Oligodendrocyte
Precursors ou MNOP)
Enfin, des travaux sur la moelle épinière ont suggéré que le développement des
oligodendrocytes serait plus lié à celui des motoneurones qu’à celui des astrocytes.
23
Premièrement, les oligodendrocytes et les motoneurones naissent dans la même zone focale
de la moelle ventrale (Richardson et al. 1997; Richardson et al. 2000). Deuxièmement, en
culture, ces deux types cellulaires peuvent être obtenus après induction par des concentrations
similaires de la protéine Sonic hedgehog (Shh) (Pringle et al. 1996; Orentas et al. 1999).
Troisièmement, la genèse des motoneurones et celle des oligodendrocytes sont toutes deux
perturbées chez des souris mutantes pour les gènes Olig (Lu et al. 2002; Takebayashi et al.
2002; Zhou & Anderson 2002). A partir de ces observations, certains auteurs ont émis
l’hypothèse qu’il existe vers E10,5 chez la souris des précurseurs communs aux
motoneurones et aux oligodendrocytes (MNOP, pour Motor Neuron-Oligodendrocyte
Precursors) (Lu et al. 2002; Takebayashi et al. 2002; Zhou & Anderson 2002). Toutefois, il
est aussi possible que différentes sous-populations de précurseurs Olig+ génèrent d’une part
les oligodendrocytes et, d’autre part, les motoneurones. Bref, dans une revue sur le sujet,
Noble, Pröschel et Mayer-Pröschel concluaient que l’hypothèse des MNOP avait besoin
d’être étayée plus solidement (Noble et al. 2004). Depuis, des travaux sont venus remettre
encore davantage en doute l’existence des MNOP : en procédant à l’ablation des cellules
olig1+ in vivo grâce à l’expression conditionnelle de la toxine diphtérique, Wu et ses
collaborateurs
ont
constaté
que
des
progéniteurs
olig1+
de
motoneurones
et
d’oligodendrocytes sont générés au même endroit, mais de façon successive et indépendante
(Wu et al. 2006). Pour cette raison, les MNOP n’apparaissent pas dans le tableau 3 cidessous, qui résume les caractéristiques principales des types de cellules dont le rôle de
progéniteurs gliaux a été établi.
Par ailleurs, certaines études suggèrent un lien étroit entre les oligodendrocytes et
d’autres types de neurones. Par exemple, des progéniteurs GFP+ isolés à partir de plaque
basale diencéphalique de souris plp-GFP à E9,5-E10,5 peuvent en culture donner naissance à
des oligodendrocytes et à des neurones, mais pas à des astrocytes (Le Bras et al. 2005). Il
serait intéressant de confirmer ces résultats in vivo pour établir s’il existe réellement un
lignage commun pour les oligodendrocytes et certains neurones.
24
Tableau 3 : Types de cellules souches et précurseurs générant de la glie
au cours du développement du SNC de rongeur
Nom
Age et site
d’isolement
Pot. de
diff. *
Marqueurs
présents
Marqueurs
absents
NEP
Tube neural de
rat E10,5 (zone
ventriculaire)
A, N, O
FGFR, Musashi-1,
nestine, Sox2
GRP
Moelle
embryonnaire
(surtout
ventrale) dès
E12 chez le rat
A1, A2, O
A2B5, FGFR1,2,3,
nestine
Marqueurs de
cellules
différenciées,
A2B5, EGFR,
GFAP,
PDGFRα, PSANCAM
Marqueurs de
neurones, de
cellules
myélinisantes,
GalC, GFAP,
PDGFRα
(initialement),
S100B
Glie radiaire
Cellules
souches
sensibles à
l’EGF
O-2A/OPC
APC
2 sous-groupes :
- Olig1/2 et Sox10
- dm20, Ngn3,
Nkx2.2 et Sox2
Parfois NG2 et
PDGFRα à partir
de E14,5
GLAST, nestine,
RC1, RC2, S100B,
vimentine, zébrine2
Dans le tube
neural à partir
d’E13,5-E14,5
chez le rat,
selon le niveau
rostro-caudal
Tube neural de
rat E14 (ZSV)
A, N, O…
A, N, O
EGFR, FGFR1,2,
nestine,
Musashi-1, Sox2
Nerf optique,
cervelet, cortex
cérébral, bulbe
rachidien et
moelle
périnataux
A2, O
A2B5, nestine,
FGFR1,2,3,
PDGFRα,
plp/dm20, PSANCAM, NG2,
Nkx2.2, Olig1/2,
sox10, cnp
A
Cervelet de
souris à E16,
nerf optique en
développement,
moelle dorsale
embryonnaire
Dépendance
trophique
FGF
FGF-2
GFAP (exprimé
tardivement dans
certaines
cellules, vers E18
chez le rat), NG2
Marqueurs de
cellules
différenciées,
GFAP, NG2
Marqueurs de
neurones, de
cellules
myélinisantes
(MBP, MOG),
GalC, GFAP
A2B5 (?), CD44,
Marqueurs de
fgfr3, nestine, Pax2, neurones, de
vimentine
cellules
myélinisantes,
GalC, GFAP,
RC1
EGF , FGF
PDGF-AA
FGF-2 et
GGF
* Potentiel de différenciation : A, astrocytes; A1, astrocytes de type 1; A2, astrocytes de type 2; N,
neurones ; O, oligodendrocytes.
GGF : Glial Growth Factor
25
3. Les lignages gliaux au cours du développement du SNC
Comme nous venons de le voir, l’ensemble des données sur les différents types de
précurseurs reste fragmentaire. Naturellement, les relations de lignage entre ces précurseurs
demeurent donc obscures pour la plupart. Après avoir défini ce qu’on entend aujourd’hui par
« lignage glial », je détaillerai les techniques qui permettent de l’étudier et quelques relations
de lignage qui ont ainsi pu être établies.
a. Définition du lignage glial : modèle de restriction progressive des potentiels
Le lignage d’une cellule désigne sa descendance, c’est-à-dire les cellules qu’elle
engendre au fil de ses divisions. Il existe deux lignages gliaux principaux, qui correspondent
aux deux grands types de cellules gliales : le lignage astrocytaire et le lignage
oligodendrocytaire.
Comme dans d’autres systèmes, le développement des cellules neurales et notamment
gliales s’explique actuellement par un modèle de différenciation progressive : les cellules
souches neurales génèreraient des cellules différenciées en passant par une succession de
stades de précurseurs intermédiaires dont les potentialités de prolifération et de différenciation
seraient de plus en plus restreintes, tel qu’illustré sur la figure 10.
Figure 10 : Restriction progressive des potentialités cellulaires au cours d’un lignage
Au fur et à mesure que les cellules d’un lignage avancent vers un stade différencié, leurs
potentiels se restreignent en termes de prolifération et de différenciation. Ainsi, les cellules
souches sont capables d’un auto-renouvellement quasi-infini et sont multipotentes tandis que
les précurseurs sont engagés dans une voie de différenciation et ne peuvent se diviser qu’un
nombre limité de fois.
Tiré de Bouissac 2005
26
Tel que mentionné dans la section précédente, il existe effectivement des précurseurs
gliaux avec différents potentiels plus ou moins restreints. D’après le modèle classique, les
cellules souches neurales génèrent d’abord des progéniteurs multipotents, qui eux-mêmes
donnent naissance à des précurseurs engagés dans l’un des trois lignages neuraux. Ceux-ci ont
la capacité de proliférer mais leur potentiel de différenciation est restreint à un seul type de
cellule neurale (oligodendrocyte, astrocyte ou neurone). Cependant, nous verrons que les
relations de lignage qui unissent les cellules neurales sont loin d’être toutes établies et
présentent certainement une plus grande complexité que ce modèle théorique.
b. Techniques d’analyse des lignages neuraux
Pour comprendre le lignage réel des précurseurs neuraux, et non pas leur potentiel
démasqué dans des conditions de culture par exemple, il faut observer leur devenir in vivo
dans leur environnement naturel.
L’analyse histologique permet parfois de mettre en évidence dans une région donnée
des types cellulaires dont l’apparence semble correspondre à différentes étapes de maturation
d’un même lignage. Par exemple, dans le cortex de souris, les cellules radiaires prédominent
jusqu’à E17 puis font peu à peu place à des cellules plus arborisées, dont la forme
multipolaire est caractéristique des astrocytes (Misson et al. 1991). Ce genre d’analyse
morphologique est à présent complété par l’étude des marqueurs exprimés dans ces souspopulations cellulaires. Ainsi, au cours du développement de la moelle épinière de rat
apparaissent d’abord des cellules radiaires immunopositives pour A2B5, le ganglioside GD3
et la vimentine, puis des oligodendrocytes et des astrocytes matures, exprimant
respectivement l’anhydrase carbonique et la GFAP (Hirano & Goldman 1988). Cette
chronologie d’apparition suggère une relation de lignage entre les précurseurs radiaires et les
cellules gliales matures puisqu’elle correspond à ce qui est observé au cours du temps dans
des cultures de précurseurs gliaux (voir par exemple Raff et al. 1983, Lubetzki et al. 1991).
De plus, on s’attend à ce que deux stades successifs d’un lignage expriment certains
marqueurs communs. Par exemple, dans la rétine de lapin entre E26 et P50, on observe
d’abord des précurseurs d’oligodendrocytes bipolaires O4+/GalC-/MBP-, puis de plus en plus
de pré-oligodendrocytes toujours O4+/GalC-/MBP- mais à la morphologie plus ramifiée.
Apparaissent ensuite des oligodendrocytes immatures O4+/GalC+/MBP-, et enfin des
oligodendrocytes matures myélinisants O4-/GalC+/MBP+ qui entourent les axones de leurs
prolongements (Morcos & Chan-Ling 1997).
27
Cependant, ces résultats corrélatifs ne permettent pas de démontrer hors de tout doute
l’existence de relations de lignage cellulaire. Pour ce faire, plusieurs techniques ont été
élaborées afin de marquer les cellules progénitrices et suivre leur devenir in vivo.
L’incorporation de BrdU est largement employée pour marquer l’ADN des cellules en
division (Figure 11 A). Un immunomarquage anti-BrdU permet ensuite d’identifier ces
cellules, du moins si elles ne se divisent pas à nouveau, auquel cas la BrdU serait diluée parmi
les cellules-filles.
On peut aussi ne marquer qu’une partie des cellules en division en les infectant au
moyen d’un rétrovirus incapable de se répliquer et comportant un gène rapporteur (Figure 11
B) : si le virus est suffisamment dilué, on peut supposer que toutes les cellules d’un groupe
marqué dans une même zone (un « clone ») descendent d’un seul précurseur (voir par
exemple Noctor et al. 2001).
De nos jours, il est également possible chez la souris de marquer génétiquement une
population de cellules qui expriment un gène donné et de suivre sa différenciation in vivo au
cours du temps (Figure 11 C). En particulier, il est très avantageux de créer des souris chez
lesquelles l’expression d’un gène rapporteur (souvent celui de la β-galactosidase ou de la
GFP) peut être irréversiblement activée dans une population cellulaire donnée grâce à
l’utilisation du système Cre-loxP (Mao et al. 2001, voir la section Résultats).
Quelle que soit la technique utilisée, on identifie alors les cellules marquées par
microscopie électronique, immunomarquage ou hybridation in situ. Dans le cas des
marquages par rétrovirus ou par transgenèse, l’identité des cellules peut également être
déterminée d’après les propriétés fonctionnelles des cellules vivantes, notamment en ce qui
concerne leurs potentiels de différenciation et de prolifération en culture ou leurs
caractéristiques électrophysiologiques.
28
Figure 11 : Méthodes in vivo d’analyse des lignages neuraux du SNC
Ces trois approches peuvent être employées pour étudier in vivo les lignages neuraux au
cours du développement ou chez l’adulte.
A. Les cellules en division incorporent la bromodésoxyuridine (BrdU) pendant la phase S du
cycle cellulaire. Elles sont ensuite identifiées sur coupe par immunofluorescence contre la
BrdU et des marqueurs des différents lignages neuraux, ici les marqueurs neuronaux NeuN et
DCX.
B. Un rétrovirus peut aussi servir à marquer une partie des cellules en division. Après
injection stéréotaxique dans le SNC, le génome viral s’intègre dans l’ADN des cellules
infectées au moment de la mitose. Ces cellules et leur descendance sont ensuite repérées
grâce à un gène rapporteur (ici la GFP).
C. Des souris transgéniques peuvent également être créées afin d’insérer un gène rapporteur
sous le contrôle d’un promoteur d’un gène spécifique de certaines sous-populations
cellulaires (par exemple les neurones immatures DCX+ de l’hippocampe).
NeuN : Neuronal Nuclear marker; DCX : doublecortine; GFP : Green Fluorescent Protein;
DAPI : 4',6-DiAmidino-2-PhénylIndole (marqueur nucléaire).
Tiré de Ming & Song 2005
c. Quelques relations établies de lignages gliaux
Quelles sont les relations de lignage entre les différentes cellules souches et
progénitrices capables de générer des cellules gliales au cours du développement ? La seule
29
hypothèse difficilement contestable, c’est que les NEP sont à l’origine des autres types de
précurseurs et, en bout de ligne, des cellules gliales différenciées mais la plupart des liens
intermédiaires restent à vérifier. En effet, c’est un sujet encore jeune, sur lequel peu d’équipes
de recherche se sont penchées. Qui plus est, les tests décrits plus haut sont rarement tous
utilisés dans une seule étude, ce qui empêche d’obtenir une vision complète d’un lignage.
Une première approche pour comprendre les lignages a consisté à observer l’ordre
d’apparition des différents types de précurseurs. Ainsi, Liu et ses collaborateurs ont déterminé
l’expression spatio-temporelle d’un grand nombre de marqueurs gliaux dans la moelle
épinière de rat en développement (Liu et al. 2002). Voici un bref résumé de leurs résultats
(Figure 12). Les NEP Sox2+ sont présents dès E10,5. Puis les GRP (A2B5+), premiers
précurseurs gliaux, apparaissent vers E12,5. Vers E14, on peut détecter RC1, marqueur de
glie radiaire. Le stade d’apparition des APC est moins bien connu : des cellules CD44+ sont
décelées dès E11,5, mais il reste à déterminer leur identité exacte. Quoi qu’il en soit, des
astrocytes GFAP+/CD44+ existent à E18,5. En ce qui concerne le lignage oligodendrocytaire,
il y a clairement des OPC NG2+ à E14,5 et NG2+/Nkx2.2+ à E18, et des oligodendrocytes
O4+/GalC+ vers E20-E21.
Néanmoins, l’apparition successive des populations gliales suggère des relations de
lignage mais ne les démontre pas. Des recherches récentes ont tenté de mettre certaines
d’entre elles en évidence par d’autres techniques. Par exemple, des cultures clonales de NEP
indiquent que les GRP seraient l’étape obligée du lignage allant des cellules souches aux
cellules gliales différenciées (Rao & Mayer-Proschel 1997, Rao et al., 1998). En particulier,
in vitro du moins, les GRP donnent naissance aux OPC, qui à leur tour produisent des
oligodendrocytes (Gregori et al. 2002; Liu & Rao 2004; Noble et al. 2004). Quant au lignage
astrocytaire, plusieurs voies de développement sont envisageables (Goldman 2004). D’une
part, les astrocytes pourraient dériver de la glie radiaire dans tout le SNC, notamment dans la
moelle épinière, tel que le suggère l’apparition successive de marqueurs gliaux (Hirano &
Goldman 1988). D’autre part, du moins dans le prosencéphale et le cervelet, des expériences
de traçage par rétrovirus montrent que les astrocytes pourraient aussi provenir de la
différenciation de précurseurs migratoires en provenance de la ZSV, précurseurs peut-être
apparentés aux GRP puisqu’ils génèrent également des oligodendrocytes (Levison &
Goldman 1993, Levison 1993, Luskin & McDermott 1994).
En plus de ces analyses d’expression de marqueurs, de cultures et d’infection par des
rétrovirus, on dispose à présent d’outils génétiques très intéressants pour perturber les
lignages gliaux et pour les suivre in vivo en marquant un type de précurseur et sa
descendance. Ainsi, l’inactivation génétique d’un récepteur du FGF empêche le
30
développement des cellules souches sensibles à l’EGF, suggérant qu’elles dérivent des NEP
dépendantes du FGF (Tropepe et al. 1999). Par ailleurs, la genèse d’oligodendrocytes et
d’astrocytes à partir de cellules de la glie radiaire a été démontrée dans une zone restreinte de
la moelle épinière grâce à des souris modifiées génétiquement Dbx1-Cre/Rosa26-GFP qui ont
permis de marquer des cellules de glie radiaire et leur lignage (Fogarty et al. 2005).
La figure 12 illustre sommairement ces hypothèses de lignages gliaux. De nombreuses
études sont en cours pour les vérifier, les compléter et déterminer leurs variations régionales.
Figure 12 : Relations de lignage possibles entre les différents précurseurs gliaux
au cours du développement du SNC
Des cellules souches (les cellules neuroépithéliales et, plus tard, les cellules souches
sensibles à l’EGF) génèreraient la glie radiaire, des précurseurs neuronaux et les GRP (ici
simplement représentés comme un seul type cellulaire). A leur tour, les GRP donneraient
naissance à des précurseurs d’astrocytes (APC), qui produiraient des astrocytes à partir de
E16-18, et à des précurseurs d’oligodendrocytes (OPC), qui génèreraient ensuite des
oligodendrocytes vers E20. Certains travaux ont montré que la glie radiaire donnerait elle
aussi naissance à des neurones, puis à des astrocytes et même à des oligodendrocytes.
L’échelle de temps indique l’âge approximatif auquel les différents types cellulaires
commencent à être détectés chez le rat.
APC : Astrocyte Precursor Cell; E : jour embryonnaire; GRP : Glial Restricted Precursor;
OPC : Oligodendrocyte Precursor Cell; P : jour postnatal.
Tiré de Liu et al. 2002
31
III. Gliogenèse dans le SNC adulte
Les manuels de neurosciences présentent souvent les cellules gliales comme des
cellules du cerveau capables de se diviser, contrairement aux neurones2. Il est vrai que,
lorsque le système nerveux adulte subit une lésion, par exemple lors d’un accident vasculaire
cérébral, les neurones endommagés ne sont pas remplacés, alors que de la glie réactionnelle
(proliférative) est retrouvée au site de la lésion. Cependant, cette façon de présenter la glie
donne l’impression qu’elle est constamment en division, alors que, in vivo, les cellules
macrogliales matures prolifèrent très peu (Horner et al. 2000; Levine et al. 2001). En
revanche, il existe des cellules souches ou des progéniteurs qui permettent la genèse de
nouvelles cellules neuronales ou gliales dans diverses régions du SNC mature et intact.
Quelles sont alors les cellules responsables de la gliogenèse adulte ? On peut envisager que ce
soient des précurseurs gliaux, mais également des cellules souches, ou encore des cellules
gliales différenciées qui rentrent dans le cycle cellulaire.
C’est Altman qui, dans les années 1960, a le premier utilisé une méthode
suffisamment sensible pour déceler les cellules en mitose dans le cerveau de rongeur adulte, à
savoir l’injection de thymidine tritiée, qui s’incorpore dans l’ADN pendant la division
cellulaire (Altman & Das 1965a; Altman & Das 1965b; Altman 1969). Les cellules marquées
ont pu être identifiées, d’abord par des analyses d’histologie et de microscopie électronique
(Korr et al. 1973; Kaplan & Hinds 1980). A présent, la BrdU et des marqueurs du cycle
cellulaire (PCNA, Ki67, phospho-histone H3) sont employés pour marquer les cellules qui
prolifèrent, conjointement à des anticorps qui reconnaissent spécifiquement les neurones ou
les cellules gliales. De plus, comme pour les études menées sur le système nerveux en
développement, des cultures, notamment de neurosphères, ainsi que des greffes ont aussi servi
à déterminer les potentiels de différenciation et d’auto-renouvellement des cellules souches ou
progénitrices adultes (voir par exemple Reynolds & Weiss 1992; Richards et al. 1992; Lois &
Alvarez-Buylla 1993; Morshead et al. 1994 ; Gage et al. 1995). On a ainsi identifié quelques
types cellulaires générant de nouvelles cellules, notamment gliales, chez l’adulte.
2
« Glial cells differ from neurons in that they possess no synaptic contacts and retain the
ability to divide throughout life, particularly in response to injury. » (Raine 1999).
32
1. Cellules souches adultes
Comme pendant le développement, une cellule souche neurale adulte est définie par sa
capacité à s’auto-renouveler et à générer neurones, astrocytes et oligodendrocytes. A ce jour,
des cellules présentant ces propriétés, du moins in vitro, ont été identifiées dans des zones très
variées du SNC chez les mammifères adultes : l’hippocampe et la zone sous-ventriculaire
(ZSV) des ventricules latéraux (Reynolds & Weiss 1992; Richards et al. 1992; Palmer et al.
1995), mais aussi de nombreuses autres régions comme le striatum, le cortex, le septum, la
moelle épinière et le complexe vagal dorsal (CVD) (Palmer et al. 1995; Weiss et al. 1996a;
Shihabuddin et al. 1997; Palmer et al. 1999; Lie et al. 2002; Bauer et al. 2005). Toutefois,
même si ces cellules présentent in vitro les propriétés des cellules souches neurales, elles ne
donnent naissance à de nouveaux neurones in vivo que dans quelques zones du SNC adulte.
En effet, une neurogenèse secondaire relativement importante a été détectée uniquement dans
le gyrus dentelé de l’hippocampe et dans le système ZSV-bulbe olfactif (Cameron 1993; Lois
& Alvarez-Buylla 1994). En dehors de ces deux régions, la formation de nouveaux neurones
n’a pu être clairement démontrée ou ne concerne que très peu de cellules (Emsley et al. 2005).
A côté de la neurogenèse secondaire, la gliogenèse à partir des cellules souches adultes
n’a reçu qu’une attention bien limitée. Les cellules souches neurales contribuent-elles
naturellement à la genèse de nouvelles cellules gliales chez l’adulte ? C’est du moins le cas
dans le CVD, où une incorporation cumulative de BrdU pendant 10 jours permet de marquer
une même proportion de neurones NeuN+ et de cellules gliales S100B+ (Bauer et al. 2005).
Par contre, il semblerait que les cellules souches de la ZSV antérieure et du gyrus dentelé
produisent très majoritairement des neurones dans des conditions normales (Cameron et al.
1993; Corotto et al. 1993; Lois & Alvarez-Buylla 1994). Lorsque les cellules de la ZSV sont
suivies grâce à l’injection de rétrovirus, seulement 1% des cellules ainsi marquées se
retrouvent dans le corps calleux une semaine plus tard et expriment des marqueurs du lignage
oligodendrocytaire (Hack et al. 2005). Cette proportion peut toutefois être augmentée dans
des conditions pathologiques. Par exemple, lors d’une atteinte de la myéline, des cellules
dérivées de la ZSV peuvent être recrutées à la lésion, en dehors de leur trajet migratoire
habituel vers le bulbe olfactif, et se différencier en oligodendrocytes et en astrocytes (NaitOumesmar et al. 1999; Picard-Riera et al. 2002). Notons cependant que, dans tous ces cas,
l’identité exacte des cellules donnant naissance à des cellules gliales n’a pas été déterminée :
il peut s’agir de cellules souches comme de progéniteurs plus restreints dans leur potentiel de
différenciation ou leur capacité à proliférer.
D’un point de vue développemental, l’origine des cellules souches adultes n’est pas
complètement élucidée. Des travaux récents utilisant le traçage génétique indiquent que les
33
cellules souches de la ZSV dérivent de la glie radiaire embryonnaire (Figure 13) (AlvarezBuylla et al. 2001; Merkle et al. 2004).
Figure 13 : Origine développementale des cellules souches de la ZSV adulte
A,B. Les cellules souches du neuroépithélium génèrent des neurones (A), ainsi que la glie
radiaire (B). Celle-ci donne à son tour naissance à des neurones qui migrent ensuite dans le
cortex le long des prolongements gliaux. Cette neurogenèse passe peut-être par un stade de
progéniteur d’amplification transitoire (en vert).
C. La glie radiaire génère également les cellules souches maintenues dans la zone sousventriculaire (ZSV) adulte, qui produisent de nouveaux neurones du bulbe olfactif.
NEP : NeuroEpithelial Precursor.
Tiré de Alvarez-Buylla et al. 2001
2. Cellules NG2+ (« OPC adultes »)
Parmi les précurseurs susceptibles de générer des cellules gliales chez l’adulte, les plus
étudiés sont les cellules exprimant à leur surface le protéoglycane NG2. En effet, deux heures
après une injection unique de BrdU, la principale population cellulaire en division dans le
cerveau adulte (hors ZSV) est constituée de cellules NG2+. Elles représentent de 70 à 75%
des cellules en prolifération, les autres cellules BrdU+ étant majoritairement des cellules
endothéliales (Dawson et al. 2003). Des résultats semblables sont obtenus dans la moelle
épinière après une injection quotidienne de BrdU pendant 12 jours (Horner et al. 2000).
Ces cellules gliales sont souvent appelées précurseurs d’oligodendrocytes (OPC) ou
O-2A adultes à cause de leur profil antigénique (voir ci-dessous) et de leur capacité à générer
des oligodendrocytes et des astrocytes de type 2 en culture. Néanmoins, il faut souligner qu’il
existe un débat encore non résolu concernant l’hétérogénéité de la population de cellules
gliales NG2+ : ont-elles toutes la capacité de se diviser et de générer des oligodendrocytes in
34
vivo ? Nous verrons que certains auteurs mettent cette affirmation en doute et préfèrent par
conséquent éviter le terme d’OPC. Dans la présente introduction, « OPC adultes » et « glie
NG2+ » seront cependant considérés comme synonymes.
D’abord isolés dans le nerf optique (ffrench-Constant & Raff 1986; Wolswijk & Noble
1989), les OPC adultes sont en fait retrouvés dans tout le SNC, dispersés à la fois dans les
substances blanche et grise, et représentent entre 5 et 8% de la population gliale du SNC
(Dawson et al. 2000). In vitro, les OPC adultes sont de petites cellules unipolaires ou
bipolaires reconnues par les anticorps A2B5, O4 et NG2 (Levine et al. 2001). Par contre, in
vivo, les cellules NG2+ sont parfois bipolaires mais ont souvent une morphologie très
ramifiée de cellules plus différenciées (Levine & Card 1987; Butt et al. 1999; Berry et al.
2002; Butt et al. 2005). Fait à souligner, les cellules NG2+ qui incorporent la BrdU+ seraient
bipolaires (Horner et al. 2000). Comme les OPC périnataux, les OPC adultes expriment NG2,
PDGFRα, O4, Olig1, Olig2, les récepteurs du FGF2 et peut-être Nkx2.2 mais, hormis Olig1
et Olig2, aucun marqueur d’oligodendrocytes matures (MOG, MBP) n’est retrouvé in vivo
chez les OPC adultes (Levine et al. 1993; Nishiyama et al. 1996a; Redwine et al. 1997;
Reynolds & Hardy 1997; Butt et al. 1999; Watanabe et al. 2004; Kitada & Rowitch 2006). Ils
sont également distincts des cellules exprimant des marqueurs d’astrocytes (GFAP, S100,
vimentine), de neurones (NeuN) et de microglie (OX42, ILB4) (Levine & Card 1987; Levine
et al. 1993; Nishiyama et al. 1997; Reynolds & Hardy 1997; Butt et al. 1999; Ong & Levine
1999; Nishiyama et al. 2002). Par contre, tel que mentionné précédemment, des cellules
échappent à cette classification simple, notamment dans l’hippocampe, où le marqueur
neuronal TOAD-64 est retrouvé dans des cellules NG2+ (Belachew et al. 2003).
Par
ailleurs,
certaines
cellules
NG2+
adultes
possèdent
des
propriétés
électrophysiologiques uniques. Contrairement aux astrocytes, elles ne sont pas couplées par
des jonctions communicantes (Lin & Bergles 2002). De plus, même si elles ne peuvent
générer de potentiels d’actions à la manière des neurones, elles expriment des conductances
aux ions Na+, K+ et Ca2+ dépendantes du voltage et des récepteurs de divers
neurotransmetteurs (voir Lin & Bergles 2002 et Belachew & Gallo 2004 pour des revues sur
le sujet). Plus surprenant encore, le laboratoire du Dr Bergles a montré que des cellules NG2+
de l’hippocampe et du cervelet reçoivent des contacts synaptiques fonctionnels en provenance
de neurones GABAergiques et glutamatergiques (Bergles et al. 2000; Lin & Bergles 2002;
Lin & Bergles 2004; Lin et al. 2005). Le rôle exact de ces synapses reste à élucider ; il
pourrait s’agir d’influencer la prolifération et la différenciation de ces OPC présumés (Lin &
Bergles 2004).
35
Les cellules NG2+ adultes réagissent fortement à une grande variété d’atteintes du
SNC (Chen et al. 2002) et l’on considère généralement que ce sont elles qui repeuplent les
lésions démyélinisantes et s’y différencient en nouveaux oligodendrocytes pour assurer la
remyélinisation (Levine 1994; Keirstead et al. 1998; Redwine & Armstrong 1998; Di Bello et
al. 1999; Levine & Reynolds 1999; Levison et al. 1999; Reynolds et al. 2002; Watanabe et al.
2002; Polito & Reynolds 2005). Des travaux récents indiquent aussi qu’elles pourraient être à
l’origine de la cicatrice gliale qui se forme après une lésion traumatique faite au moyen d’un
instrument tranchant (Alonso 2005), et même générer des neurones dans l’hippocampe
(Belachew et al. 2003). Cependant, une fraction notable des cellules NG2+ marquées à la
BrdU maintiennent l’expression de NG2 après 10 jours (Dawson et al. 2003) et même quatre
semaines (Horner et al. 2000), ce qui suggère qu’elles ne se différencient pas davantage.
Plusieurs autres indications laissent entendre que les cellules NG2+ du SNC adulte pourraient
avoir une autre fonction que celle de précurseurs. Par exemple, leur morphologie complexe
rappelle plutôt la forme de cellules différenciées (Berry et al. 2002; Butt et al. 2005). De plus,
les cellules NG2+ établissent des contacts privilégiés avec les nœuds de Ranvier dans la
substance blanche et les synapses neuro-neuronales au sein de la substance grise (Butt et al.
1999; Bergles et al. 2000; Butt et al. 2002). C’est pourquoi certains auteurs proposent de les
considérer comme une classe de macroglie à part entière, qui porterait des noms tels
synantocytes (Butt et al. 2002), polydendroglie (Nishiyama et al. 2002) ou cellules
neurogliales ß (Peters 2004). En plus de participer à la formation de la cicatrice gliale, la glie
NG2+ pourrait avoir comme fonction de mettre en place et stabiliser les synapses et les nœuds
de Ranvier (Butt et al. 2002). Bien entendu, rien ne permet d’exclure la possibilité que les
cellules NG2+ soient en fait une population hétérogène, dont seulement une partie serait des
précurseurs d’oligodendrocytes (Polito & Reynolds 2005) ou de neurones (Belachew et al.
2003).
Enfin, en ce qui concerne l’origine développementale des cellules NG2+ adultes, le
consensus général veut qu’elles descendent des OPC périnataux (Wren et al. 1992). C’est du
moins ce que suggère une étude récente, qui montre que les cellules NG2+ ne se développent
pas chez des souris déficientes pour Olig2 (Ligon et al. 2006), gène également indispensable
au développement des oligodendrocytes (Lu et al. 2002; Zhou & Anderson 2002). Toutefois,
comme il existe peut-être plusieurs sous-populations d’OPC périnataux (Spassky et al. 2000;
Mallon et al. 2002), l’une pourrait donner naissance aux oligodendrocytes, l’autre aux OPC
adultes (Butt et al. 2002; Nishiyama et al. 2002).
36
3. Autres sources de gliogenèse adulte
Des cellules gliales nouvellement formées ont souvent été observées dans le SNC
adulte intact ou lésionnel (par exemple, voir Hommes & Leblond 1967; Korr et al. 1973;
Kaplan & Hinds 1980; Gensert & Goldman 1996; Mao & Wang 2001; Rietze et al. 2000;
Gotts & Chesselet 2005). Cependant, dans ces études, les approches techniques utilisées
permettent rarement de déterminer si ces nouvelles cellules gliales proviennent de précurseurs
distincts des cellules souches ou des cellules NG2+.
En particulier, le renouvellement des astrocytes s’explique-t-il en partie par la
prolifération de cellules déjà engagées dans le lignage astrocytaire ? Une étude le suggère :
dans le cortex de rat, les cellules S100B+ (considérées comme des astrocytes) y
représenteraient une forte proportion des cellules BrdU+ un jour ou quatre semaines après une
injection de BrdU (Ehninger & Kempermann 2003). Cependant, des résultats potentiellement
contradictoires ont aussi été obtenus : juste après injection de BrdU, seuls de rares astrocytes
GFAP+ sont également BrdU+ dans la moelle épinière et le cerveau (Horner et al. 2000;
Dawson et al. 2003). Ces conclusions méritent donc d’être confirmées, d’autant plus que
S100B a été retrouvé dans certaines cellules du lignage oligodendrocytaire, ce qui remet en
question son utilisation comme marqueur d’astrocytes (Deloulme et al. 2004; Hachem et al.
2005). En fait, il apparaît clairement qu’une combinaison de marqueurs doit être utilisée pour
identifier chaque type cellulaire, ce qui est d’autant plus valable pour les astrocytes que
certaines cellules GFAP+ seraient en fait des cellules souches ou des progéniteurs
multipotents, pas de simples astrocytes (Doetsch et al. 1999; Steiner et al. 2004). Par ailleurs,
il est important d’étudier le phénotype des cellules BrdU+ à au moins deux moments, par
exemple juste après l’injection de BrdU et quelques jours ou semaines plus tard, ce qui permet
de savoir d’abord quelles cellules incorporent la molécule et ensuite quel est leur devenir.
37
B. LA NEUROHYPOPHYSE DE RONGEUR COMME MODELE
D’ETUDE DU LIGNAGE GLIAL
Il ressort de cette revue bibliographique que les cellules susceptibles de générer de
nouvelles cellules gliales sont encore méconnues, tant au cours du développement que chez
l’adulte. Afin d’approfondir les connaissances sur le sujet, la neurohypophyse (NH) de
rongeur apparaît comme un modèle intéressant de par sa composition cellulaire simple et la
persistance chez l’adulte d’une gliogenèse modulable selon les conditions physiologiques. De
plus, sa localisation anatomique fait qu’elle a souvent été écartée des préparations de SNC.
Par conséquent, au moment où cette thèse a débuté, les techniques récentes d’étude des
lignages gliaux n’avaient pas encore été appliquées à la NH. Pour ces raisons, j’ai entrepris de
réexaminer la gliogenèse dans la NH, au cours du développement ainsi que chez l’adulte.
I. Brève anatomie de l’hypophyse
L’hypophyse est une glande endocrine logée dans la selle turcique de l’os sphénoïde, à
la base de l’hypothalamus, auquel elle est reliée par la tige pituitaire. Complètement entourée
par la dure-mère, qui la sépare du cerveau, elle est donc située en dehors de la barrière
hématoméningée (Hanoune 1996). Elle est subdivisée en trois lobes, tel qu’illustré sur la
figure 14.
1.Neurohypophyse
Le lobe postérieur de l’hypophyse, ou neurohypophyse (NH), ou encore pars nervosa,
fait partie du SNC. Il contient les terminaisons nerveuses de neurones hypothalamiques, dont
la fonction est de libérer directement dans la circulation générale des neurohormones, la
vasopressine et l’ocytocine. Ses composantes cellulaires et sa physiologie sont détaillées plus
bas.
2. Adénohypophyse
L’autre lobe principal de l’hypophyse se nomme l’adénohypophyse (AH), ou pars
anterior, et comporte divers types de cellules endocrines. Dans l’hypothalamus, des neurones
neurosécréteurs déversent dans le système porte hypophysaire différentes hormones qui, une
fois dans l’AH, ont une action essentiellement stimulante sur les cellules endocrines. A leur
38
tour, celles-ci sécrètent alors dans la circulation générale d’autres hormones régulant
l’ensemble des glandes de l’organisme (Silbernagl & Despopoulos 1997).
3. Lobe intermédiaire
Enfin, il existe chez les vertébrés dits inférieurs, mais sous forme extrêmement réduite
chez l’humain adulte (Bucy 1932), un petit lobe intermédiaire (LI) entre la NH et l’AH. Ses
cellules principales sécrètent la mélanostimuline (MSH), qui contrôle notamment la
pigmentation de la peau (Nussey & Whitehead 2001).
Figure 14 : Anatomie de l’hypophyse
A. Schéma d’une coupe sagittale de cerveau de rongeur adulte. L’hypophyse est située sous
le cerveau, reliée à l’hypothalamus par la tige pituitaire. Elle est composée de trois lobes: la
neurohypophyse (NH), le lobe intermédiaire (LI) et l’adénohypophyse (AH).
B. Les neurones magnocellulaires de l’hypothalamus projettent leurs axones dans la
neurohypophyse et libèrent les neurohormones ocytocine et vasopressine dans la circulation
générale.
39
II. Composition cellulaire de la neurohypophyse
La NH est composée d’un nombre restreint de types cellulaires (récapitulés dans le
tableau 4). En effet, elle contient les axones de neurones hypothalamiques mais ne comporte
aucun corps cellulaire neuronal. Outre les cellules des vaisseaux sanguins sur lesquels se
terminent ces axones, l’élément cellulaire majeur est le pituicyte, une cellule gliale souvent
apparentée à l’astrocyte.
1. Axones
Les axones présents dans la NH proviennent essentiellement des neurones
magnocellulaires des noyaux supraoptiques et paraventriculaires de l’hypothalamus
(Silverman & Zimmerman 1983) et sont principalement non myélinisés (Bucy 1932; Schober
& Hoheisel 1977). Ils sont le lieu de stockage et de relargage de deux hormones : la
vasopressine et l’ocytocine. Les vésicules hormonales renferment également une protéine
distincte pour chaque hormone et servant au transport le long de l’axone, les neurophysines
(Hanoune 1996).
Des études par microscopie électronique ont identifié plusieurs types de vésicules dans
les axones de la NH : des granules de sécrétion denses aux électrons, où sont stockées
vasopressine et ocytocine, ainsi que de nombreuses petites vésicules claires ressemblant à des
vésicules synaptiques (Navone et al. 1989). En fait, la NH comporte non seulement les
terminaisons sécrétrices d’ocytocine et de vasopressine, mais aussi des axones qui contiennent
de l’enképhaline, du GABA, de la noradrénaline, de la sérotonine et de le monoxyde d’azote
(NO) (van Leeuwen et al. 1998). La fonction de ces neurotransmetteurs pourrait être de
moduler la sécrétion hormonale.
Ces différents types de fibres forment des contacts synaptiques entre eux ainsi que des
jonctions synaptoïdes avec des pituicytes (Monroe & Scott 1966; Tweedle & Hatton 1980).
Par contacts synaptoïdes, on entend des jonctions neurono-gliales qui, en microscopie
électronique, possèdent des microvésicules claires et du matériel dense aux électrons du côté
présynaptique mais souvent pas de caractéristiques postsynaptiques dans le pituicyte
(Baumgarten et al. 1972).
Afin de visualiser ces fibres nerveuses, on peut utiliser des anticorps dirigés contre
différentes protéines, par exemple les neurofilaments, la vasopressine ou l’ocytocine, ou
encore la synthase neuronale de monoxyde d’azote (nNOS).
40
2. Vaisseaux sanguins
La NH est une structure richement vascularisée. Un réseau de capillaires fenestrés
assure son irrigation à partir des artères hypophysaires inférieures, branches de la carotide
interne. La NH contient donc de nombreuses cellules endothéliales et périvasculaires
(fibroblastes, péricytes, microglie, mastocytes) (Nordmann 1977; Paterson & Leblond 1977;
Seyama et al. 1980). Le rôle de ces vaisseaux sanguins est non seulement de permettre les
échanges gazeux entre le sang et les cellules de la NH, mais aussi de recevoir les hormones
neurohypophysaires et de les transporter vers la circulation générale. Dans la NH, les axones
neurosécréteurs ont en effet des contacts privilégiés avec les capillaires sanguins : les
terminaisons axoniques se prolongent souvent dans la lame basale des cellules endothéliales
(Tweedle et al. 1989). Sur des coupes de NH, ces dernières peuvent être reconnues grâce à la
forme allongée de leur noyau et au marquage à l’isolectine B4 (ILB4) (Laitinen 1987).
De plus, parmi les cellules périvasculaires, il existe des cellules microgliales un peu
particulières qui constituent environ 20% des cellules non endothéliales de la NH adulte
(Mander & Morris 1996). Leur fonction serait de phagocyter les terminaisons des axones
neurosécréteurs qui obstruent l’espace périvasculaire (Pow et al. 1989). On peut les distinguer
des pituicytes au moyen de nombreux marqueurs (Guillemin & Brew 2004), notamment ILB4
(Streit & Kreutzberg 1987) et l’anticorps anti-CD11b, clone OX42 (Robinson et al. 1986;
Ling et al. 1990).
3. Pituicytes
Enfin, les cellules les plus nombreuses dans la NH sont les pituicytes. A l’origine, leur
morphologie les a distingués des astrocytes (Bucy 1932), mais peu à peu, d’autres propriétés
les en ont rapprochés (Livingston 1976). Par exemple, leur fonction serait de réguler
l’environnement ionique immédiat des axones neurosécréteurs (Dellmann et al. 1974, cité
dans Tweedle & Hatton 1980) et de contrôler la sécrétion des neurohormones, comme nous le
verrons plus bas. De plus, leurs multiples prolongements cellulaires sont fortement
interconnectés par différents types de jonctions, dont des jonctions communicantes (OlivieriSangiacomo 1973; Dreifuss et al. 1975; Stoeckel et al. 1975). Surtout, les pituicytes sont
souvent considérés comme des cellules astrogliales parce que, chez le rat, ils expriment la
vimentine (Marin et al. 1989) et S100B (Cocchia & Miani 1980), deux marqueurs du lignage
astrocytaire. La protéine GFAP, un marqueur classique d’astrocytes, est aussi décelée dans les
pituicytes chez le rat et l’humain (Salm et al. 1982; Velasco et al. 1982) mais pas chez la
souris (d’après nos propres observations). Par contre, les pituicytes expriment certains
41
marqueurs de cellules neurales immatures qu’on ne trouve habituellement pas dans les
astrocytes, comme PSA-NCAM (Theodosis et al. 1991) et la protéine Low Molecular Weight
Microtubule-Associated Protein-2 (LMW MAP-2) (Matsunaga et al. 1999), ainsi que la
vimentine, qui disparaît au cours de la maturation des astrocytes dans le reste du SNC (Dahl
et al. 1981; Bignami et al. 1982). Les pituicytes seraient donc des cellules gliales spécialisées
distinctes des astrocytes.
Tableau 4 : Les types cellulaires de la NH de rat adulte
Nom
Fonction
Axones (dont les axones
neurosécréteurs)
Neurosécrétion de vasopressine et
d’ocytocine, modulation de cette
sécrétion par d’autres transmetteurs
Vaisseaux
sanguins
Paroi des vaisseaux sanguins
Cellules
endothéliales
Péricytes
Microglie
Fibroblastes
Mastocytes
Pituicytes
Contraction des capillaires
Phagocytose, création de l’espace
périvasculaire
Synthèse de composants
extracellulaires
Réponse inflammatoire et
allergique, régulation de la
perméabilité vasculaire…
Modulation de la neurosécrétion ?
Exemples de
marqueurs
Neurofilaments,
ocytocine,
vasopressine, nNOS,
PSA-NCAM
ILB4, PECAM/CD31
NG2, nestine,
PECAM/CD31, αSMA,
PDGFRβ
ILB4, OX42, CD45
Fibronectine
CD34, CD45,
histamine
GFAP, S100B,
vimentine, PSANCAM, MAP2
Références : Olivieri-Sangiacomo 1972; Paterson & Leblond 1977; Cocchia & Miani 1980;
Laitinen 1987; Streit & Kreutzberg 1987; Marin et al. 1989; Pow et al. 1989; Theodosis et al.
1991; Mander & Morris 1996; Silver et al. 1996; Matsunaga et al. 1999; Guillemin & Brew
2004; Dore-Duffy et al. 2006.
III. Formation ontogénique
1. Développement des lobes
L’origine embryonnaire de l’hypophyse est double : d’une part, une invagination du
plancher du troisième ventricule cérébral forme la NH au niveau du prosomère p5 et, d’autre
part, l’AH et le LI proviennent d’un diverticule ectodermique du stomodeum, c’est-à-dire la
future bouche (Figure 15 A). Un échange de signaux inducteurs entre ces deux régions
permet leur développement parallèle (Treier & Rosenfeld 1996; Dasen & Rosenfeld 1999).
42
Au commencement, l’ectoderme oral contacte l’épithélium neural sus-jacent et devient peu à
peu une structure appelée la poche de Rathke, formée vers E11 chez le rat. Puis vers E11,5
apparaît au niveau du diencéphale la cavité infundibulaire (Figure 15 B), qui s’élargit ensuite.
La poche de Rathke se détache de la cavité orale vers E14 (Figure 15 C). Ses cellules
présentent alors une activité proliférative intense, qui remplit petit à petit la lumière de la
poche de Rathke. En revanche, le diverticule diencéphalique présente toujours une lumière
assez large à ce stade et celle-ci ne diminue grâce à de la prolifération cellulaire que vers E17E18. A la fin de la vie embryonnaire, l’hypophyse présente la même organisation que chez
l’adulte (Figure 15 D). Quant à la tige pituitaire, elle a la même origine que la NH et est
entourée en grande partie par une extension de la poche de Rathke appelée lobe tubéral ou
pars tuberalis (Dubois et al. 1997; Sheng & Westphal 1999; Kaufman 2001).
Figure 15 : Développement embryonnaire de l’hypophyse de rongeur
Schémas représentant la formation de l’hypophyse d’après des sections sagittales d’embryons
de rat à quatre stades de développement. Les âges correspondant aux mêmes stades chez la
souris sont indiqués en italique.
A. Vers E8,5 apparaît un épaississement de l’ectoderme oral préfigurant la future poche de
Rathke.
B. La formation d’une poche de Rathke (PR) rudimentaire commence vers E11: on observe
un bourgeonnement épithélial pointant vers le tissu neural sus-jacent.
C. La poche de Rathke continue ensuite à s’étendre vers le haut et se détache de la cavité
orale vers E14. Entre-temps, le plancher du diencéphale (Di) forme un diverticule dirigé vers
la poche: ce sera la neurohypophyse (NH). Des fibres nerveuses y entrent et viennent
contacter des vaisseaux sanguins en formation.
D. La poche de Rathke se remplit ensuite de cellules par prolifération et devient
l’adénohypophyse (AH). Sa paroi dorsale constitue quant à elle le lobe intermédiaire (LI). La
lumière de la NH se referme aussi peu à peu et, à la fin de la gestation, l’anatomie de
l’hypophyse ressemble déjà à celle retrouvée chez l’adulte.
CO : chiasma optique; I : infundibulum; Més : mésencéphale; MO : membrane orale; O :
cavité orale; PN : plaque neurale; PP : préplaque; Pro : prosencéphale; Rh : rhombencéphale;
V : ventricule.
Tiré de Sheng & Westphal 1999
43
2. Différenciation des constituants cellulaires de la neurohypophyse
Au niveau cellulaire, les différentes composantes de la NH se développent en
parallèle, en s’influençant les unes les autres. Par exemple, les pituicytes qui se différencient
les premiers sont ceux en contact avec des axones (Galabov & Schiebler 1978) et, dans une
souris mutante dépourvue de projections axoniques dans la NH, les pituicytes ne survivent pas
(Schonemann et al. 1995).
D’après des études d’histologie, on peut distinguer trois périodes de maturation de la
NH (Galabov & Schiebler 1978). La première s’étend jusqu’à E17 chez le rat. Pendant cette
période, l’ébauche de la NH ressemble d’abord à une masse de cellules identiques, puis leur
différenciation débute : elles présentent de nouveaux organites et des granules de
lipoprotéines et leur ultrastructure générale rappelle celle des cellules gliales immatures. C’est
aussi à ce moment que les premières fibres nerveuses pénètrent dans la structure et
qu’apparaissent des cellules endothéliales et périvasculaires (vers E14). Puis, entre E18 et la
fin du premier mois postnatal, les fibres nerveuses sont plus nombreuses et forment des
contacts neurovasculaires et neuro-gliaux et l’on distingue les premiers signes de
neurosécrétion (Galabov & Schiebler 1978). La fenestration des capillaires apparaît vers la
naissance (Dellmann et al. 1978), puis les cellules endothéliales deviennent plus fines, il se
forme un espace périvasculaire et une lame basale. On commence aussi à observer des
cellules microgliales phagocytant des axones dans la NH, ce qui suggère que ce sont elles qui
créent ainsi l’espace périvasculaire (Olivieri-Sangiacomo 1972; Pow et al. 1989). De plus, les
pituicytes ont une apparence de cellules actives, c’est-à-dire notamment que leur cytoplasme
est dense et compte de nombreux organites (Galabov & Schiebler 1978). Enfin, jusqu’à l’âge
de trois mois, les pituicytes perdent peu à peu ces signes d’activité, qu’ils ne retrouvent en
grand nombre que lors d’une stimulation physiologique de la NH (Galabov & Schiebler
1978).
Ces travaux mériteraient d’être complétés par des analyses d’expression de marqueurs
de pituicytes au cours du développement de la NH. De plus, le lignage des pituicytes n’est pas
élucidé. L’idée la plus généralement acceptée veut que les pituicytes dérivent des cellules
épendymaires du plancher du troisième ventricule puisqu’on observe une continuité
morphologique entre ces dernières et les cellules de l’ébauche de la NH (Livingston 1976;
Galabov & Schiebler 1978).
44
IV. Physiologie de la neurohypophyse
1. Hormones neurohypophysaires
Dans la NH, les axones des neurones magnocellulaires sécrètent deux hormones dans
les capillaires sanguins : l’ocytocine et la vasopressine (aussi appelée ADH, pour antidiuretic
hormone, l’hormone anti-diurétique). La figure 16 résume les différentes situations
physiologiques qui peuvent entraîner la sécrétion de ces deux neuropeptides ainsi que les
effets sur leurs organes cibles.
Figure 16 : Stimulation et effets de la sécrétion d’hormones neurohypophysaires
Stimulée par la tétée ou la distension vaginale, l’ocytocine induit l’éjection du lait ou la contraction
de l’utérus. Chez les mâles, elle est plus fortement sécrétée au moment de l’éjaculation. L’ocytocine
stimule aussi la sécrétion d’insuline et de glucagon et agit sur les adipocytes, ce qui indique son
implication dans la régulation métabolique de l’alimentation. Avec l’ocytocine, la vasopressine est
sécrétée suite à divers stimuli dénotant une perte hydrique (hyperosmolarité plasmatique,
hypotension, hypovolémie due à une hémorragie…). En retour, les deux hormones interviennent dans
la réaction à la déshydratation en stimulant notamment la vasoconstriction, la rétention d’eau,
l’excrétion rénale de sodium et la coagulation.
45
La vasopressine est libérée dans la circulation générale en réponse à des variations de
la pression osmotique du sang ou de l’espace extracellulaire. Sa fonction est de contrôler
l’équilibre hydrique. Lors d’une déshydratation par exemple, l’osmolarité plasmatique
augmente, ce qui provoque, via les neurones osmorécepteurs de l’hypothalamus, une sécrétion
accrue de vasopressine. Celle-ci stimule alors les tubules distaux des reins afin d’accroître la
rétention d’eau et peut agir sur les artérioles et leurs afférences nerveuses pour entraîner une
vasoconstriction (Hanoune 1996; Silbernagl & Despopoulos 1997).
L’ocytocine est mieux connue pour son rôle dans la reproduction, puisque, chez les
mammifères femelles, elle est impliquée dans la parturition et la lactation. En effet, elle peut
induire la contraction de l’utérus et contrôle l’éjection du lait au niveau des cellules
myoépithéliales des glandes mammaires lors de la tétée. L’ocytocine intervient aussi dans la
régulation de l’équilibre hydrominéral puisque, après administration de sodium, elle stimule
l’excrétion rénale de sodium en conjonction avec le facteur natriurétique auriculaire et inhibe
le besoin de sel (Silbernagl & Despopoulos 1997).
2. Stimulation et plasticité morpho-fonctionnelle dans la neurohypophyse
Nous avons vu que des stimulations physiologiques diverses peuvent provoquer la
sécrétion des hormones neurohypophysaires, en particulier la déshydratation, la lactation et la
parturition. Déshydratation et lactation sont fréquemment utilisées expérimentalement dans
les études sur le fonctionnement de la NH. Dans notre laboratoire, le modèle que nous avons
choisi est la stimulation par déshydratation car elle est facile à mettre en œuvre sans délai et
une littérature abondante est disponible sur le sujet. Pour stimuler la NH par déshydratation,
on peut soit priver l’animal d’eau, soit remplacer son eau de boisson par une solution saline.
Dans les deux cas, il en découle une hyperosmolarité plasmatique, qui déclenche la sécrétion
de vasopressine et d’ocytocine dans la NH. La figure 17 montre spécifiquement les actions
des hormones mises en cause lors d’une déshydratation (Silbernagl & Despopoulos 1997).
46
Figure 17 : Action des hormones impliquées lors d’une déshydratation ou d’un excès de sel
La déshydratation per se (A) et l’excès de sel dans l’organisme (B) provoquent tous deux une
stimulation de la NH.
A. Lors d’une déshydratation, le compartiment extracellulaire devient hypertonique. Cela
stimule les neurones hypothalamiques, créant une sensation de soif et entraînant une sécrétion
de vasopressine et d’ocytocine dans la NH. Transportée jusqu’aux reins par la circulation
sanguine, la vasopressine y réduit l’excrétion d’eau.
B. Un excès de sel dans l’organisme résulte aussi en une hausse de l’osmolarité plasmatique.
Cela entraîne une libération d’hormones dans la NH et un freinage du système rénineangiotensine II-aldostérone, et donc une augmentation de la natriurèse. De plus, le volume du
compartiment extracellulaire et du plasma augmente, ce qui se traduit par une libération de
facteur natriurétique auriculaire, qui stimule l’excrétion de sodium. L’ocytocine inhibe
également le besoin de sel ressenti par l’hypothalamus.
De nombreuses études ont examiné les effets sur la NH d’une déshydratation
prolongée, parfois suivie d’une période de réhydratation. Une telle stimulation entraîne non
seulement la sécrétion des hormones vasopressine et ocytocine, mais aussi une hypertrophie
de la NH, une prolifération accrue dans la NH, qui concerne notamment les pituicytes et les
47
cellules endothéliales, ainsi qu’une augmentation de l’activité phagocytaire de la microglie
(Paterson & Leblond 1977; Tweedle & Hatton 1980; Kawamoto & Kawashima 1984; Mander
& Morris 1994). De plus, la sécrétion des hormones neurohypophysaires s’accompagne de
changements morphologiques importants remarqués dans la NH par microscopie électronique.
En effet, on observe une multiplication et un élargissement des terminaisons neuronales
(Tweedle & Hatton 1980; Theodosis et al. 1998). Qui plus est, en temps normal, les pituicytes
entourent les axones neurosécréteurs, tandis que, lors d’une stimulation, les pituicytes ne sont
plus retrouvés autour des axones (Figure 18). Les prolongements des pituicytes normalement
positionnés entre les axones et les vaisseaux sanguins se rétractent en cas de stimulation
(Matsunaga et al. 1999), ce qui accroît les contacts neurovasculaires (Wittkowski &
Brinkmann 1974; Tweedle & Hatton 1980). La sécrétion de neurohormones serait ainsi
favorisée (Theodosis 2002). Par ailleurs, la rétraction des pituicytes résulte en une hausse de
la concentration extracellulaire de K+ (Leng & Shibuki 1987), ce qui dépolariserait les
terminaisons axoniques et stimulerait davantage la sécrétion hormonale (Theodosis 2002). De
plus, les contacts synaptoïdes entre les terminaisons axoniques et les pituicytes sont aussi plus
nombreux dans la NH après trois jours de privation d’eau (Wittkowski & Brinkmann 1974).
Ces changements morphologiques pourraient découler de l’action des neurohormones ou de
neurotransmetteurs sur les pituicytes au niveau de ces contacts synaptoïdes (Boersma & Van
Leeuwen 1994). Des études sur des cultures de pituicytes ont en particulier démontré l’action
de l’adénosine et des neurohormones vasopressine et ocytocine sur la morphologie des
pituicytes (Rosso et al. 2002a,b).
Figure 18 : Changements morphologiques au cours d’une stimulation de la NH
Au cours d’une stimulation, la couverture gliale (en bleu) des terminaisons des neurones
magnocellulaires est réduite, permettant l’augmentation de la zone de contact
neurovasculaire. Ces mouvements faciliteraient la sécrétion des neurohormones dans la
circulation générale. PSA-NCAM, représenté en jaune, constituerait un facteur permissif
dans ces mouvements cellulaires.
48
Des modifications similaires sont observées dans les noyaux hypothalamiques qui
projettent dans la NH (voir Tweedle & Hatton 1980 pour une revue). Ces changements étant
réversibles par une réhydratation (Tweedle & Hatton 1980; Kawamoto & Kawashima 1984),
on parle donc de plasticité morpho-fonctionnelle. Différents facteurs permissifs semblent
favoriser cette plasticité (Theodosis et al. 1998), notamment la forme polysialylée de la
molécule neurale d’adhésion cellulaire (PSA-NCAM). Par exemple, retirer spécifiquement
PSA sur NCAM par micro-injection de l’enzyme endoneuraminidase (endoN) dans le noyau
supraoptique empêche les modifications normalement observées dans les contacts neuroneuronaux et neurono-gliaux après déshydratation ou pendant la lactation (Theodosis et al.
1999).
C. HYPOTHÈSES DE TRAVAIL
Dépourvue de neurones et d’oligodendrocytes, la NH m’est apparue comme un
modèle d’étude simple et encore inexploré pour analyser le développement des cellules
gliales. D’après une étude de Wang et ses collaborateurs (Wang et al. 1994), des cellules
rappelant les précurseurs d’oligodendrocytes (OPC) sont présentes dans la NH de rats
nouveau-nés. De plus, des travaux préliminaires de mon laboratoire avaient montré que, chez
la souris, des morceaux de NH greffés dans une zone neurogénique (la ZSV) génèrent
différents types de cellules, certaines exprimant des marqueurs d’astrocytes et
d’oligodendrocytes. J’ai donc voulu tester l’hypothèse que la NH néonatale pourrait contenir
soit des cellules souches, soit des précurseurs multipotents. Ces cellules souches ou
précurseurs pourraient donner naissance aux pituicytes au cours du développement de la NH.
Par ailleurs, la NH adulte est le siège d’une gliogenèse de base assez faible, fortement
accentuée lors de stimulations physiologiques comme la déshydratation (Paterson & Leblond
1977; Murugaiyan & Salm 1995). De plus, des explants de NH adulte sont capables de
générer des oligodendrocytes en culture (Coquillat 2001). Même chez l’adulte, la NH pourrait
ainsi contenir des cellules souches ou progénitrices. In vivo, ces cellules pourraient servir à
donner naissance à de nouveaux pituicytes. C’est la seconde hypothèse que j’ai souhaité
vérifier.
49
RESULTATS
A. Article 1 : Des précurseurs d’oligodendrocytes génèrent des
pituicytes
in
vivo
au
cours
du
développement
de
la
neurohypophyse (Virard et al. 2006)
I. Approche expérimentale
Dans un premier temps, je voulais tester l’hypothèse que la NH de rat nouveau-né
contient des précurseurs d’oligodendrocytes (OPC) et que ces OPC sont à l’origine des
pituicytes. Mon premier objectif a donc consisté à caractériser les cellules de la NH néonatale.
J’ai utilisé des marqueurs variés pour identifier les précurseurs présents dans la NH et définir
les étapes de différenciation des pituicytes in vivo. Des cultures cellulaires et des greffes
m’ont également permis de déterminer les propriétés des cellules de la NH, en particulier leur
potentiel de différenciation et leur motilité. Enfin, j’ai utilisé des souris modifiées
génétiquement afin de suivre les cellules progénitrices au cours du développement et étudier
leur relation de lignage avec les pituicytes.
II. Résumé des résultats
Mes résultats sont venus corroborer l’hypothèse de départ, comme l’illustre l’article 1
présenté ci-après.
Tout d’abord, j’ai montré que des marqueurs d’OPC sont présents dans la NH en
développement et ce, dès E20. Des hybridations in situ et des immunomarquages multiples
ont ensuite permis de vérifier que des cellules de la NH expriment une combinaison de
marqueurs caractéristiques des OPC (voir figure 19), à savoir olig1, Olig2, pdgfrα, sox10 et
Nkx2.2.
50
Figure 19 : Le lignage oligodendrocytaire
A. La spécification des précurseurs d’oligodendrocytes a lieu dans le neuroépithélium
germinatif. Les OPC entament ensuite leur migration tout en proliférant. Ils deviennent
ensuite postmitotiques et passent par des stades de pré-oligodendrocytes et
d’oligodendrocytes immatures avant de se différencier en oligodendrocytes matures
myélinisants.
B. Ces étapes de maturation sont caractérisées par l’expression séquentielle de marqueurs
distinctifs. Les OPC sont ainsi identifiables à des marqueurs comme pdgfrα, NG2 ou A2B5,
qui disparaissent dans les stades plus avancés de l’oligodendrogenèse, ou d’autres qui
persistent dans les oligodendrocytes matures, comme plp/dm20 et les facteurs de
transcription Olig1, Olig2 et Sox10 (notons qu’Olig1 devient alors cytoplasmique).
Note : ce schéma représente une synthèse de résultats obtenus in vitro et in vivo sur des
cellules de différentes structures (nerf optique et moelle épinière notamment). Des
divergences importantes peuvent exister dans d’autres régions du SNC.
Tiré de Woodruff et al. 2001; Liu et al. 2002; Watanabe et al. 2004; Kitada & Rowitch 2006
Pour confirmer que les cellules ainsi identifiées d’après l’expression de marqueurs
sont effectivement des OPC, j’ai étudié leurs propriétés fonctionnelles in vitro. Les travaux de
Raff et ses collaborateurs avaient montré que les OPC du nerf optique présentent deux
caractéristiques principales : d’une part, ils migrent en réponse à des facteurs spécifiques et,
51
d’autre part, ils sont bipotentiels, c’est-à-dire capables de se différencier soit en
oligodendrocytes, soit en astrocytes de type 2, selon le milieu de culture (Raff et al. 1983b).
J’ai d’abord étudié la motilité des cellules de la NH en utilisant des cultures d’explants de NH
néonatale. J’ai observé que des cellules migrent hors des explants mais uniquement en
présence de FGF-2, de PDGF-AA et de NT3, des facteurs favorisant notamment la migration
des OPC du nerf optique (McKinnon et al. 1990; Barres et al. 1994). De plus, ces cellules
sorties des explants expriment les marqueurs d’OPC Olig2, A2B5 et NG2. Ensuite, j’ai
analysé le potentiel de différenciation des cellules de la NH : j’ai isolé les progéniteurs
A2B5+ par tri cellulaire magnétique, puis les ai mis en culture dans différents milieux. Après
4 jours, les cellules A2B5+ maintenues dans un milieu pauvre en sérum se sont
essentiellement différenciées en cellules O4+/GFAP- avec la morphologie ramifiée des
oligodendrocytes matures, tandis que, dans un milieu contenant 10% de sérum, elles ont
généré une majorité d’astrocytes de type 2 immunopositifs pour O4 et GFAP. En d’autres
termes, les progéniteurs A2B5+ de la NH néonatale sont bipotentiels in vitro, comme les OPC
du nerf optique.
Ainsi, j’ai montré que la NH néonatale contient de véritables OPC. Cette découverte
était surprenante puisqu’il n’y a aucun oligodendrocyte myélinisant dans la NH adulte,
comme en témoigne un marquage négatif contre la protéine basique de la myéline (MBP). J’ai
voulu confirmer que des cellules de la NH peuvent réellement donner naissance à des
oligodendrocytes matures. En premier lieu, j’ai suivi la différenciation des cellules issues des
explants de NH après 14 jours dans un milieu pauvre en sérum : telles des oligodendrocytes,
elles se sont mises à exprimer O4, GalC et MBP. En second lieu, un membre de mon équipe a
effectué des greffes de NH de souris actine-GFP dans le cerveau de souris shiverer
déficientes en myéline : 25 et 39 jours plus tard, nous avons observé des cellules
GFP+/MBP+, indiquant que des cellules de la NH s’étaient différenciées en oligodendrocytes
myélinisants.
Puisque la NH est dépourvue d’oligodendrocytes, quel peut être le rôle des OPC
présents dans la NH périnatale ? Nous avons postulé qu’ils servent à générer non pas des
oligodendrocytes, mais des pituicytes. En accord avec cette hypothèse, les marqueurs de
pituicytes S100 et vimentine apparaissent vers le jour de la naissance (P0), donc après les
OPC. A ce stade, de rares cellules expriment à la fois des marqueurs d’OPC (NG2) et de
pituicyte (S100 ou vimentine) et pourraient ainsi représenter une étape de transition entre
l’OPC et le pituicyte. Enfin, pour suivre le devenir des OPC au cours du développement de la
NH, j’ai utilisé des souris modifiées génétiquement, chez lesquelles un gène rapporteur (lacZ)
est exprimé dans toutes les cellules olig1+, notamment les OPC, ainsi que dans la
52
descendance de ces cellules (voir figure 20). Si les pituicytes dérivent des OPC olig1+, le
gène lacZ doit se retrouver exprimé dans les pituicytes. C’est effectivement ce que j’ai
observé après un marquage XGal sur des NH à P0 ou adultes : de nombreuses cellules de la
NH sont XGal+, dont des pituicytes S100+ ou vimentine+, ce qui montre la relation de
lignage qui existe entre les OPC olig1+ et les pituicytes.
Figure 20 : Analyse du lignage des pituicytes grâce à des souris olig1-cre/RosaLacZ
Des souris olig1-cre hétérozygotes (1) (Lu et al. 2002) ont été croisées à une lignée Rosa26
(2) (Soriano 1999) portant un allèle de lacZ précédé d’une séquence STOP floxée. Chez les
souris doublement hétérozygotes issues de ce croisement (3), toutes les cellules olig1+
expriment la recombinase Cre et donc toutes ces cellules et leur descendance activent la βgalactosidase de façon irréversible.
Ainsi, ce système permet de suivre le devenir des précurseurs d’oligodendrocytes (olig1+) et
notamment de déterminer s’ils génèrent des pituicytes dans la NH. Si cette hypothèse de
lignage est vraie, les pituicytes doivent exprimer la β-galactosidase chez les souris olig1cre/RosaLacZ.
Points-clés
-
Des cellules de la NH périnatale expriment une combinaison de marqueurs d’OPC.
-
En culture et après transplantation, ces cellules présentent des caractéristiques
fonctionnelles d’OPC.
-
Ces OPC génèrent les pituicytes au cours du développement de la NH. Les pituicytes
peuvent donc être considérés comme une branche particulière du lignage
oligodendrocytaire.
53
GLIA 53:294–303 (2006)
Oligodendrocyte Precursor Cells Generate Pituicytes
In Vivo During Neurohypophysis Development
ISABELLE VIRARD,1 DELPHINE COQUILLAT,1 MIRCEA BANCILA,1 SOVANN KAING,2 AND PASCALE DURBEC1*
1
Laboratoire de Neurogenèse et Morphogenèse dans le Developpement et chez l’Adulte, CNRS UMR 6156,
Universite de la Mediterranee, IBDM, Parc Scientifique de Luminy, Marseille, France
2
Department of Pediatric Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts
KEY WORDS
oligodendrocyte precursor cell; pituicyte; neurohypophysis;
cell lineage; cell differentiation
ABSTRACT
In the vertebrate brain, much remains to be understood
concerning the origin of glial cell diversity and the potential lineage relationships between the various types of glia.
Besides astrocytes and myelin-forming oligodendrocytes,
other macroglial cell populations are found in discrete
areas of the central nervous system (CNS). They share
functional features with astrocytes and oligodendrocytes
but also display specific characteristics. Such specialized
cells, called pituicytes, are located in the neurohypophysis
(NH). Our work focuses on the lineage of the pituicytes
during rodent development. First, we show that cells identified with a combination of oligodendrocyte precursor cell
(OPC) markers are present in the developing rat NH. In
culture, neonatal NH progenitors also share major functional characteristics with OPCs, being both migratory
and bipotential, i.e. able to give rise to type 2 astrocytes
and oligodendrocytes. We then observe that, either in vitro
or after transplantation into myelin-deficient Shiverer
brain, pieces of NH generate myelinating oligodendrocytes,
confirming the oligodendrogenic potentiality of NH cells.
However, no mature oligodendrocyte can be found in the
NH. This led us to hypothesize that the OPCs present in
the developing NH might be generating other glial cells,
especially the pituicytes. Consistent with this hypothesis,
the OPCs appear during NH development before pituicytes
differentiate. Finally, we establish a lineage relationship
between olig11 cells, most likely OPCs, and the pituicytes
by fate-mapping experiments using genetically engineered
mice. This constitutes the first demonstration that OPCs
generate glial cells other than oligodendrocytes in vivo.
C 2005
V
Wiley-Liss, Inc.
INTRODUCTION
Although recent work has partly elucidated the development of oligodendrocytes in the neural tube (Liu
et al., 2002; Rowitch, 2004), much remains to be discovered concerning other glial lineages in the rest of the
CNS. Our study is aimed at understanding the origin of
glial cells in the neurohypophysis (NH), a CNS structure
located at the base of the brain (Fig. 1A–D). It is a
model of special interest due to its relatively simple cellular composition: apart from axons, blood vessels and
microglia, the principal cellular element is the pituicyte.
C
V
2005 Wiley-Liss, Inc.
Pituicytes are frequently regarded as astroglial cells
since, in rat, they express vimentin (Marin et al., 1989)
and S-100b (Cocchia and Miani, 1980), two markers of
the astrocyte lineage. Glial fibrillary acidic protein
(GFAP), another astrocyte marker, is also detected in rat
and human pituicytes (Salm et al., 1982; Velasco et al.,
1982), but not in mouse pituicytes (our unpublished
observation). Pituicytes may thus constitute a specialized population of glial cells distinct from astrocytes, as
anticipated from classical histological studies (Bucy,
1932). Importantly, no markers of mature oligodendrocytes are detected in the NH (see Fig. 4A). Nevertheless,
an earlier study (Wang et al., 1994) suggested the presence of oligodendrocyte precursor cells (OPCs) in the
developing NH: neurohypophysial explants from newborn rats generated migrating cells that exhibited properties similar to those described previously for OPCs
from the optic nerve (Raff et al., 1983).
During development, OPCs arise from multipotential
cells in spatially restricted regions of the germinal
zones (Spassky et al., 1998, 2001; Vallstedt et al.,
2005). Subsequently, they migrate throughout the CNS
to reach their final destinations, where most differentiate into oligodendrocytes, while others persist as OPCs
in the adult. Early OPCs express characteristic markers: the proteolipid protein transcripts plp/dm20
(Spassky et al., 1998), which encode major myelin components; the platelet-derived growth factor receptor-a
(PDGFRa) (Hall et al., 1996); Sox10, a transcription
factor of the high-mobility group domain family,
expressed by all glial progenitors (Kuhlbrodt et al.,
1998; Zhou et al., 2000); Olig1 and Olig2, two bHLH
transcription factors, necessary for early commitment
of OPCs and oligodendrocyte lineage specification (Lu
et al., 2000; Zhou et al., 2000); Nkx2.2, a homeodomain
transcription factor involved in OPC differentiation (Qi
Grant sponsor: Association pour la Recherche contre le Cancer (ARC); Grant
sponsor: European Community; Grant number: QLG3-CT-2000-00911; Grant sponsor: INSERM Stem Cell Network.
*Correspondence to: Pascale Durbec, Laboratoire de Neurogenèse et Morphogenèse dans le Developpement et chez l’Adulte, CNRS UMR 6156, Universite de la
Mediterranee, IBDM, Parc Scientifique de Luminy, 13288 Marseille Cedex 9,
France. Email: [email protected]
Received 2 May 2005; Accepted 12 August 2005
DOI 10.1002/glia.20282
Published online 1 November 2005 in Wiley InterScience (www.interscience.wiley.
com).
OPCS GENERATE PITUICYTES IN VIVO
295
Fig. 1. Chronology of appearance
of oligodendrocyte progenitor markers in the developing rat NH. A,C:
The hypophysis is located under the
brain. Boxes: areas viewed in B and
D. B,D: Nissl staining on sagittal
sections of E20 and P10 rat hypophysis. NH: neurohypophysis; I: intermediate lobe; AH: adenohypophysis.
The pituitary stalk joins the NH to
the hypothalamus (Hy). E: At E20,
pdgfra1 cells are present throughout
the NH (surrounded by the dotted
line; inset: larger view of positive
cells), where they persist at P0 (F),
P10 (G), and in the adult (H). olig11
cells are detected in the NH at E20
(I), but not at its distal end, which
is even more noticeable at P0 (J).
At P10 (K) and in the adult (L),
olig11 cells are restricted to the junction with the pituitary stalk. With the
sox10 (M–P) and olig2 (Q–T) probes,
we obtain staining patterns quite similar to that of olig1, although somewhat fainter for olig2. In the adult,
sox101 cells are present throughout
the NH (P). plp/dm20 is not detected at E20 (U), but later (V–X)
displays a pattern of expression similar to olig1. Cx, cortex; Cb, cerebellum; OB, olfactory bulb; OC, optic
chiasma. Scale bars 5 500 lm in
B,D; 250 lm in E–X.
et al., 2001); NG2, a chondroitin sulfate proteoglycan
(Nishiyama et al., 1996) and a surface antigen recognized exclusively in vitro by the A2B5 antibody (Raff
et al., 1983).
Culture of perinatal OPCs from structures such as
the optic nerve demonstrated their bipotentiality
in vitro: they differentiate into type 2 astrocytes in the
presence of fetal calf serum (FCS) and cytokines (Fulton et al., 1991), whereas in serum-free medium they
generate oligodendrocytes (Raff et al., 1983; Noble and
Wolswijk, 1992; Noble et al., 2004). Other reports suggested that OPCs might actually be bipotential in vivo
in pathological situations (reviewed in Franklin and
Blakemore, 1995; Franklin, 2002). However, while it is
clear that the primary fate of OPCs during CNS development is to generate oligodendrocytes, there is no definitive evidence that they give rise to astrocytes or other
glial cells in vivo (Skoff, 1990; Fulton et al., 1992;
Franklin and Blakemore, 1995; Franklin, 2002; Noble
et al., 2004).
In the present work, we further characterize the cells
previously identified as putative OPCs in the developing NH (Wang et al., 1994) and study their relationship
with pituicytes. By in situ hybridization, immunolabeling, cell culture, and transplantation, we establish that
cells with phenotypic and functional properties of OPCs
are present in the developing rodent NH before pituicyte differentiation. Moreover, using genetically engineered mice to follow the fate of these precursors, we
demonstrate in vivo that pituicytes derive from these
OPCs. We conclude that OPCs generate pituicytes during NH development. This is the first demonstration
that OPCs actually give rise to a glial cell population
distinct from oligodendrocytes in vivo.
296
VIRARD ET AL.
MATERIALS AND METHODS
Solutions for cell culture were purchased from Invitrogen (Cergy Pontoise, France) and other chemicals from
Sigma (Saint Quentin Fallavier, France), if not otherwise specified.
Animals and Tissue Processing
All procedures involving the use of animals were performed in accordance with the European Animal Care
Guidelines and Directives. We used Wistar rat and
Swiss mouse embryos and pups from embryonic day 16
(E16) to postnatal day 10 (P10), and 6- to 8-week-old
males. Dr. D. Rowitch’s laboratory (Dana-Farber Cancer
Institute) provided tissues from the progeny of an olig1cre heterozygote mouse (Lu et al., 2002) mated to a
ROSA26 strain carrying a floxed-STOP allele of lacZ
(Soriano, 1999). Shiverer mice were obtained from the
Jackson Laboratory (Bar Harbor, ME). Brains and hypophyses from animals perfused with 4% paraformaldehyde (PF) were postfixed with 4% PF for 2 h, cryoprotected, and included in OCT (Sakura Finetek, Bayer
Diagnostic). Cryostat sections (12 lm) were collected on
SuperFrost slides (VWR, Fontenay-sous-Bois, France).
Neurohypophysial Explant Cultures
NH culture was performed as described by Wang and
colleagues (1994). Briefly, NHs from P0–P3 rats were
carefully dissected from the meninges, adenohypophysis,
and intermediate lobe. Each was then sectioned into 4–6
pieces and explanted onto poly-L-lysine-treated glass coverslips either in Dulbecco’s modified Eagle’s medium (DMEM)
with 10% FCS or in serum-free medium (DMEM-F12
complemented with 100 lg/ml human transferrin, 5 lg/ml
insulin, 100 lM putrescin, 20 nM progesterone, 30 nM
sodium selenite, and 1 mM sodium pyruvate) supplemented or not with FGF-2 (10 ng/ml), PDGF-AA (10 ng/
ml), and NT3 (10 ng/ml) in the presence of 0.4% methylcellulose. For cell migration assays, A2B51 cells were
counted around NH explants in three independent
experiments with at least five explants per condition. In
experiments designed to analyze the role of proliferation, 10 mM b-D-arabinofuranosylcytosine (ARA-C) was
added to the culture medium after 17 h. Cell progression
out of the explants was then monitored at different time
points (17, 23, and 39 h after explantation) using a Leica
DM IRB inverted microscope.
Dissociated and Sorted Cell Cultures
P0–P3 rat NHs were dissected, incubated in 5 mg/ml
trypsin in Hanks’ balanced salt solution (HBSS) and dissociated by trituration. After rinsing in DMEM containing 10% FCS, the suspension was incubated with the
A2B5 antibody (ascites diluted 1:100; American Type
Cell Collection [ATCC], Manassas, VA), then with an
anti-mouse IgM antibody conjugated to microbeads (Miltenyi Biotec, Paris, France). Magnetic-activated cell sorting (MACS) was performed according to the manufacturer’s recommendations by passing the cells over an
MS cell separation column (Miltenyi Biotec) twice. First,
to confirm the identity of the acutely dissociated A2B51
cells, their antigenic phenotype was assayed by rapid
centrifugation onto glass slides using a Shandon 4 Cytospin (Thermo, Jouan, Saint-Herblain, France) and by
fixation and staining with A2B5 or the anti-Olig2 antibody. Second, to study their differentiation potential, the
positive cell fraction was seeded at a concentration of
4,000 cells in 12 ll of DMEM complemented with 10%
FCS onto poly-L-lysine-treated glass coverslips and left
to settle for 1 h. We then filled the dishes with either
DMEM complemented with 10% FCS or the defined
medium described above, diluting the serum down to a
final concentration of 1%. Both explant and dissociated
cell cultures were kept at 37°C in 5% CO2 and 95% air,
and one-half of the medium was changed every other
day.
Transplantation of Mouse NH Pieces
into Shiverer Brain
We dissected NH pieces (150–200 lm in diameter)
from newborn mice expressing the green fluorescent protein (GFP) under the control of the actin promoter
(actin-GFP mice) (Hadjantonakis et al., 1998). We
excluded the intermediate lobe and pituitary stalk and
only used the part of the NH most distal from the stalk.
We then grafted 2–3 NH pieces into the brain of
2-month-old myelin-deficient Shiverer mice (n 5 6)
(Lachapelle et al., 1983–1984), within the lateral ventricle. We sacrificed host mice at various times after transplantation (25 or 39 days) and processed their brains for
cryostat sectioning, as described above. Sagittal sections
(14 lm) were labeled with an anti-MBP antibody.
Immunolabeling and Nissl and XGal Staining
We used the following primary antibodies: A2B5
(mouse IgM; pure supernatant; ATCC), anti-Olig2 (rabbit; 1:20,000; gift from Dr. Rowitch), polyclonal anti-NG2
(rabbit; 1:200–1:1,000; Chemicon, Euromedex, Mundolsheim, France), monoclonal anti-NG2 (mouse IgG; 1:25;
Chemicon, Euromedex) and anti-Nkx2.2 (mouse IgG;
1:800; Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA) for OPCs; O4 (mouse IgM;
1:1; ATCC) for oligodendrocytes and type 2 astrocytes;
anti-MBP (mouse IgG; 1:50; Euromedex) and GalC
(mouse IgG; 1:1; ATCC) for oligodendrocytes; and antivimentin (clone LN-6; mouse IgM; 1:200; Sigma), anti-S100 (rabbit; 1:300; DAKO, Trappes, France), monoclonal
anti-GFAP (mouse IgG; 1:400; Sigma), and polyclonal
anti-GFAP (rabbit; 1:100; Sigma) for pituicytes or astrocytes. For immunolabeling, the tissue sections were
OPCS GENERATE PITUICYTES IN VIVO
incubated overnight at 4°C in a primary antibody solution, with 0.1% Triton X-100 for internal markers
(GFAP, MBP, Nkx2.2, Olig2, S-100, vimentin). The sections were subsequently washed and incubated with the
appropriate fluorescently labeled secondary antibodies
(1:1,000; Jackson ImmunoResearch Laboratories, West
Grove, PA). To label cultures, we first fixed them for
10 min in 4% PF in phosphate-buffered saline (PBS) and
incubated them in the primary antibody for 1 h at room
temperature (RT); then, after washes, we soaked them
in the corresponding secondary antibody for 1 h at RT.
When necessary, we stained cell nuclei with Hoechst
33342. Sections, tissue pieces, and cultures were examined using Zeiss Axiophot fluorescence or confocal microscopes. Nissl and XGal stainings on 12-lm cryosections
were performed using classical protocols. To carry out
immunohistochemistry after either in situ hybridization
or XGal staining, we postfixed the tissue sections with
4% PF and followed the immunohistochemical staining
protocol of the Vectastain universal Elite ABC kit (Vector Laboratories, Burlingame, CA). To analyze the glial
cells of the adult NH, the number of positive cells for a
given marker was counted on at least 5 randomly-chosen sections from adult rat NH and compared with the
total number of cells identified with the nuclear marker.
When XGal staining was followed by immunohistochemistry, we first counted cells stained with XGal and then
performed immunohistochemistry, analyzed the exact
same fields, and included in our analysis only cells with
a clear immunolabeling.
In Situ Hybridization on Sections
Nonradioactive in situ hybridization was done as previously described (Tiveron et al., 1996), with minor modifications. Cryosections (12 lm) of adult rat NH were
hybridized with 500 ng/ml digoxigenin-labeled antisense
riboprobes for olig1 and olig2 (Lu et al., 2000), pdgfra
(Mudhar et al., 1993), sox10 (Kuhlbrodt et al., 1998), or
plp/dm20 (Peyron et al., 1997). To improve final color
development, 5–10% polyvinyl alcohol was added to the
development solution.
RESULTS
Glial Progenitor Markers Are Present in the
Developing Rat NH
To determine whether there are OPCs in the NH, as
had been previously suggested (Wang et al., 1994), we
performed in situ hybridization with different classical
glial markers on developing and adult rat NH. At early
stages, OPCs can be identified by the expression of markers such as plp/dm20 (Spassky et al., 1998), plateletderived growth factor receptor a (PDGFRa) (Hall et al.,
1996), and the transcription factors Sox10 (Kuhlbrodt
et al., 1998; Zhou et al., 2000), Olig1, and Olig2 (Lu
et al., 2000; Zhou et al., 2000). In rat, the anlage of the
NH is formed before E17.5 as a mass of cells derived
297
from the neuroectoderm. Ultrastructural studies had
suggested that cell differentiation in the NH starts from
E17.5 and is maintained till one month after birth
(Galabov and Schiebler, 1978). In our study, we used tissue sections from E16 to adult rats to investigate the
chronology in which glial progenitor markers appear
during NH development (Fig. 1).
The earliest detection of OPC markers in the anlage
of the NH (Fig. 1A,B) was at E20; at this stage, we
observed expression of pdgfra (Fig. 1E), olig1 (Fig. 1I),
sox10 (Fig. 1M), only weak staining for olig2 (Fig. 1Q)
and no staining for plp/dm20 (Fig. 1U). At P0, pdgfra
was expressed in cells dispersed throughout the NH
(Fig. 1F), while olig1-expressing cells were seen in the
stalk and the proximal half of the NH (Fig. 1J). sox10
(Fig. 1N), olig2 (Fig. 1R), and plp/dm20 (Fig. 1V) probes
had expression patterns similar to olig1. At later stages,
namely at P10 (Fig. 1C,D) and in the adult, pdgfra
(Fig. 1G,H) remained expressed in cells located in the
entire NH, whereas olig1 (Fig. 1K,L), olig2 (Fig. 1S,T),
and plp/dm20 (Fig. 1W,X) were only detected at the
junction with the pituitary stalk. With the sox10 probe,
at P10, we obtained a clear staining in the stalk and
proximal part of the NH as well as in a few cells at the
distal end of the NH (Fig. 1O) and, in the adult, a weak
staining in cells dispersed throughout the NH (Fig. 1P).
To characterize further the cells expressing OPC markers, we carried out double stainings at P0. At this stage,
100% of the olig11 cells in the NH also expressed Olig2
and vice versa (Fig. 2A). Furthermore, all the Olig21 cells
were also positive for pdgfra (Fig. 2B) and sox10 (Fig. 2C),
as well as for Nkx2.2 (Fig. 2D), another OPC marker (Qi
et al., 2001). Thus, at P0, cells in the NH simultaneously,
express olig1, Olig2, pdgfra, sox10, and Nkx2.2 a combination of markers also found in OPCs (Liu et al., 2002).
Strikingly, the appearance of these cells coincided with
the presence of migrating OPCs in the nearby optic
chiasma (Fig. 2E,F) (Small et al., 1987).
Overall these results demonstrate that progenitor cells
expressing concomitantly a set of OPC markers, i.e.,
olig1/Olig2/pdgfra/sox10/Nkx2.2 are present in the developing NH. To establish that these progenitors are
actual OPCs, we also characterized these cells functionally in vitro.
NH Precursors Are Migratory and Bipotential
Previous studies showed that OPCs from the optic
nerve display two major functional properties in vitro:
they are migratory and bipotential, giving rise either to
oligodendrocytes or to type 2 astrocytes, depending on
the culture medium composition (Raff et al., 1983).
Therefore, we first assayed the migratory behavior of
NH cells. Newborn NHs were dissected out and cultured
in defined medium in the presence of FGF-2, PDGF-AA,
and NT3, known to favor the migration, proliferation,
and survival of optic nerve OPCs (McKinnon et al.,
1990; Barres et al., 1994). Migrating cells were observed
around the explants within 24 h when FGF-2, PDGF-
298
VIRARD ET AL.
Fig. 2. Phenotypic characterization of rat NH glial progenitor cells
at P0. In situ hybridizations combined with an anti-Olig2 staining
demonstrate that the Olig21 cells in the NH are also positive for olig1
(A), pdgfra (B), and sox10 (C). D: Olig21 cells co-express Nkx2.2 as
well, as seen by a double immunofluorescent staining. Thus, at P0, cells
in the NH express a combination of markers characteristic of OPCs.
E: Location of the area shown in F. F: Interestingly, olig11 cells are
present in the NH at a time when olig11 OPCs enter the nearby optic
chiasma (OC). Scale bars 5 20 lm in A–D; 500 lm in F.
AA, and NT3 were present in the medium. Cell migration also occurred in the presence of the antimitotic
agent ARA-C (Fig. 3A–C), indicating that this effect was
not due to proliferation. It did not result from explant
spreading either since the explants maintained their original shape over time (Fig. 3A–C). The migrating cells
were identified using Olig2 as well as NG2 and A2B5,
classical in vitro markers for OPCs. We quantified the
number of A2B51 cells around the explants after 48 h in
the absence or presence of the trophic factors: only rare
A2B51 cells were found in the control conditions (<1
A2B51 cell per explant; Fig. 3D), whereas numerous
A2B51 progenitors migrated out of the explants in the
presence of NT3, PDGF-AA and FGF-2, representing
37% of the total migrating cells (55.3 cells per explant,
SEM 5 32.5; Fig. 3E). Furthermore, 99% and 100% of
the A2B51 cells also stained, respectively, with antiNG2 and anti-Olig2 antibodies, other oligodendrocyte
lineage markers (Fig. 3F,G). In conclusion, explants of
newborn rat NH can give rise to A2B51/Olig21/NG21
cells that migrate only in the presence of trophic factors
known to promote the migration of classical OPCs.
Second, to show directly that the NH precursors are
bipotential in vitro, we isolated the A2B51 progenitor
cell population from a suspension of dissociated P0–P3
rat NH cells using immunomagnetic separation. After
cytocentrifugation, 90% of the cells in the positive fraction were A2B51 and 100% of the freshly dissociated
A2B51 cells were also positive for Olig2 (not shown). We
then followed their differentiation by analyzing their
morphology and their expression of specific markers: oligodendrocytes can be recognized because they are O41/
GFAP2, and type 2 astrocytes, GFAP1/A2B51 or GFAP1/
O41 (Raff et al., 1983; Ingraham et al. 1999). After
4 days of culture in medium containing 10% serum, 56%
of the cells were both O41 and GFAP1 and displayed a
typical type 2 astrocyte morphology (Fig. 3H) and 13%
were O41, GFAP2 oligodendrocytes. When cultured in
low serum conditions, 67% of the total cells were O41
but GFAP2, with the ramified morphology of mature oli-
Fig. 3. Functional in vitro characterization of precursors from rat
NH: migratory behavior and bipotentiality. A–C: In the presence of
FGF-2, PDGF-AA, and NT3, numerous cells are observed migrating out
of a newborn rat NH explant (Ex) after 17 (A), 23 (B), and 39 h (C) in
culture, even in the presence of the anti-mitotic agent ARA-C (B,C;
ARA-C was added after 17 h). Rare A2B51 cells migrating from neonatal NH explants (Ex) after 48 h can be observed in the absence of
trophic factors (D), but their number increases significantly in the presence of FGF-2, PDGF-AA, and NT3 (E). The migrating A2B51 cells
clearly belong to the OPC lineage, since they are positive for both NG2
(F) and Olig2 (G). H,I: NH precursor cells are bipotential: sorted
A2B51 cells cultured for 4 days differentiate into either O41/GFAP1
type 2 astrocytes in high serum conditions (H) or O41/GFAP2 oligodendrocytes in low serum conditions (I). GFAP, glial fibrillary acidic protein. Scale bar 5 50 lm.
godendrocytes (Fig. 3I), and 6% of the cells were type 2
astrocytes. Less than 1% of type-1 astrocytes were
observed in either condition (not shown). Approximately
30% of the cells in both culture media were both O42
and GFAP2 after immunostaining and presented a
round undifferentiated or fibroblast-like morphology.
OPCS GENERATE PITUICYTES IN VIVO
299
This constant proportion of cells likely derived from the
<10% contaminating A2B52 cells present after purification at plating time. Our results clearly demonstrate
that purified progenitors from newborn rat NH can give
rise to either astrocytes or oligodendrocytes and thus
share with OPCs their main functional characteristic.
Neonatal NH Can Generate Mature Myelinating
Oligodendrocyte In Vitro and In Vivo
Fig. 4. Generation of mature myelinating oligodendrocytes from NH
in vitro and in vivo in a heterotopic location. A: The adult rat NH (delineated with the dotted line) is totally devoid of myelinating oligodendrocytes, as illustrated by an anti-myelin basic protein (MBP) staining.
B,C: When cultured in defined medium, cells derived from neonatal rat
explants progressively differentiate into mature myelinating oligodendrocytes. After 14 days, they are immunopositive for the mature oligodendrocyte markers GalC (B) and MBP (C). D,E: After transplantation
into adult Shiverer mouse brain, NH pieces from newborn actin-GFP
mice give rise to MBP1 oligodendrocytes in the corpus callosum. In D,
the cell nuclei appear blue due to Hoechst 33342 staining. Arrows point
to some GFP1 cells that have migrated out of the implant. Scale bars 5
500 lm in A; 58 lm in B,C; 250 lm in D; 10 lm in E.
Fig. 5. Chronology of appearance
of pituicyte markers in the developing rat NH. Vimentin immunostaining is not observed at either E17.5
(A) or E20 (B). Vimentin1 cells are
present at P0 (C). Their number is
increased by P10 (D) and in the
adult (E). S-100 emerges earlier: no
or faint staining is detected at
E17.5 (F) and at E20 (G), respectively. The number of S-1001 cells
and the intensity of labeling are
much greater by P0 (H), and even
more so at P10 (I) and in the adult
(J). Consistent with a lineage from
OPCs to pituicytes, rare cells doubly
labeled for vimentin and NG2 (K)
and for S-100 and NG2 (L) can be
observed at P0. Scale bars 5 50 lm
in A–J; 20 lm in K,L.
The presence of OPCs in the developing NH is intriguing, since the adult structure is devoid of myelinating
oligodendrocytes, as monitored by myelin basic protein
(MBP) staining (Fig. 4A). We further investigated the
potentiality of neonatal NH to generate mature myelinating oligodendrocytes in different environmental contexts.
As described previously, after 48 h in culture in
serum-free medium supplemented with NT3, PDGF-AA,
and FGF-2, A2B51/NG21/Olig21 cells had already
migrated out of the explant (Fig. 3E–G). We monitored
the capacity of these cells to differentiate further into
mature myelinating oligodendrocytes. After 14 days,
cells had the typical ramified morphology of mature oligodendrocytes and expressed the O4 (not shown), GalC
(Fig. 4B), and MBP (Fig. 4C) antigens. We never
observed cells expressing a neuronal phenotype, as monitored with either anti-bIII-tubulin or anti-NeuN antibodies (not shown). These results thus indicate that progenitors from newborn rat NH are able to give rise to
mature oligodendrocytes in vitro.
To assay the potential of NH-derived cells to differentiate into fully mature myelinating oligodendrocytes
in vivo in a heterotopic location, we transplanted NH
fragments from newborn actin-GFP mice into the brain
of adult Shiverer mice and performed anti-MBP labeling. Since Shiverer mice totally lack MBP (Warrington
300
VIRARD ET AL.
et al., 1993) and are hypomyelinated, any MBP labeling
detected in their brain must originate in the cells
derived from the grafted tissue (Lachapelle et al., 198384). We injected two to three explants into the right cerebral ventricle of 2-month-old Shiverer mice. We first
explored their potential to integrate this rodent CNS tissue based on GFP fluorescence. When the explants were
found (in 4 out of 6 brains), they were always integrated
in the corpus callosum (Fig. 4D). Some GFP1 cells had
migrated out of the graft and were found around the
implant (Fig. 4D, arrows). MBP labeling around GFP1
grafted cells was observed at both 25 days (not shown)
and 39 days (Fig. 4D,E) post-injection. Grafted cells
therefore had the potential to generate mature oligodendrocytes able to myelinate Shiverer axons (Fig. 4E). This
demonstrates that the neonatal NH contains cells able
to give rise to mature myelinating oligodendrocytes in
vivo in a heterotopic environment.
In summary, the neonatal NH contains OPCs with the
ability to generate fully mature oligodendrocytes either
in vitro or in vivo but these OPCs never differentiate
into oligodendrocytes during normal development of the
structure. We thus set out to understand what might be
the role of these OPCs and hypothesized that they could
participate in the formation of the NH.
NH OPCs Generate Pituicytes In Vivo
As previously mentioned, apart from blood vessel cells
and microglia, the main cell type in NH is the pituicyte,
recognizable from its expression of astrocyte markers.
We then sought to determine whether the NH OPCs
could be generating these pituicytes during NH development.
If this lineage hypothesis were correct, one would
expect pituicyte differentiation to occur after OPCs
appear in the developing NH. Therefore, we examined
the chronology of appearance of pituicyte markers. At
E17.5, no vimentin1 or S-1001 cells were visible in the
NH (Fig. 5A,F) and at E20, there were only a few cells
weakly positive for S-100 (Fig. 5G). Cells positive for
both astrocyte markers were first seen at P0 (Fig.
5C,H), and in larger numbers at P10 (Fig. 5D,I) and in
the adult (Fig. 5E,J). Thus, in the developing NH, differentiated pituicytes appear after cells expressing a combination of OPC markers, first detected at E20 (Fig. 1).
Another strong indication that the NH OPCs might differentiate into pituicytes is the presence, at P0, of rare
cells doubly positive for the OPC marker NG2 and
either one of the pituicyte markers vimentin (Fig. 5K) or
S-100 (Fig. 5L).
Our results are compatible with the possibility that
the OPCs present around birth in the NH might be the
pituicyte progenitors. To test this hypothesis directly, we
performed cell fate mapping using a genetically engineered mouse lineage tracer line. Using immunohistochemistry and in situ hybridization, we first showed
that the same markers can be used to identify the OPCs
in mouse NH (e.g., olig1 at P0; Fig. 6A and data not
shown). Then, olig1-cre heterozygote mice (Lu et al.,
2002) were mated to a ROSA26 reporter strain carrying
a floxed-STOP allele of lacZ (Soriano, 1999). In their
double heterozygous progeny, any olig11 cell will express the Cre recombinase and thus, all such cells and
their descendants irreversibly activate b-galactosidase.
XGal staining on NH from olig1-cre/RosaLacZ animals
revealed b-galactosidase activity in numerous cells
throughout the NH at P0 (Fig. 6C). No staining could be
observed on NH sections from a control littermate (Fig.
6B). Subsequent immunolabeling showed that some
XGal1 cells express vimentin at this stage (Fig. 6D–F).
In the adult NH, at a stage when the structure is fully
mature, 40% of the cells were XGal1 (Fig. 6G,J). Interestingly, cells expressing pituicyte markers represent a
similar proportion of cells in the adult NH. Indeed,
when we quantified pituicytes in the adult NH using S100, 45% of the total cells were labeled. Among the
XGal1 cells, we could clearly identify vimentin1 (Fig.
6G–I) and S-1001 pituicytes (Fig. 6J–L). Thirty-nine
percent of the XGal1 cells were vimentin1, representing
a conservative estimate given that the filamentous
staining pattern of vimentin precludes an accurate
quantification of the marked cells.
This result shows that pituicytes derive from olig1expressing cells, demonstrating that OPCs in the developing NH do generate cells other than oligodendrocytes
in vivo.
DISCUSSION
Our study provides evidence that, in the NH, OPCs
generate pituicytes in vivo. We have shown that, just
before birth, at the time when OPCs are colonizing the
nearby optic nerve in which they later generate oligodendrocytes, similar cells can be detected in the developing NH. Since the NH contains no oligodendrocytes, we
addressed the question whether OPCs differentiate into
glial cells distinct from oligodendrocytes in vivo. Genetic
labeling of the OPCs and their progeny demonstrated
unequivocally that pituicytes derive from olig11 precursor cells.
OPCs Generate Pituicytes During
NH Development
Multipotent stem cells give rise to more restricted precursor cells that undergo progressive maturation to generate postmitotic mature cells. Two types of precursors
with a restricted potential for differentiation into oligodendrocytes have been identified in the spinal cord: glial
restricted precursors (GRPs) and motor neuron–oligodendrocyte precursors (MNOPs). These two types of precursors are thought to generate OPCs (also called oligodendrocyte and type 2 astrocyte precursors or O-2A
cells). Indeed, a recent study showed that GRPs produce
OPCs and astrocyte precursors in vivo early during
spinal cord development (Liu and Rao, 2004a). In addi-
OPCS GENERATE PITUICYTES IN VIVO
Fig. 6. Analysis of the lineage relationship between olig1-expressing
cells and pituicytes in mouse NH. A: The olig1 probe identifies isolated
cells in the pituitary stalk and proximal mouse NH, as well as OPCs in
the developing brain and optic chiasma (OC). XGal staining on P0 control (B) and olig1-cre/RosaLacZ (C) mouse tissues: a large number of
cells display b-galactosidase activity in the olig1-cre/RosaLacZ NH.
Some XGal1 cells (D) co-express vimentin at P0 (E,F). In the adult
NH, XGal is also present in numerous cells (G,J), especially vimentin1
(H,I) and S-1001 (K,L) pituicytes. F,I,L: Enlargements of the boxed
areas in D,E, G,H, and J,K, respectively. Scale bars 5 250 lm in A–C;
25 lm in D,E,G,H,J,K; 10 lm in F,I,L.
tion, analyses performed in the developing spinal cord
demonstrated that oligodendrocytes are generated
through the maturation of MNOPs, which gives rise to
motor neurons first (from about E9.5–E10.5 in mouse)
and then to oligodendrocytes (from E12.5) (Lu et al.,
2002; Zhou and Anderson, 2002; Rowitch, 2004). The
lineage relationship between OPCs, MNOPs, and GRPs
is not completely solved in the spinal cord (Liu and Rao,
2004a,b; Noble et al., 2004; Rowitch, 2004), and very few
data are available concerning the rest of the CNS. However, these different types of precursors can be distinguished based on the expression of specific combinations
of markers and on the time window in which they are
present during development. Furthermore, each displays
specific functional characteristics, in particular concerning their differentiation potential (Liu et al., 2002;
Rowitch, 2004).
Clearly, our study indicates that the glial progenitors
identified in the NH from late gestation to neonate
stages meet criteria of the OPC definition since they (1)
are positive for olig1, Olig2, Nkx2.2, sox10, pdgfra
301
in vivo, as well as for A2B5, NG2, and Olig2 in vitro, (2)
are migratory in response to specific trophic factors, (3)
are bipotential in vitro after purification, giving rise to
type 2 astrocytes or oligodendrocytes, and (4) differentiate after birth. By comparison, GRPs share common features with the NH progenitors identified in our study,
namely the expression of A2B5 in vitro and Nkx2.2,
sox10 and olig1/2 in vivo, but GRPs initially lack the
expression of NG2 and pdgfra seen in the NH (Liu and
Rao, 2004a). Also, GRPs have only been identified early
in the developing spinal cord. Furthermore, GRPs generate type-1 astrocytes in vitro, a cell type we did not find
in the present analysis. As for MNOPs, they have only
been identified at very early stages in the spinal cord, at
a time when markers such as Nkx2.2 and sox10 are not
yet expressed (Rowitch, 2004). In conclusion, until more
is known about the diversity of glial lineages in the
brain and how the potential various lineages are linked,
we believe that the NH progenitors are more closely
related to OPCs than to other precursor cells in the
brain.
In our study, we have shown that the OPCs are present in the perinatal NH before pituicyte differentiation.
We clearly observed expression of early pituicyte markers from P0 (Fig. 5A–J) in the NH. Also, at P0, rare
cells express the OPC marker NG2 concomitantly with
the pituicyte markers vimentin and S-100 (Fig. 5K,L)
and could represent a transient state of maturation
between OPCs and mature pituicytes. These findings
are consistent with a putative lineage relationship
between the OPCs and the pituicytes. We then demonstrated, using genetically modified mice, that pituicytes
derive from olig11 cells (Fig. 6), the OPCs. Indeed, in
the adult NH, pituicytes represent 45% of the total cells,
which correlates with the proportion of Xgal1 cells
(40%). This result seems to indicate a single developmental origin for pituicytes. The fact that all XGal1 cells
are not vimentin1 could be explained by the heterogeneity of the pituicyte population, in which many but not
all cells express vimentin (our unpublished observation),
as well as by technical limitations. Finally, some
vimentin1 cells do not seem to be XGal1. This is again
likely due to technical limitations, but we cannot totally
exclude the possibility that some pituicytes could come
from an alternative source of precursor cells unrelated
to olig1.
Pituicytes, a Subclass of Oligodendrocytes
With Astrocytic Features
Can pituicytes be considered as astrocytes? Several
arguments support this idea. First, as previously mentioned, pituicytes express astrocyte lineage markers
such as vimentin (Marin et al., 1989) and S-100b (Cocchia and Miani, 1980), as well as GFAP in rat and
human (Salm et al., 1982; Velasco et al., 1982) but not
in mouse (our unpublished observation). Second, they
play an active role in synaptic activity modulation.
Indeed, pituicytes form a physical barrier between the
302
VIRARD ET AL.
blood vessels and the neurosecretory terminals of the
NH, in a synapse-like neurovascular junction. During
stimulation (i.e., parturition, lactation, or dehydration),
glial processes retract (Hatton, 1990), leading to an
increased juxtaposition between axonal terminals and
blood vessels and to the release of neuropeptides into
the general circulation (Theodosis, 2002). Similarly, an
active role in the direct modulation of synaptic transmission has been described for astrocytes in other areas of
the brain (Fellin and Carmignoto, 2004) and correlated
with astrocytic process motility in the brainstem (Hirrlinger et al., 2004). Third, many properties of pituicytes
resemble those described for immature astrocytes, as
reviewed by Franklin and Blakemore (1995). For
instance, pituicytes continue to express factors such as
vimentin, LeX/ssea-1 (our unpublished observation), a
marker of adult CNS stem cells (Capela and Temple,
2002), or polysialylated neural cell adhesion molecule
(PSA-NCAM), a marker for immature neural progenitors
(Theodosis et al., 1991). In contrast, classical histological
studies had found no resemblance at all between astrocytes and pituicytes using various staining techniques
(Bucy, 1932). This places the pituicytes in a distinct
category from other astrocyte populations and could be a
consequence of their different embryonic origin. Furthermore, pituicytes are not type 2 astrocytes either, the second cell type generated by OPCs in vitro as well as in
vivo in certain transplantations, since pituicytes do not
express A2B5 and O4 in vitro and NG2 in vivo (our
unpublished observations). Alternatively, pituicytes
could be regarded as a specialized subtype of oligodendroglia, and not as astrocytes. Indeed, it is interesting to
note that, like oligodendrocytes, pituicytes can, to some
extent, display ensheathing-like properties (Hatton,
1990). Thus, our results would highlight the cellular
diversity of the oligodendrocyte lineage: oligodendrocytes
would be a heterogeneous cell population including the
pituicyte subset. In conclusion, pituicytes could constitute a separate subclass of glial cells, belonging to the
oligodendrocyte lineage but sharing major functional
and phenotypic properties with astrocytes.
Environmental Cues in the NH Could Prevent
Oligodendrocyte Differentiation and
Favor a Pituicyte Fate
How might the differentiation of OPCs in the NH
come to differ from that in the optic nerve and other
CNS regions? Indeed, we have shown that cells from the
neonatal NH can generate fully mature oligodendrocytes
both in vitro and in vivo after transplantation in a heterotopic location (Fig. 4). However, NH OPCs generate
pituicytes and never become mature oligodendrocytes in
the adult NH (absence of olig1, olig2, plp, MBP). Several
arguments can be put forward to explain the putative
cellular and molecular mechanisms involved in OPC differentiation in the NH.
The fact that the olig genes act as repressors of astrocyte differentiation (Gabay et al., 2003) could indicate
that the astroglial-like phenotype of pituicytes may be
the ‘‘default’’ glial fate of OPCs. Signals that instruct
olig expression and thus oligodendrocyte differentiation
may be absent from this structure. For instance, the NH
may be devoid of Noggin signaling, which has been
shown to promote OPC differentiation into oligodendrocyte and to inhibit the formation of type 2 astrocytes
(Kondo and Raff, 2004). Another possibility would be
that the pituicyte fate is actively promoted in the developing NH. For instance, it has been established in other
systems that CNTF/LIF family cytokines favor astrocyte
differentiation (Ware et al., 1995; Johe et al., 1996;
Bonni et al., 1997; Nakashima et al., 1999; Lee et al.,
2000). The isolated position of the NH (which incidentally explains its absence from many brain preparations)
and its atypical cellular composition could create special
environmental conditions that drive OPCs towards an
astroglial fate. Indeed, the NH is highly vascularized
and lacks a blood-brain barrier, meaning that serumderived factors necessary for the differentiation of OPCs
into astrocyte-like pituicytes might be available here
and not in the optic nerve. An alternative would be that
endothelial cells (Grinspan et al., 1987; Lillien and Raff,
1990; Mi et al., 2001) or unmyelinated axons could
directly induce pituicyte differentiation.
CONCLUSION
Overall, our results demonstrate in vivo the existence
of a lineage relationship between OPCs and pituicytes in
the NH. They also suggest that pituicytes constitute a
specialized subclass of oligodendroglia. Finally, our
study illustrates that, though glial cell lineages throughout the CNS share many key features, certain phenomena may be restricted to specific brain regions. Further
analyses are needed to identify what controls OPC differentiation in the developing NH.
ACKNOWLEDGMENTS
The authors are grateful to Dr. David H. Rowitch for
providing us with the olig1-cre/RosaLacZ animals and
for helpful comments on the manuscript. We thank Drs.
C. Henderson, J. Cohen, X. Morin, and M. Cayre for critically reading the manuscript, and Dr. G. Rougon for
constant support and input. We are indebted to G.
Monti, to K. Magalon, and to our institute technical services for their excellent technical assistance, especially
C. Moretti and the imaging service. Drs. R. Lu and B.
Zalc generously provided probe templates.
REFERENCES
Barres BA, Raff MC, Gaese F, Bartke I, Dechant G, Barde YA. 1994. A
crucial role for neurotrophin-3 in oligodendrocyte development. Nature 367:371–375.
Bonni A, Sun Y, Nadal-Vicens M, Bhatt A, Frank DA, Rozovsky I, Stahl
N, Yancopoulos GD, Greenberg ME. 1997. Regulation of gliogenesis
OPCS GENERATE PITUICYTES IN VIVO
in the central nervous system by the JAK-STAT signaling pathway.
Science 278:477–483.
Bucy P. 1932. The hypophysis cerebri. In: W. Penfield, editor. Cytology
and cellular pathology of the nervous system. Vol. II. New York: Paul
B. Hoeber. p 707–738.
Capela A, Temple S. 2002. LeX/ssea-1 is expressed by adult mouse CNS
stem cells, identifying them as nonependymal. Neuron 35:865–875.
Cocchia D, Miani N. 1980. Immunocytochemical localization of the
brain-specific S-100 protein in the pituitary gland of adult rat. J Neurocytol 9:771–782.
Fellin T, Carmignoto G. 2004. Neurone-to-astrocyte signalling in
the brain represents a distinct multifunctional unit. J Physiol 559:3–
15.
Franklin RJ. 2002. Remyelination of the demyelinated CNS: the case
for and against transplantation of central, peripheral and olfactory
glia. Brain Res Bull 57:827–832.
Franklin RJ, Blakemore WF. 1995. Glial-cell transplantation and plasticity in the O-2A lineage: implications for CNS repair. Trends Neurosci 18:151–156.
Fulton BP, Burne JF, Raff MC. 1991. Glial cells in the rat optic nerve.
The search for the type-2 astrocyte. Ann NY Acad Sci 633:27–34.
Fulton BP, Burne JF, Raff MC. 1992. Visualization of O-2A progenitor
cells in developing and adult rat optic nerve by quisqualate-stimulated cobalt uptake. J Neurosci 12:4816–4833.
Gabay L, Lowell S, Rubin LL, Anderson DJ. 2003. Deregulation of dorsoventral patterning by FGF confers trilineage differentiation capacity on CNS stem cells in vitro. Neuron 40:485–99.
Galabov P, Schiebler TH. 1978. The ultrastructure of the developing
neural lobe. Cell Tissue Res 189:313–329.
Grinspan JB, Lieb M, Stern J, Rupnick M, Williams S, Pleasure D.
1987. Rat brain microvessel extracellular matrix modulates the phenotype of cultured rat type 1 astroglia. Brain Res 430:291–295.
Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A. 1998.
Generating green fluorescent mice by germline transmission of green
fluorescent ES cells. Mech Dev 76:79–90.
Hall A, Giese NA, Richardson WD. 1996. Spinal cord oligodendrocytes
develop from ventrally derived progenitor cells that express PDGF
alpha-receptors. Development 122:4085–4094.
Hatton GI. 1990. Emerging concepts of structure-function dynamics in
adult brain: the hypothalamo-neurohypophysial system. Prog Neurobiol 34:437–504.
Hirrlinger J, Hulsmann S, Kirchhoff F. 2004. Astroglial processes show
spontaneous motility at active synaptic terminals in situ. Eur J Neurosci 20:2235–2239.
Ingraham CA, Rising LJ, Morihisa JM. 1999. Development of O41/O12
immunopanned pro-oligodendroglia in vitro. Brain Res Dev Brain
Res 112:79–87.
Johe KK, Hazel TG, Muller T, Dugich-Djordjevic MM, McKay RD.
1996. Single factors direct the differentiation of stem cells from the
fetal and adult central nervous system. Genes Dev 10:3129–3140.
Kondo T, Raff MC. 2004. A role for Noggin in the development of oligodendrocyte precursor cells. Dev Biol 267:242–251.
Kuhlbrodt K, Herbarth B, Sock E, Hermans-Borgmeyer I, Wegner M.
1998. Sox10, a novel transcriptional modulator in glial cells. J Neurosci 18:237–250.
Lachapelle F, Gumpel M, Baulac M, Jacque C, Duc P, Baumann N.
1983– 1984. Transplantation of CNS fragments into the brain of shiverer mutant mice: extensive myelination by implanted oligodendrocytes. I. Immunohistochemical studies. Dev Neurosci 6:325–334.
Lee JC, Mayer-Proschel M, Rao MS. 2000. Gliogenesis in the central
nervous system. Glia 30:105–121.
Lillien LE, Raff MC. 1990. Analysis of the cell-cell interactions that
control type-2 astrocyte development in vitro. Neuron 4:525–534.
Liu Y, Rao MS. 2004a. Glial progenitors in the CNS and possible lineage relationships among them. Biol Cell 96:279–290.
Liu Y, Rao MS. 2004b. Olig genes are expressed in a heterogeneous
population of precursor cells in the developing spinal cord. Glia
45:67–74.
Liu Y, Wu Y, Lee JC, Xue H, Pevny LH, Kaprielian Z, Rao MS. 2002.
Oligodendrocyte and astrocyte development in rodents: an in situ and
immunohistological analysis during embryonic development. Glia
40:25–43.
Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP,
Stiles CD, Rowitch DH. 2000. Sonic hedgehog-regulated oligodendrocyte lineage genes encoding bHLH proteins in the mammalian central nervous system. Neuron 25:317–329.
Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH. 2002.
Common developmental requirement for Olig function indicates a
motor neuron/oligodendrocyte connection. Cell 109:75–86.
Marin F, Boya J, Lopez-Carbonell A. 1989. Immunocytochemical localization of vimentin in the posterior lobe of the cat, rabbit and rat
pituitary glands. Acta Anat 134:184–190.
303
McKinnon RD, Matsui T, Dubois-Dalcq M, Aaronson SA. 1990. FGF
modulates the PDGF-driven pathway of oligodendrocyte development.
Neuron 5:603–614.
Mi H, Haeberle H, Barres BA. 2001. Induction of astrocyte differentiation by endothelial cells. J Neurosci 21:1538–1547.
Mudhar HS, Pollock RA, Wang C, Stiles CD, Richardson WD. 1993.
PDGF and its receptors in the developing rodent retina and optic
nerve. Development 118:539–552.
Nakashima K, Yanagisawa M, Arakawa H, Taga T. 1999. Astrocyte differentiation mediated by LIF in cooperation with BMP2. FEBS Lett
457:43–46.
Nishiyama A, Lin XH, Giese N, Heldin CH, Stallcup WB. 1996. Co-localization of NG2 proteoglycan and PDGF alpha-receptor on O2A progenitor cells in the developing rat brain. J Neurosci Res 43:299–314.
Noble M, Wolswijk G. 1992. Development and regeneration in the O-2A
lineage: studies in vitro and in vivo. J Neuroimmunol 40:287–293.
Noble M, Proschel C, Mayer-Proschel M. 2004. Getting a GRiP on oligodendrocyte development. Dev Biol 265:33–52.
Peyron F, Timsit S, Thomas JL, Kagawa T, Ikenaka K, Zalc B. 1997. In
situ expression of PLP/DM-20, MBP, and CNP during embryonic and
postnatal development of the jimpy mutant and of transgenic mice
overexpressing PLP. J Neurosci Res 50:190–201.
Qi Y, Cai J, Wu Y, Wu R, Lee J, Fu H, Rao M, Sussel L, Rubenstein J,
Qiu M. 2001. Control of oligodendrocyte differentiation by the Nkx2.2
homeodomain transcription factor. Development. 128:2723–2733.
Raff MC, Miller RH, Noble M. 1983. A glial progenitor cell that develops in vitro into an astrocyte or an oligodendrocyte depending on culture medium. Nature 303:390–396.
Rowitch DH. 2004. Glial specification in the vertebrate neural tube.
Nat Rev Neurosci 5:409–419.
Salm AK, Hatton GI, Nilaver G. 1982. Immunoreactive glial fibrillary
acidic protein in pituicytes of the rat neurohypophysis. Brain Res
236:471–476.
Skoff RP. 1990. Gliogenesis in rat optic nerve: astrocytes are generated
in a single wave before oligodendrocytes. Dev Biol 139:149–168.
Small RK, Riddle P, Noble M. 1987 Evidence for migration of oligodendrocyte-type-2 astrocyte progenitor cells into the developing rat optic
nerve. Nature 328:155–157.
Soriano P. 1999. Generalized lacZ expression with the ROSA26 Cre
reporter strain. Nat Genet 21:70–71.
Spassky N, Goujet-Zalc C, Parmantier E, Olivier C, Martinez S, Ivanova A, Ikenaka K, Macklin W, Cerruti I, Zalc B, Thomas JL. 1998.
Multiple restricted origin of oligodendrocytes. J Neurosci 18:8331–
8343.
Spassky N, Olivier C, Cobos I, LeBras B, Goujet-Zalc C, Martinez S,
Zalc B, Thomas JL. 2001. The early steps of oligodendrogenesis:
insights from the study of the plp lineage in the brain of chicks and
rodents. Dev Neurosci 23:318–326.
Theodosis DT. 2002. Oxytocin-secreting neurons: a physiological model
of morphological neuronal and glial plasticity in the adult hypothalamus. Front Neuroendocrinol 23:101–135.
Theodosis DT, Rougon G, Poulain DA. 1991. Retention of embryonic
features by an adult neuronal system capable of plasticity: polysialylated neural cell adhesion molecule in the hypothalamo-neurohypophysial system. Proc Natl Acad Sci USA 88:5494–5498.
Tiveron MC, Hirsch MR, Brunet JF. 1996. The expression pattern of
the transcription factor Phox2 delineates synaptic pathways of the
autonomic nervous system. J Neurosci 16:7649–7660.
Vallstedt A, Klos JM, Ericson J. 2005. Multiple dorsoventral origins of
oligodendrocyte generation in the spinal cord and hindbrain. Neuron
45:55–67.
Velasco ME, Roessmann U, Gambetti P. 1982. The presence of glial
fibrillary acidic protein in the human pituitary gland. J Neuropathol
Exp Neurol 41:150–163.
Wang C, Rougon G, Kiss JZ. 1994. Requirement of polysialic acid for
the migration of the O-2A glial progenitor cell from neurohypophyseal explants. J Neurosci 14:4446–4457.
Ware CB, Horowitz MC, Renshaw BR, Hunt JS, Liggitt D, Koblar SA,
Gliniak BC, McKenna HJ, Papayannopoulou T, Thoma B, et al. 1995.
Targeted disruption of the low-affinity leukemia inhibitory factor
receptor gene causes placental, skeletal, neural and metabolic defects
and results in perinatal death. Development 121:1283–1299.
Warrington AE, Barbarese E, Pfeiffer SE. 1993. Differential myelinogenic capacity of specific developmental stages of the oligodendrocyte
lineage upon transplantation into hypomyelinating hosts. J Neurosci
Res 34:1–13.
Zhou Q, Anderson DJ. 2002. The bHLH transcription factors OLIG2
and OLIG1 couple neuronal and glial subtype specification. Cell
109:61–73.
Zhou Q, Wang S, Anderson DJ. 2000. Identification of a novel family of
oligodendrocyte lineage-specific basic helix-loop-helix transcription
factors. Neuron 25:331–343.
B. Article 2 : Caractérisation de populations hétérogènes de
pituicytes et leur implication dans la gliogenèse induite par la
déshydratation dans la neurohypophyse de rat adulte (Virard et al.,
en préparation)
I. Approche expérimentale
Dans une deuxième partie de mon travail, présentée ci-dessous sous la forme d’un
article en préparation, j’ai souhaité poursuivre mon analyse de la NH chez l’adulte, dans le
but d’y rechercher la présence de cellules souches ou progénitrices. Ma précédente étude sur
le développement de la NH avait d’ailleurs suggéré que la NH adulte contenait des cellules
exprimant des marqueurs de progéniteurs gliaux, comme pdgfrα (Article 1, Figure 1). J’ai
donc réexaminé la diversité cellulaire dans la NH adulte par immunomarquage et hybridation
in situ. Les propriétés de migration, de prolifération et de différenciation des cellules de la NH
adulte ont ensuite été étudiées par des cultures d’explants et de neurosphères. Enfin, je me
suis intéressée à la réponse à la déshydratation des différentes populations cellulaires
identifiées dans la NH adulte : en marquant les cellules en division avec de la BrdU et avec un
anticorps anti-Ki67, un marqueur du cycle cellulaire, j’ai déterminé lesquelles prolifèrent en
temps normal et durant une stimulation.
II. Résumé des résultats
L’existence de sous-populations de pituicytes a été mise en évidence grâce à des
immunomarquages contre différents marqueurs gliaux (S100, vimentine, GFAP), qui ont
identifié S100 comme celui le plus largement exprimé. De plus, ces expériences ont révélé la
présence dans la NH adulte d’un type cellulaire exprimant le marqueur d’OPC pdgfrα, mais
pas d’autres marqueurs oligodendrocytaires (cnp2, Nkx2.2, olig1, olig2, Olig2, plp/dm20),
hormis rarement NG2. Ces cellules pdgfrα+ sont distinctes des pituicytes S100+ et
GFAP+ ainsi que des cellules des vaisseaux sanguins ILB4+.
Par ailleurs, des explants de NH adultes cultivés en présence de FGF-2, PDGF-AA et
NT3 ont généré de rares précurseurs A2B5+/O4+ qui ont migré hors des explants avant de se
différencier en oligodendrocytes matures GalC+ et MBP+. Cela démontre qu’il existe au sein
de la NH adulte des progéniteurs gliaux, ou alors des cellules souches capables de donner
naissance à des progéniteurs gliaux. Des tests de neurosphères ont ensuite permis de
distinguer entre ces possibilités. Les cellules de la NH dissociées ont pu générer des
neurosphères primaires, mais pas de neurosphères secondaires, ce qui suggère que la structure
54
contient des progéniteurs gliaux mais probablement pas des cellules souches neurales. Cette
idée est aussi renforcée par le fait que les neurosphères de NH adulte peuvent se différencier
en astrocytes GFAP+ et en oligodendrocytes O4+, mais pas en neurones ßIII-tubuline+, et ne
sont donc pas multipotentes.
Enfin, quand la NH est stimulée par déshydratation, on observe une augmentation de
la prolifération cellulaire, telle que mesurée par l’incorporation de BrdU ou par l’expression
de Ki67. Cette prolifération n’est pas accompagnée d’une hausse du nombre de cellules dans
la NH, sans doute parce qu’elle est compensée par une mort cellulaire accrue, comme en
témoigne un marquage TUNEL. Pour terminer, l’identification des cellules Ki67+ ou BrdU+
pendant la stimulation a démontré que l’augmentation de la prolifération concerne tous les
types de cellules gliales étudiés, notamment les cellules pdgfrα+.
Points-clés
-
Chez le rat adulte, les pituicytes n’expriment pas tous la même combinaison des
marqueurs gliaux vimentine, S100 et GFAP et il en existe une sous-population
distincte pdgfrα+.
-
Des explants de NH adulte peuvent générer des oligodendrocytes en culture alors
qu’in vivo, la NH ne contient pas d’oligodendrocytes.
-
Des cultures de neurosphères ont confirmé la présence de progéniteurs gliaux dans la
NH adulte mais pas celle de cellules souches neurales.
-
Au cours d’une déshydratation, on observe une prolifération cellulaire accrue dans les
différentes populations gliales de la NH, ainsi qu’une augmentation de la mort
cellulaire.
55
Title : Characterization of heterogeneous pituicyte populations involved in dehydrationinduced gliogenesis in the adult rat neurohypophysis.
Authors : Isabelle Virard, Olena Gubkina, Fabienne Alfonsi and Pascale Durbec.
Address : Institut de Biologie du Développement de Marseille-Luminy (IBDML) ; CNRS
UMR 6216 ; Campus de Luminy, case 907 ; 13288 Marseille Cedex 9 ; France.
Running title : Dehydration-induced glial proliferation.
Corresponding author: Dr Pascale DURBEC
Institut de Biologie du Développement de Marseille-Luminy (IBDML) ; CNRS UMR 6216 ;
Campus de Luminy, case 907 ; 13288 Marseille Cedex 9 ; France.
Phone number: 33-491 26 93 47
Fax number: 33-491 26 97 57
E-mail: [email protected]
Key Words : central nervous system, glial progenitors, stem cells, proliferation
1
ABSTRACT
The adult neurohypophysis (NH) is a well established site of central nervous system (CNS)
plasticity: its glial cells, the pituicytes, reorganize their structure and undergo increased
proliferation in response to stimulations such as dehydration. However, it remains to be
clarified whether the newly-formed cells derive from pituicytes re-entering the cell cycle or
from glial precursors or stem cells. Here, we first analyze the expression of several glial
markers in the adult rat NH and demonstrate that the pituicytes constitute a heterogeneous
population. In particular, we identify a distinct subtype of glial cells expressing the
oligodendrocyte precursor marker pdgfrα. In addition, adult NH explants can give rise to
migratory precursors able to differentiate into mature oligodendrocytes. This leads us to
hypothesize that the adult NH could contain immature cells, therefore we test for the presence
of stem or progenitor cells using a neurosphere-forming assay. Adult NH cells can generate
bipotent primary neurospheres but not secondary ones, suggesting that the structure contains
glial progenitors but probably not stem cells. Finally, when the NH is stimulated by
dehydration, we observe an increase in cell proliferation associated with an increase in cell
death. By identifying the cells incorporating bromodeoxyuridine (BrdU) or positive for Ki67,
we demonstrate that this increased proliferation concerns all glial cell types in the adult NH,
including the pdgfrα+ cells. Our study shows that the NH is a complex structure composed of
multiple glial subtypes, which all participate in the physiological response to dehydration.
2
INTRODUCTION
Brain plasticity refers to the structural and/or functional modifications that allow the brain to
adapt to external or internal changes, either in physiological or pathological conditions. It is
now clearly established that plasticity occurs in the adult mammal CNS (for a review, see
Lledo et al. 2006). For instance, the hypothalamo-neurohypophysial system, which secretes
oxytocin and vasopressin, shows remarkable plasticity in response to appropriate stimulation,
in particular in the posterior lobe of the pituitary (NH). During physiological stimulation, such
as dehydration, parturition and lactation, the NH undergoes an important structural
reorganization involving both neurons and glial cells, termed pituicytes (for a review see
Hatton 1997). Pituicytes are specialized glial cells expressing astrocyte markers such as
GFAP, vimentin and S100B (Cocchia and Miani 1980; Salm et al. 1982; Velasco et al. 1982;
Marin et al. 1989). In the resting state, the pituicytes enclose oxytocin- and vasopressinsecreting axons from hypothalamic neurons, while they release the engulfed neurosecretory
axons during prolonged physiological stimulation. This active retraction of pituicyte
processes allows a greater contact between the neurosecretory endings and blood vessels and
is thought to favor oxytocin and vasopressin secretion into the general circulation (Tweedle
and Hatton 1980; Hatton 1990). Furthermore, an earlier study showed that prolonged
dehydration induced by saline substitution of drinking water also results in an intense cell
proliferation in the adult NH (Murugaiyan and Salm 1995). However, from this report, it was
unclear whether the dividing cell population derives exclusively from pituicytes induced to reenter the cell cycle or from the stimulation of resident glial precursors or stem cells
maintained in a resting state under basal conditions.
Interestingly, we had previously demonstrated that, despite the complete absence of
oligodendrocytes in the adult rodent NH, oligodendrocyte precursor cells (OPCs) can be
identified in the developing structure. These OPCs generate pituicytes instead of myelinating
oligodendrocytes and some OPC markers are maintained in a cell population in the adult NH
3
(Virard et al. 2006). This observation highlighted the fact that, in the adult NH, the glial
population could be more heterogeneous than previously thought. Therefore, we wanted to
investigate further the cellular composition of the adult rat NH, to establish whether it
contains immature glial cells and/or stem cells and to determine how these cells participate in
the plasticity of the structure.
In this work, we used a variety of glial lineage markers to investigate the heterogeneity of NH
glial cells and analyzed how these populations respond to dehydration in terms of
proliferation.
MATERIALS AND METHODS
Animals
We used adult male Sprague-Dawley rats (IFFA CREDO, Saint-Germain-sur-l’Arbesle,
France). All procedures involving the use of animals were performed in accordance with the
European Community Council Directive of 24 November 1986 on the protection of animals
used for experimental purposes (86/609/EEC).
Neurohypophysial explant cultures
Solutions for cell culture were purchased from Gibco (Invitrogen, Cergy-Pontoise, France)
and other chemicals from Sigma (Saint-Quentin-Fallavier, France) if not stated otherwise.
Neurohypophysial culture was performed as described earlier (Wang et al. 1994; Virard et al.
2006). Briefly, pituitaries from adult rats were dissected in Hank’s Balanced Salt Solution
(HBSS). Meninges were stripped off and the neural lobes carefully separated from the
anterior and intermediate lobes. Each NH was sectioned into 4-6 pieces in Dulbecco’s
Modified Eagle’s Medium (DMEM) containing 10% fetal calf serum (FCS). The pieces were
then explanted in the presence of 0.4% methylcellulose onto poly-L-lysine-treated glass
coverslips and maintained in serum-free medium (DMEM-F12 complemented with 100 µg/ml
4
human transferrin, 5 µg/ml insulin, 100 µM putrescin, 20 nM progesterone, 30 nM sodium
selenite), supplemented with FGF-2 (10 ng/ml), PDGF-AA (10 ng/ml) and NT3 (10 ng/ml) as
indicated in the text. Cultures were incubated at 37°C in a 5% CO2 and 95% air atmosphere
and fed with fresh medium every 2-3 days.
Neurosphere cultures
To obtain primary neurospheres, five week-old rats were sacrificed by decapitation and their
brains and hypophyses were dissected out. Brains were sectioned into 400 µm thick slices
using a vibratome (Leica Microsystème, Rueil-Malmaison, France). The subventricular zone
(SVZ) from the wall of the anterior lateral ventricle horn was dissected in HBSS and cut into
100 µm diameter explants. NHs were dissected as described above and cut into 100 µm
diameter pieces. Both NH and SVZ fragments were dissociated mechanically after enzymatic
treatment (trypsin, 5mg/ml). After rinsing, the cells were plated at a concentration of 15.000
cells/ml and cultured in the serum-free medium described above, complemented with B-27
(1/50), FGF-2 (10 ng/ml) and EGF (10 ng/ml). The medium was changed every 2-3 days.
Secondary spheres were obtained by chemical (Accumax, Sigma) and mechanical
dissociation of primary neurospheres after 7 days in vitro and cultured in the same medium.
Direct counting of primary and secondary spheres was performed using a Leica DM IRB
inverted microscope after 7 and 14 days in vitro, respectively. The primary and secondary
sphere diameter was measured based on an image analysis approach using the ImageJ 1.33u
software (Wayne Rasband, NIH, USA). Primary sphere differentiation was induced by plating
the neurospheres on poly-L-lysine-coated coverslips in defined medium complemented with
0.3% FCS. Sphere multipotentiality was tested by immunofluorescence 5-7 days after plating.
5
Dehydration and BrdU incorporation experiments
For our dehydration experiments, six-week-old rats were maintained either with normal
drinking water (controls) or with a 2% NaCl solution (dehydrated) for either 5 or 9 days
(respectively termed 5D and 9D). After 9 days of dehydration, groups of rats were allowed a
rehydration period of 3 or 6 days (3R and 6R). At least 3 rats were used in each group.
Cumulative in vivo labeling of cell proliferation was performed by repetitive
bromodeoxyuridine (BrdU; Sigma) injections. A daily injection (50 mg/kg) of BrdU (10
mg/ml in phosphate-buffered saline (PBS), pH7.4) was given intraperitoneally during the
entire dehydration period. There were no BrdU injections during the rehydration period.
Tissue processing
Anesthetized rats were perfused with cold PBS followed by cold 4% paraformaldehyde (PF),
or a 3% PF solution containing sodium periodate and lysine monohydrochloride for optimal
staining with the OX42 antibody (McLean and Nakane 1974). Their pituitaries and brains
were post-fixed with 4% PF for 1-2 hours at 4°C, then cryoprotected with 20% sucrose,
included in OCT (Sakura Finetek, Bayer Diagnostic) and kept at -80°C until used. Cryostat
sections (12 µm) were collected on SuperFrost slides (VWR, Fontenay-sous-Bois, France).
In situ hybridization on sections
In situ hybridization was done as previously described (Virard et al. 2006) on adult rat brain
and NH cryosections using digoxigenin (DIG)-labeled antisense riboprobes for rat cnp2
(Gravel et al. 1994), olig1, olig2 (Lu et al. 2000), pdgfrα (Mudhar et al. 1993), or mouse
plp/dm20 (Peyron et al. 1997). To detect pdgfrα by fluorescent in situ hybridization, we used
an anti-DIG antibody coupled to horseradish peroxidase, then labeled it with a Tyramide
Signal Amplification (TSA) Plus Cyanine 3 kit (NEL744B001KT; Perkin-Elmer) according
to the manufacturer’s protocol (6 minute incubation in TSA).
6
Immunolabeling
We used the following primary antibodies and lectin: mouse A2B5, GalC and O4 (pure
supernatant ATCC, USA), mouse anti-BrdU (1/100, DAKO, France), mouse anti-MBP
(1/500, Euromedex), rabbit anti-Olig2 (1/20.000, after heat antigen retrieval, gift from D.
Rowitch), rabbit anti-NG2 (1/100, Chemicon), mouse anti-CD11b, clone OX42 (1/1000,
Cymbus Biotechnology, UK), mouse anti-GFAP (1/1000, Sigma), rabbit anti-GFAP (1/1000,
Sigma), isolectin B4 from Griffonia simplicifolia (ILB4, 1/100, Sigma), rabbit anti-Ki67
(1/400 after heat antigen retrieval, Abcam, UK), mouse anti-Nkx2.2 (1/800, Developmental
Studies Hybridoma Bank, USA), rabbit anti-S100 (1/300, Dako), mouse anti-S100B, clone
SHB1 (1/1000, Sigma), mouse anti-ßIII tubulin (Tuj1, 1/5000, Babco) and mouse antivimentin (1/200, Sigma).
For immunolabeling, the tissue sections were incubated overnight at 4°C in a primary
antibody solution containing 10% FCS, with 0.3% Triton-X100 for internal markers. The
sections were subsequently washed and incubated with the appropriate fluorescently-labeled
secondary antibodies (1/200; Jackson Immunoresearch Laboratories, West Grove, PA, USA)
for 1-2 hours at room temperature. In the case of ILB4, the sections were first rinsed twice
with PBlec (PBS 1% Triton-X100 with 0.1M CaCl2, 0.1M MgCl2, 0.1M MnCl2), then
incubated overnight with ILB4 1/100 in PBlec and washed. Finally, we detected the
biotinylated ILB4 using streptavidin coupled to either Texas Red or Oregon Green (Molecular
Probes, 1/1000 in saturation buffer). For immunostaining on explant and neurosphere
cultures, the cells were fixed with 4% PF for 10 minutes, rinsed, incubated in primary
antibodies for 30-60 minutes, rinsed again, and incubated for 1 hour in a secondary antibody
solution. Cell nuclei were stained with Hoechst 33342 (1/1000, Sigma).
For BrdU labeling, the sections were incubated for 15-30 minutes at 37°C in 2N HCl and
0.5% Triton-X100. After 3 washes in 0.1M sodium tetraborate, they were incubated overnight
with the anti-BrdU antibody at 4°C. After several washes, we covered the sections with a
7
biotinylated anti-mouse IgG antibody solution (1:200) for 5 hours, washed them, then
incubated them with Oregon Green-coupled streptavidin for 2 hours. In the case of BrdU
stainings combined with another immunolabeling, this other labeling was performed first,
then the tissues were fixed with 4% PF and we proceeded with the anti-BrdU protocol.
Cell apoptosis assay
Apoptotic
cells
were
identified
on
adult
rat
hypophysis
sections
by
TUNEL
immunohistochemistry using the ApopTag kit (QBiogene, France) according to the
manufacturer’s instructions.
Fluorescent microscopy, quantification and statistical analysis
Sections were examined using Zeiss confocal or ApoTome microscopes and cell counting was
done on digital pictures. The number of positive cells for a given marker was counted on at
least 3 randomly-chosen NH sections and compared to the total number of cells identified
with the nuclear marker.
To calculate surface areas, we used the Visiolab 2000 software (Biocom), the area of one field
being 250 µm2.
Counts are presented as mean ± standard error of the mean (s.e.m.).
We used the Sigma Stat software (SPSS, USA) to perform one-way ANOVA and t-tests in
order to determine the degree of significance of the difference between countings and
measurements. For neurosphere diameter comparison, a Kruskal-Wallis was used due to the
non normal distribution of our values. An asterisk indicates a significant difference (p < 0.05).
8
RESULTS
Glial cell diversity in the adult rat neurohypophysis
In order to clearly characterize the pituicyte population from the adult NH, we performed an
immunohistochemical analysis using different markers for the astroglial lineage, namely
GFAP, S100 and vimentin. GFAP+ cells could clearly be identified on sections of adult rat
NH as process-bearing cells (Fig. 1 A). Although GFAP is usually considered as the main
pituicyte marker, we observed that S100 was more widely expressed in rat pituicytes :
antibodies to GFAP (Fig. 1 A), S100 (Fig. 1 B) and vimentin (Fig. 1 C) labeled respectively
10±1%, 43±3% and 12±2% of the total cells within the structure. Using double
immunostaining and confocal analysis, we showed that 10±1% of the total population coexpressed S100 and GFAP (Fig. 1 D), 7±1% S100 and vimentin (Fig. 1 E), and 4±1% GFAP
and vimentin (Fig. 1 F).
In addition to pituicytes, it is well known that the NH contains blood vessels, onto which
terminate axons from hypothalamic nuclei. These vessels are made of numerous endothelial
cells as well as perivascular cells (fibroblasts, pericytes, microglia, mastocytes) (Paterson and
Leblond 1977). Most of these cells can be labeled using isolectin B4 (ILB4) (Laitinen 1987;
Streit and Kreutzberg 1987), which marks 23±1% of the total NH cells (Fig. 1 G). Microglia
represents about half of the ILB4+ cells, since the microglial marker OX42 labeled 9% of the
total NH cells (Fig. 1 H). We did not observe any cell co-labeled with ILB4 and pituicyte
markers S100 or GFAP (not shown).
Overall, our data showed that adult rat NH cells include approximately 43% S100+ pituicytes
and revealed heterogeneity within these cells, with subpopulations expressing various
combinations of astroglial markers (Fig. 1 M).
9
Fig. 1. Cell diversity in the adult rat NH.
A-F: Pituicyte subpopulations express heterogeneous combinations of the astroglial markers GFAP,
S100 and vimentin. The numbers indicate the percentage of the total NH cells immunopositive for
each marker (A-C) or pair of markers (D-F). Arrows point to doubly labeled cells. G,H: Blood vessel
cells stained with isolectin B4 (ILB4) represent 23% of the NH cells (G), including OX42+ microglia
(H). I-L: In situ hybridization with a pdgfrα probe identifies a new glial cell population (I) which
rarely coexpresses the OPC marker NG2 (J) and is distinct from S100+ pituicytes (K) and ILB4+
blood vessel cells (L). Small panels show enlargements of the boxed areas in J-L, with separate color
channels and a merged image. M: Recapitulative scheme of the different NH cell populations. Results
obtained with NG2 were not included due to localization of this marker on various cell populations.
Scale bars = 25 µm ; 10 µm in J-L insets.
10
Identification of pdgfrα-expressing cells in the adult NH
We recently showed that pituicytes derive from oligodendrocyte precursor cells (OPCs) and
that some OPC markers are expressed in the adult structure (Virard et al. 2006). In order to
uncover the identity of this cell population, we performed an analysis with markers of the
oligodendrocyte lineage.
As demonstrated before (Virard et al. 2006), immunofluorescence on sections using
antibodies against oligodendrocyte markers such as galactocerebroside (GalC) or myelin basic
protein (MBP) revealed no labeling in the NH (not shown), thus indicating the absence of
mature stages of the oligodendrocyte lineage. However, we detected the expression of NG2,
an integral membrane chondroitin sulfate proteoglycan expressed by early committed OPCs
(Nishiyama et al. 1997), in 19±1% of the adult NH cells (Fig. 1 J green). Double labeling
showed that the NG2+ cells were negative for vimentin, S100 and GFAP, but that about two
thirds were co-labeled with ILB4, indicating that they were blood vessel cells (not shown).
The pdgfrα transcript, another early OPC marker (Hall et al. 1996), was detected in numerous
cells scattered throughout the NH (Fig. 1 I), representing 6.2±0.4% of the total cells. These
pdgfrα+ cells are distinct from GFAP+ (not shown) or S100+ pituicytes (Fig. 1 K) and from
ILB4+ blood vessel cells (Fig. 1 L). Only occasionally did pdgfrα+ cells appear to express
NG2 (Fig. 1 J). No staining could be detected using other OPC markers, such as probes for
olig1, olig2, plp/dm20 or cnp2, or antibodies against Nkx2.2 or Olig2, whereas they stained
numerous cells in control tissues like the adult corpus callosum or the developing optic nerve
(not shown).
Overall, these results indicate that adult pituicytes include a separate subpopulation of cells
positive for the OPC marker pdgfrα (Fig. 1 M) but expressing no other oligodendrocyte
lineage marker.
11
Adult NH progenitors can generate oligodendrocytes in culture
We then wanted to determine the functional properties of the pdgfrα+ putative progenitors
found in the adult rat NH and therefore turned to in vitro assays. Unfortunately, due to the
lack of known cell surface markers resistant to the strong enzymatic treatment necessary to
dissociate adult NH tissues, it was not technically possible to isolate the various NH cell
populations to examine separately their differentiation potential. Therefore, we resorted to
using a cruder approach of adult NH explants to establish the functional characteristics of the
NH cells.
First, when NHs were dissected out and cultured in defined medium in the absence of any
trophic factor, no cellular migration was observed around the explants (not shown). Second,
when FGF-2, PDGF-AA and NT3, known to favor migration, proliferation and survival of
optic nerve OPCs (McKinnon et al. 1990; Barres et al. 1994), were added to the defined
medium, occasional cell migration was observed. After 3 to 8 days, rare motile cells with a
bipolar morphology (round cell bodies and two long processes) and positive for the OPC
marker A2B5 (Fig. 2 A) were seen around the explants. These cells were also immunopositive
for O4, a marker of early committed oligodendrocytes (Fig. 2 B). After 15 to 21 days, we
found scarce cells with the typical ramified morphology of mature oligodendrocytes,
expressing GalC (Fig. 2 C) and MBP (Fig. 2 D). Despite the presence of GFAP+ cells within
the explants, no GFAP or ßIII-tubulin labeling was ever observed around these explants,
indicating respectively the absence of astrocytes and of neuronal cells among the migrating
cells (not shown).
These results indicate that a progenitor cell population able to give rise to oligodendrocytes
persists in the adult NH. However, in their normal environment, these progenitors do not
naturally generate oligodendrocytes, since no myelin or mature oligodendrocyte marker can
be detected in the NH.
12
Fig. 2. Oligodendrocyte differentiation of adult NH-derived cells in vitro.
In the presence of FGF-2, PDGF-AA and NT3, rare bipolar cells exit adult rat NH explants. After 8
days, these cells express the oligodendrocyte lineage markers A2B5 (A) and O4 (B). After 15 days,
they are multipolar and immunopositive for GalC (C) and MBP (D), indicating their differentiation
into mature oligodendrocytes. Scale bars = 58 µm.
Adult NH cells can generate primary but not secondary neurospheres
The oligodendrocytes generated in our in vitro assays could actually derive from neural stem
cells (NSCs) or multipotent progenitors. To determine whether the NH contains such cells, we
examined the neurosphere-forming potential of NH cells. Indeed, testing the ability to form
neurospheres is widely used to demonstrate the presence of NSCs in the central nervous
system (Reynolds and Weiss 1992; Weiss et al. 1996). Thus, we dissociated the NHs from
adult rats and put them in culture at a low density. In parallel, as a positive control for culture
conditions, we also plated SVZ cells from the same rats. Primary neurospheres were
generated from cells from both tissues (Fig. 3 A,B), indicating that the adult NH contains
progenitors capable of proliferation. However, the NH cells gave rise to a much smaller
number of primary spheres (Fig. 3 E): 21±3 per 10.000 plated cells compared to 160±2 for the
SVZ after 7 days in culture. Also, the NH spheres were slightly smaller, with an average
diameter of 42±1 µm instead of 58±1 µm (Fig. 3 F, p=0.001). In addition, when we
dissociated the primary spheres, we were able to obtain secondary neurospheres only from
SVZ cells, not from NH cells (Fig. 3 C,D).
Primary spheres were allowed to differentiate and multipotentiality was tested by triple
immunofluorescence 5-7 days after plating (Fig. 3 G,H). As expected, all SVZ-derivedneurospheres gave rise to GFAP+ astrocytes, O4+ oligodendrocytes and ßIII tubulin+
13
neuronal cells (Fig. 3 G). In comparison, NH-derived spheres only generated GFAP+
astrocytes and O4+ oligodendrocytes (Fig. 3 H).
Therefore, the NH contains progenitors that differ from SVZ stem cells in their limited
capacity to self-renew and their ability to generate only glial cells.
Fig. 3. Neurosphere-forming potential of adult NH cells compared to SVZ cells.
A-D: Primary neurospheres from adult rat SVZ (A) and NH (B) cells. Dissociated SVZ neurospheres
give rise to secondary neurospheres (C) but NH neurospheres do not (D). Though plated in the same
conditions, the NH primary spheres are much less numerous (E) and slightly smaller (F) than SVZderived spheres. Cells from adult rat SVZ (G) and NH (H) primary neurospheres were allowed to
differentiate for 6 days and tested for their expression of GFAP (turquoise), ßIII-tubulin (red) and O4
(green). Scale bars = 100 µm in A-D; 25 µm in G,H.
14
All glial cell types examined participate in dehydration-induced proliferation
Having identified different cell subtypes in the adult NH, we were highly interested in
understanding how these cell populations react to a physiological stimulation of the structure.
A way to stimulate the NH is a prolonged dehydration, which induces a strong proliferation in
NH cells (Paterson and Leblond 1977; Kawamoto and Kawashima 1984; Murugaiyan and
Salm 1995). Therefore, we submitted adult rats to dehydration by saline substitution of their
drinking water.
In a first set of experiments, we wanted to study how NH cells globally respond to stimulation
over a dehydration-rehydration period in terms of proliferation and cell death. Control or 9
day-dehydrated adult rats received daily BrdU injections during the dehydration period. We
monitored cell proliferation by counting BrdU+ cells either at the end of dehydration (9D) or
after a rehydration period of 3 (3R) or 6 (6R) days. We observed that cell proliferation was
increased in the NH, relative to paired controls : the density of BrdU+ cells was considerably
increased in dehydrated animals compared to controls (Fig. 4 A,B). Indeed, after 9 days of
dehydration, 29.4±2% of the NH cells were BrdU+ compared to 11.2±0.7% in the control
situation (Fig. 4 C). Cell proliferation persisted during the rehydration period (Fig. 4 C) : the
proportion of BrdU+ cells was 40.9±0.9% after 3 days of rehydration compared to 11.4% in
controls. The subsequent decrease in the number of BrdU+ cells observed during rehydration
can be explained by a persistence of proliferation that causes BrdU dilution among the
progeny of dividing cells. To verify this hypothesis, we used Ki67 as a marker for cells
undergoing cell cycle during the dehydration period, at the end of dehydration, and during
rehydration. The anti-Ki67 antibody labeled 2.4 ± 0.4% of the total NH cells in control rats
compared to 8.5±0.9%, 9.4±1.1% and 6.9±1.4% in dehydrated rats after 5 days of dehydration
(5D), 9 days of dehydration (9D) and 3 days of rehydration (3R), respectively (not shown).
Therefore, proliferation is elevated and concerns a constant proportion of NH cells over the
15
dehydration-rehydration stimulation. This is in agreement with a dilution of BrdU at 6 days of
rehydration.
Although stimulating the NH induced a strong proliferative response, we did not observe any
increase in the size of the NH (Fig. 4 D), nor in its cell density (Fig. 4 E). Thus, increased cell
proliferation is not associated with a concomitant detectable increase in the total cell number.
Consequently, we hypothesized that there must be an augmentation of cell death. Indeed, we
could observe a peak in cell apoptosis in rat NH during rehydration, as monitored by TUNEL
staining (Fig. 4 F).
Fig. 4. BrdU incorporation, NH size, cell density and apoptosis
during dehydration and rehydration.
A-B: An anti-BrdU staining illustrates that NH cells proliferate at a basal level in control NH (A) that
is greatly increased after 9 days of dehydration (B). C: When BrdU is incorporated during 9 days of
dehydration (9D), the number of BrdU+ cells is approximately tripled in the NH. It increases further
after 3 days of rehydration (3R) and starts decreasing but remains elevated after 6 days (6R). D-E: At
either 9D, 3R or 6R, there is no significant change in the size (D) or cell density (E) of any of the
hypophysis lobes (NH: neurohypophysis; IL: intermediate lobe; AH: adenohypophysis). F: TUNEL
assays indicate that there is increased cell death in the NH after dehydration. Scale bar = 500 µm.
16
Our next objective was to determine how the different cell subpopulations of the adult NH
respond to dehydration, in particular the S100+ and GFAP+ pituicyte subpopulations, the
ILB4+ blood vessel cells and the newly identified pdgfrα+ glial cells. We chose to study
them after 3 days of rehydration (3R) since it is the time point at which we observed the
largest numbers of BrdU+ cells (Fig. 4 C) and TUNEL-stained cells (Fig. 4 F). First, by
counting the number of cells positive for either S100, GFAP, ILB4 or pdgfrα, we could not
detect any difference between control and stimulated rats (Fig. 5 A). Then, double stainings
were used to determine the phenotype of the BrdU+ cells (Fig. 5 B,D). Among the S100+
pituicytes, BrdU+ cells represented 1.4±0.4% of the cells in controls and 20.3±5.7% in 3R
rats (Fig. 5 C,D). Within the GFAP+ pituicyte population, BrdU stained 1.3±0.3% and
9.0±1.8% of cells in controls and 3R animals respectively (Fig. 5 D). BrdU was incorporated
in 5.3±0.7% of the pdgfrα+ glial cells in controls, versus 11.8±2.8% in rehydrated rats (Fig. 5
B,D). Overall, in rats rehydrated for 3 days, there was a significantly larger number of BrdU+
cells among each of the three glial subpopulations we examined. Concerning the ILB4+ blood
vessel cells, 4.8±1.4% of them presented detectable levels of BrdU in controls and 9.0±1.5%
in stimulated rats but this difference was not significant (Fig. 5 D).
Finally, because cumulative BrdU incorporation cannot be used to determine which cells
undergo division, we sought to examine the phenotype of the Ki67+ cells during (5D) and at
the end (9D) of dehydration, as well as during rehydration (3R). Among the Ki67+ positive
cells, we observed only a small number of cells also positive for glial cell markers. This
precluded any reliable quantification and statistical analyses. Nevertheless, among the Ki67+
cells, pdgfrα+, GFAP+ and S100+ cells were found at each time point analyzed (Fig.5 E,F
and data not shown). This indicates that all glial subpopulations self-renew during
dehydration and rehydration, as well as in control conditions.
17
Fig. 5. Cell subtype proportions, BrdU incorporation
and Ki67 expression after NH stimulation.
A: At 3R, the proportions of cells expressing pdgfrα, S100, GFAP or ILB4 are not affected by
dehydration. B,C: BrdU is detected in different cell subpopulations, including pdgfrα+ cells (B) and
S100+ pituicytes (C). D: All four cell subtypes examined show increased BrdU incorporation at 3R.
E,F: At each time point (here at 5D), the cell cycle marker Ki67 can be detected in cells of all
examined subpopulations, for instance in pdgfrα+ (E) and GFAP+ (F) cells. Small panels are
enlargements of the boxed areas, with separate color channels and a merged image. Scale bars = 25
µm; 10 µm in insets.
18
Our finding suggests that stimulation of the NH leads to the division of all resident glial cell
populations, including the pdgfrα+ cells, which are quiescent or slowly proliferating in
normally-hydrated animals.
DISCUSSION
In the present study, we established that the pituicyte population is heterogeneous based on
the expression of the glial markers S100, GFAP and vimentin, and we identified a separate
cell type expressing pdgfrα. Using in vitro assays, we showed that the adult NH contains glial
progenitors capable of differentiating into oligodendrocytes and/or astrocytes but that the
structure does not harbor neural stem cells. Finally, in response to prolonged dehydration,
increased proliferation was observed in all the different glial cell populations we had
identified in the adult NH.
Pituicyte heterogeneity
Our work demonstrates that the glial cells present in the adult NH do not all express the same
combination of astrocyte markers (Fig. 1) : pituicytes express S100 but only fractions of them
co-express vimentin or GFAP. Pituicyte heterogeneity had already been reported based on
morphological criteria in earlier electron and conventional light microscopy studies (Bucy
1932; Dellmann and Owsley 1969; Takei et al. 1980). However, these results were variable
and several studies described only one type of pituicytes, especially in rodents ( Krsulovic and
Bruckner 1969; Galabov and Schiebler 1978). Also, since pituicytes are known to undergo
morphologic changes during NH stimulation, it could not be excluded that this heterogeneity
was linked to simple shape differences. Here, we clearly established based on marker
expression that pituicytes are heterogeneous in the resting state and that this heterogeneity is
maintained during stimulation : the relative proportions of cells expressing different glial
markers do not change after dehydration (Fig. 5 A). An interesting possibility would be that
19
these glial subpopulations could constitute maturation stages of a single pituicyte lineage. It
has already been suggested that the low expression of intermediate filaments (GFAP,
vimentin) in pituicytes compared to astrocytes could be linked to their morphological
plasticity (Miyata and Hatton 2002). Therefore, vimentin+ or GFAP+ pituicytes could
represent less plastic, more mature pituicytes while those expressing only S100 could be more
plastic cells.
We also identified a distinct subpopulation of cells expressing pdgfrα, with an unusual
identity. Indeed, pdgfrα+ cells, often called synantocytes or adult OPCs, are present in other
regions of the adult CNS (Dawson et al. 2000; Butt et al. 2002) but they express markers
which are not found in the adult NH pdgfrα+ cells. In particular, pdgfrα and NG2 are almost
never co-expressed in the NH (Fig. 1 J) whereas NG2 is expressed in the majority of pdgfrα+
cells in the adult brain (Nishiyama et al. 1999). Also, a recent study on adult OPCs in the
mouse spinal cord indicates that the oligodendrocyte lineage marker Olig2 is detected in a
great majority of NG2+ cells (Kitada and Rowitch 2006), while we cannot observe any
staining in the adult NH using the same antibody (data not shown). Likewise, no staining
could be detected in the adult NH using other OPC markers, namely olig1, plp/dm20, cnp2, or
Nkx2.2 (not shown). Although some heterogeneity has been reported in the expression of
certain markers in adult OPCs (Horner et al. 2002; Polito and Reynolds 2005), our results
suggest that the pdgfrα+ cells in the adult NH are radically different from most NG2+ adult
OPCs. Yet, these pdgfrα+ cells are not blood vessel cells (Fig. 1 L), and we consider them as
glial cells of the NH. In other words, we believe that the pdgfrα+ cells are a distinct subgroup
within the heterogeneous pituicyte population.
In vitro characteristics of progenitors in the adult NH
Our explant experiments show that adult NH cells can give rise to rare A2B5+ precursors that
later differentiate into myelinating MBP+ oligodendrocytes (Fig. 2). In addition, these cells
20
only migrate out of NH explants when put in the presence of trophic factors known to favor
OPC motility (McKinnon et al. 1990; Barres et al. 1994). Therefore, the adult NH explants
have the potential to generate cells which share some important functional properties with
OPCs. Moreover, we were able to grow primary neurospheres from adult NH cells and these
spheres differentiated exclusively into astrocytes and oligodendrocytes, which confirms the
presence of glial progenitors (Fig. 3). Furthermore, the inability to form secondary spheres
and the fact that the sphere-forming cells in the adult NH are not multipotential point to the
absence of neural stem cells in the structure.
However, there remains the question of the identity of the glial precursors in vivo.
Unfortunately, the very small number of progenitors present in the adult NH and the absence
of adequate cell surface markers preclude any cell sorting analysis which could give more
insight into the identity of the NH progenitors. We can nevertheless put forward the
hypothesis that the glial NH progenitors could be the pdgfrα+ cells. They do not express most
classical adult OPC markers but this could be due to specific environmental cues present in
the NH which could downregulate oligodendrocyte lineage markers and thus prevent
oligodendrocyte differentiation, similar to what is thought to occur during NH development
(Virard et al. 2006).
Glial cell division in the stimulated adult NH
Next, we sought to determine how the different NH cell populations respond to stimulation by
dehydration in terms of proliferation. We first noticed that the number of BrdU+ cells greatly
increased after dehydration, with a peak after 9 days of dehydration followed by 3 days of
rehydration (3R; Fig. 4 C), consistent with a previous report (Murugaiyan and Salm 1995).
The subsequent decrease is most likely due to BrdU dilution, since at 3 days of rehydration
(3R), the cell cycle marker Ki67 still labels the same proportion of cells than at 5 and 9 days
of dehydration (5D and 9D). Nonetheless, we cannot completely exclude the possibility that
21
some BrdU+ cells disappear as a result of cell death (see below).
Our BrdU incorporation experiments also show that, after 9 days of dehydration followed by
3 days of rehydration (3R), BrdU is detectable in a larger proportion of each glial cell
population (pdgfrα+, S100+ and GFAP+ cells) (Fig. 5 D). This indicates that all these cell
types participate in the dehydration-induced increase in gliogenesis. Of course, one must bear
in mind that the BrdU has accumulated over the entire dehydration period. Therefore if, for
example, a S100+ pituicyte is labeled with BrdU (Fig. 5 C), it can either mean that a S100+
cell has undergone cell cycle or that a S100- precursor has divided and differentiated into a
S100+ cell. However, the experiments using Ki67 seem to indicate that all cell types can
proliferate. Incidentally, we have previously shown that, during development, S100+
pituicytes derive from olig1+ OPCs, which also express pdgfrα. We can then hypothesize that
the pdgfrα+ cells present in the adult NH could be part of the pituicyte lineage and represent
progenitors maintained with the purpose of generating new pituicytes. This would be a
similitude with neurogenic areas, in which stem or progenitor cell populations participate in
cell renewal. In the hippocampus for example, neuronal progenitors with limited self-renewal
capacity locally proliferate and differentiate into postmitotic granule neurons of the dentate
gyrus, as can be monitored by BrdU incorporation coupled to immunocytochemical staining
with neuronal lineage markers (Kuhn et al. 1996). In the NH, many of the newly-formed cells
are glial cells that can continue dividing even in basal conditions (Fig. 5 D), therefore it is not
possible to use BrdU in order to identify the progenitor cells and to trace their progeny:
BrdU+ cells would not necessarily be progenitors and, conversely, newly-formed cells could
be BrdU- because of BrdU dilution. Still, we can postulate that the various pituicyte
subpopulations we have identified could represent different maturation stages of the pituicyte
lineage and thus be a sign of constant cell renewal in the mature NH. In order to undoubtedly
demonstrate a lineage relationship from pdgfrα+ to S100+ cells, further studies are needed
using for instance a genetic approach to follow the fate of the adult pdgfrα+ cells.
22
Cell number regulation during NH stimulation
A remarkable feature of CNS regions where neural progenitors or stem cells generate new
cells is the regulation of cell number (Biebl et al. 2000). For example, stem cells in the wellstudied SVZ constantly give rise to neuroblasts that migrate to the olfactory bulb, where they
differentiate into new interneurons, and this adult neurogenesis is at least partly compensated
for by cell death, including apoptosis of newly-generated neurons (Winner et al. 2002). Here
we showed that there is no apparent change in either the NH size or cell density (Fig. 4 D,E)
over stimulation, thus the increased proliferation is not linked with a concomitant increase in
the total NH cell number. We showed that NH cells are eliminated over the time course of
stimulation by an increase in apoptosis (Fig. 4F). To our knowledge, this is the first
demonstration that there is a balance between newly-formed NH cells and cell death in
response to physiological stimulation in the NH. In the case of the NH, cell death could affect
young pituicytes or there could be a preferential elimination of more mature pituicytes that are
possibly less plastic in terms of process retraction.
CONCLUSION
In summary, our study demonstrates that the NH glial cell population is more complex than
expected, comprising multiple cell subtypes that are all involved in the NH response to
dehydration. In particular, it reveals the presence of pdgfrα+ cells, which do not express the
same combination of markers as other pdgfrα+ cells in the rest of the CNS. Their relationship
with other pituicytes remains a matter of debate that will need to be examined using genetic
tools.
23
ACKNOWLEDGEMENTS
The authors are grateful to G. Monti for her expert assistance with the cultures; to Drs. B.
Zalc and R. Lu for providing probe templates; to Dr. D. Rowitch for the anti-Olig2 antibody;
and to all lab members for constant input and helpful comments on the manuscript.
This work was supported by a grant from the INSERM Stem Cell Network and by
fellowships to I.V. from the Fondation Recherche Médicale (FRM) and to F.A. from the
Association Française contre les Myopathies (AFM).
REFERENCES
Barres BA, Raff MC, Gaese F, Bartke I, Dechant G, Barde YA. 1994. A crucial role for
neurotrophin-3 in oligodendrocyte development. Nature 367(6461):371-5.
Biebl M, Cooper CM, Winkler J, Kuhn HG. 2000. Analysis of neurogenesis and programmed
cell death reveals a self-renewing capacity in the adult rat brain. Neurosci Lett
291(1):17-20.
Bucy P. 1932. The hypophysis cerebri. In: Penfield W, editor. Cytology and cellular
Pathology of the nervous system. New York: Paul B. Horber Inc. p 707-38.
Butt AM, Kiff J, Hubbard P, Berry M. 2002. Synantocytes: new functions for novel NG2
expressing glia. J Neurocytol 31(6-7):551-65.
Cocchia D, Miani N. 1980. Immunocytochemical localization of the brain-specific S-100
protein in the pituitary gland of adult rat. J Neurocytol 9(6):771-82.
Dawson MR, Levine JM, Reynolds R. 2000. NG2-expressing cells in the central nervous
system: are they oligodendroglial progenitors? J Neurosci Res 61(5):471-9.
Dellmann HD, Owsley PA. 1969. Investigations on the hypothalamo-neurohypophysial
neurosecretory system of the grass frog (Rana pipiens) after transection of the
proximal neurohypophysis. II. Light- and electron microscopic findings in the
disconnected distal neurohypophysis with special emphasis on the pituicytes. Z
Zellforsch Mikrosk Anat 94(3):325-36.
Galabov P, Schiebler TH. 1978. The ultrastructure of the developing neural lobe. Cell Tissue
Res 189(2):313-29.
Gravel M, DeAngelis D, Braun PE. 1994. Molecular cloning and characterization of rat brain
2',3'-cyclic nucleotide 3'-phosphodiesterase isoform 2. J Neurosci Res 38(3):243-7.
Hall A, Giese NA, Richardson WD. 1996. Spinal cord oligodendrocytes develop from
ventrally derived progenitor cells that express PDGF alpha-receptors. Development
122(12):4085-94.
24
Hatton GI. 1990. Emerging concepts of structure-function dynamics in adult brain: the
hypothalamo-neurohypophysial system. Prog Neurobiol 34(6):437-504.
Hatton GI. 1997. Function-related plasticity in hypothalamus. Annu Rev Neurosci 20:375-97.
Horner PJ, Thallmair M, Gage FH. 2002. Defining the NG2-expressing cell of the adult CNS.
J Neurocytol 31(6-7):469-80.
Kawamoto K, Kawashima S. 1984. Ultrastructural changes and proliferation of pituicytes in
mouse posterior lobe during water deprivation and rehydration. Acta Anat (Basel)
119(3):136-41.
Kitada M, Rowitch DH. 2006. Transcription factor co-expression patterns indicate
heterogeneity of oligodendroglial subpopulations in adult spinal cord. Glia 54(1):3546.
Krsulovic J, Bruckner G. 1969. Morphological characteristics of pituicytes in different
functional stages. Light- and electronmicroscopy of the neurohypophysis of the albino
rat. Z Zellforsch Mikrosk Anat 99(2):210-20.
Kuhn HG, Dickinson-Anson H, Gage FH. 1996. Neurogenesis in the dentate gyrus of the
adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci
16(6):2027-33.
Laitinen L. 1987. Griffonia simplicifolia lectins bind specifically to endothelial cells and
some epithelial cells in mouse tissues. Histochem J 19(4):225-34.
Lledo PM, Alonso M, Grubb MS. 2006. Adult neurogenesis and functional plasticity in
neuronal circuits. Nat Rev Neurosci 7(3):179-93.
Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP, Stiles CD, Rowitch
DH. 2000. Sonic hedgehog--regulated oligodendrocyte lineage genes encoding bHLH
proteins in the mammalian central nervous system. Neuron 25(2):317-29.
Marin F, Boya J, Lopez-Carbonell A. 1989. Immunocytochemical localization of vimentin in
the posterior lobe of the cat, rabbit and rat pituitary glands. Acta Anat 134(3):184-90.
McKinnon RD, Matsui T, Dubois-Dalcq M, Aaronson SA. 1990. FGF modulates the PDGFdriven pathway of oligodendrocyte development. Neuron 5(5):603-14.
McLean IW, Nakane PK. 1974. Periodate-lysine-paraformaldehyde fixative. A new fixation
for immunoelectron microscopy. J Histochem Cytochem 22(12):1077-83.
Miyata S, Hatton GI. 2002. Activity-related, dynamic neuron-glial interactions in the
hypothalamo-neurohypophysial system. Microsc Res Tech 56(2):143-57.
Mudhar HS, Pollock RA, Wang C, Stiles CD, Richardson WD. 1993. PDGF and its receptors
in the developing rodent retina and optic nerve. Development 118(2):539-52.
Murugaiyan P, Salm AK. 1995. Dehydration-induced proliferation of identified pituicytes in
fully adult rats. Glia 15(1):65-76.
25
Nishiyama A, Chang A, Trapp BD. 1999. NG2+ glial cells: a novel glial cell population in the
adult brain. J Neuropathol Exp Neurol 58(11):1113-24.
Nishiyama A, Yu M, Drazba JA, Tuohy VK. 1997. Normal and reactive NG2+ glial cells are
distinct from resting and activated microglia. J Neurosci Res 48(4):299-312.
Paterson JA, Leblond CP. 1977. Increased proliferation of neuroglia and endothelial cells in
the supraoptic nucleus and hypophysial neural lobe of young rats drinking hypertonic
sodium chloride solution. J Comp Neurol 175(4):373-90.
Peyron F, Timsit S, Thomas JL, Kagawa T, Ikenaka K, Zalc B. 1997. In situ expression of
PLP/DM-20, MBP, and CNP during embryonic and postnatal development of the
jimpy mutant and of transgenic mice overexpressing PLP. J Neurosci Res 50(2):190201.
Polito A, Reynolds R. 2005. NG2-expressing cells as oligodendrocyte progenitors in the
normal and demyelinated adult central nervous system. J Anat 207(6):707-16.
Reynolds BA, Weiss S. 1992. Generation of neurons and astrocytes from isolated cells of the
adult mammalian central nervous system. Science 255(5052):1707-10.
Salm AK, Hatton GI, Nilaver G. 1982. Immunoreactive glial fibrillary acidic protein in
pituicytes of the rat neurohypophysis. Brain Res 236(2):471-6.
Streit WJ, Kreutzberg GW. 1987. Lectin binding by resting and reactive microglia. J
Neurocytol 16(2):249-60.
Takei Y, Seyama S, Pearl GS, Tindall GT. 1980. Ultrastructural study of the human
neurohypophysis. II. Cellular elements of neural parenchyma, the pituicytes. Cell
Tissue Res 205(2):273-87.
Tweedle CD, Hatton GI. 1980. Evidence for dynamic interactions between pituicytes and
neurosecretory axons in the rat. Neuroscience 5(3):661-71.
Velasco ME, Roessmann U, Gambetti P. 1982. The presence of glial fibrillary acidic protein
in the human pituitary gland. J Neuropathol Exp Neurol 41(2):150-63.
Virard I, Coquillat D, Bancila M, Kaing S, Durbec P. 2006. Oligodendrocyte precursor cells
generate pituicytes in vivo during neurohypophysis development. Glia 53(3):294-303.
Wang C, Rougon G, Kiss JZ. 1994. Requirement of polysialic acid for the migration of the O2A glial progenitor cell from neurohypophyseal explants. J Neurosci 14(7):4446-57.
Weiss S, Reynolds BA, Vescovi AL, Morshead C, Craig CG, van der Kooy D. 1996. Is there
a neural stem cell in the mammalian forebrain? Trends Neurosci 19(9):387-93.
Winner B, Cooper-Kuhn CM, Aigner R, Winkler J, Kuhn HG. 2002. Long-term survival and
cell death of newly generated neurons in the adult rat olfactory bulb. Eur J Neurosci
16(9):1681-9.
26
DISCUSSION ET PERSPECTIVES
Les objectifs de mon travail étaient de découvrir si la NH contient des cellules souches
ou progénitrices, au cours du développement et chez le rongeur adulte, et d’établir les
relations entre ces cellules et les pituicytes. Je discuterai ici comment mes résultats, fondés sur
des approches in vivo et in vitro variées, m’ont effectivement permis de déterminer l’origine
des pituicytes. De plus, ils m’ont amenée à réactualiser la définition de cette population
cellulaire, finalement très hétérogène et dont le nombre et la composition sont asujettis à une
régulation précise.
A. Genèse des pituicytes au cours du développement de la NH
I. Etablissement d’une relation de lignage entre OPC périnataux et
pituicytes
Les conclusions principales de l’article 1 sont d’avoir confirmé la présence d’OPC
dans la NH périnatale, déjà pressentie lors d’une étude in vitro (Wang et al. 1994), et d’avoir
établi une nouvelle relation de lignage entre ces OPC périnataux et les pituicytes. Jusqu’à
présent, on savait simplement que la NH dérivait du plancher du troisième ventricule cérébral,
sans connaître clairement le lignage des pituicytes. De par leur expression de marqueurs
retrouvés dans les cellules du lignage astrocytaire (S100, vimentine, GFAP), on les
considérait généralement comme des astrocytes particuliers.
Seule une étude précédente avait comparé le développement des pituicytes, des
astrocytes et des oligodendrocytes (Livingston 1976). Dans ce travail, Livingston avait en
effet remarqué que les souris mutantes jimpy ont moins d’astrocytes et moins
d’oligodendrocytes dans le corps calleux par rapport aux souris sauvages, mais qu’elles
possèdent autant de pituicytes. Cela suggérait que les pituicytes avait une origine différente à
la fois des astrocytes et des oligodendrocytes. A présent que l’on connaît la relation de lignage
entre OPC et pituicytes, on peut expliquer ce résultat chez les souris jimpy de plusieurs
façons, non exclusives les unes des autres. Le nombre de pituicytes n’est peut-être pas
diminué chez les souris jimpy parce qu’il y a compensation par d’autres cellules progénitrices
de pituicytes. Notre analyse montre en effet que de nombreux pituicytes dérivent des OPC
olig1+, mais ne permet pas d’exclure complètement l’existence d’une autre source de
pituicytes. Une autre possibilité est que les OPC de la NH sont épargnés par la mutation
jimpy. C’est tout à fait envisageable, parce que cette mutation se trouve dans le gène plp
(Fahim & Riordan 1986). Or, plp ne semble exprimé que tardivement dans les précurseurs de
56
la NH (Article 1, Fig. 1). La mutation affecterait donc le développement des
oligodendrocytes du corps calleux à un stade tardif de maturation des OPC. Une dernière
alternative impliquerait des facteurs particuliers dans l’environnement neurohypophysaire qui
sauveraient les OPC jimpy. C’est d’ailleurs ce qui se passe lorsque des oligodendrocytes jimpy
sont exposés à un environnement normal : ils retrouvent une longévité normale et une
meilleure capacité de myélinisation, ce qui suggère qu’il manque dans le SNC des souris
jimpy un facteur soluble nécessaire au développement des oligodendrocytes (Bartlett et al.
1988; Lachapelle et al. 1991; Lachapelle et al. 1992; Lachapelle et al. 1994).
Par ailleurs, l’étude du lignage des pituicytes pourrait bénéficier d’analyses plus
poussées sur d’autres souris mutantes. Il existe en effet des souris knock-out ou naturellement
mutantes pour la plupart des gènes utilisés comme marqueurs des OPC de la NH périnatale,
notamment pour olig1 et olig2 (Lu et al. 2002; Zhou & Anderson 2002), nkx2.2 (Sussel et al.
1998), pdgfrα (Stephenson et al. 1991) et sox10 (Britsch et al. 2001). Il serait intéressant
d’examiner le développement des OPC de la NH et des pituicytes chez ces souris mutantes,
du moins chez celles qui survivent jusqu’à la naissance. Par exemple, le gène sox10 est
impliqué dans la différenciation terminale des oligodendrocytes, puisqu’il induit l’expression
de gènes comme celui de la Myelin Basic Protein (MBP) (Stolt et al. 2002) : on ne s’attend
donc pas à ce que sa délétion affecte les pituicytes, qui ne se sont pas des cellules MBP+. En
revanche, le gène sox9, de la même famille de facteurs de transcription, est nécessaire à la
spécification des progéniteurs gliaux de la moelle épinière (Stolt et al. 2003) : sans lui, la
spécification des OPC de la NH risque de ne pas avoir lieu, ce qui compromettrait sans doute
la genèse des pituicytes. Ce type d’analyse permettrait peut-être de disséquer les rôles de ces
différents gènes dans la différenciation des OPC en pituicytes.
II. Hypothèses sur l’origine et la migration des OPC de la NH périnatale
Par hybridation in situ, j’ai montré que des marqueurs d’OPC comme pdgfrα, olig1 ou
plp apparaissent progressivement dans la NH entre E17.5 et P0 (Article 1, Fig. 1). Des
cultures d’explants ont aussi dévoilé la capacité migratoire de ces OPC en réponse à des
facteurs de croissance (Article 1, Fig. 3). La NH périnatale contient donc des OPC motiles.
D’où viennent-ils ? Par analogie avec les OPC du reste du SNC (Thomas et al. 2000; de
Castro & Bribian 2005), les OPC de la NH ne seraient pas spécifiés dans la NH même mais
dans une zone focale du cerveau antérieur, depuis laquelle ils migreraient jusque dans la NH
en longeant la tige pituitaire. Au moins deux aspects de cette migration vaudraient la peine
57
d’être étudiés plus avant. En effet, on peut se demander, d’une part, quel est le site d’origine
des OPC de la NH et, d’autre part, quels signaux leur permettent d’atteindre la NH.
1. Recherche du site d’origine des OPC de la NH
En ce qui concerne le site d’origine des OPC de la NH, une hypothèse vraisemblable
serait qu’il s’agit d’un des foyers d’émergence situés dans le plancher du troisième ventricule.
En effet, plusieurs sites d’oligodendrogenèse ont été identifiés dans la partie ventrale du
diencéphale, notamment dans la plaque latéro-basale des prosomères 1 à 3, ainsi que dans les
aires mammillaire, postoptique et chiasmatique (Pringle & Richardson 1993; Timsit et al.
1995; Ono et al. 1997; Spassky et al. 1998; Perez-Villegas et al. 1999).
L’un de ces foyers, certainement le plus étudié, se trouve juste au-dessus du chiasma
optique et génère les OPC du nerf optique. C’est une région où une prolifération importante
avait été remarquée entre E16 et E19 chez le rat (Small et al. 1987). La colonisation périnatale
du nerf optique par les OPC a ensuite été démontrée de plusieurs façons. Au départ, ce sont
des expériences de culture qui ont suggéré une invasion progressive du nerf optique à partir
de la fin de la vie embryonnaire. Small et ses collaborateurs ont pour cela disséqué différents
segments du nerf optique (rétinien, central, chiasmatique) de rat entre E16 et P9, puis ont
dissocié et mis en culture leurs cellules. Ils ont alors observé que les OPC étaient d’abord
retrouvés au niveau du chiasma optique, puis petit à petit dans le nerf au fur et à mesure que le
développement progresse (Small et al. 1987). Par la suite, des études sur l’expression de
marqueurs précoces du lignage oligodendrocytaire sont venues corroborer cette colonisation
du nerf optique (voir notamment Mudhar et al. 1993; Fanarraga et al. 1996; Ono et al. 1997).
Par exemple, le nerf optique ne contient aucune cellule pdgfra+ avant E18 chez le rat, âge
auquel ce marqueur apparaît au niveau du chiasma. A P0 et P2, les cellules pdgfra+ sont plus
nombreuses et distribuées selon un gradient allant du chiasma vers la rétine. A P5, elles sont
retrouvées uniformément dans tout le nerf (Mudhar et al. 1993). Enfin, un marqueur
fluorescent (DiI) a été utilisé chez le poulet pour marquer des cellules dans le neuroépithélium
ventriculaire et les suivre ensuite après leur migration jusque dans le nerf optique (Ono et al.
1997).
En ce qui concerne les OPC de la NH, leur site d’origine pourrait être une des zones
focales du diencéphale ventral où est observée l’expression de plp/dm20, pdgfrα ou olig1/2
avant l’apparition de ces marqueurs dans la NH (Pringle & Richardson 1993; Timsit et al.
1995; Spassky et al. 1998; Perez-Villegas et al. 1999; Lu et al. 2000). Rappelons par exemple
que pdgfrα est absent dans la NH de rat à E17.5 et y est détecté à E20 (Article 1, Fig. 1).
58
Cependant, on ne voit pas nettement les cellules pdgfrα+ envahir la structure, peut-être parce
que la taille de la NH est relativement petite avant l’arrivée des OPC et la génération
subséquente des pituicytes. Afin d’étudier l’origine de ces OPC, on pourrait effectuer des
transplantations caille/poulet des différentes zones d’où proviendraient les OPC du
diencéphale (Ono et al. 1997) et voir s’ils colonisent aussi la NH. Toutefois, cela implique de
changer de modèle, donc de valider un certain nombre de nos observations chez le poulet,
comme l’utilisation de marqueurs cellulaires, notamment pour identifier les pituicytes. Une
autre option serait alors d’infecter avec un rétrovirus les OPC de ces zones d’origine
potentielles pour les suivre ensuite jusque dans la NH, comme cela a déjà été fait pour
connaître le devenir de cellules de la ZSV postnatale (Levison et al. 1993; Levison &
Goldman 1993). Néanmoins, ces expériences risquent d’être techniquement délicates à
effectuer chez l’embryon de rongeur. En fin de compte, une approche génétique serait
probablement la meilleure : il s’agirait d’utiliser des souris chez lesquelles on peut induire
l’expression d’un gène rapporteur dans les OPC à un moment déterminé, par exemple des
souris pdgfrα-creER/Rosa-GFP (génération en cours dans le laboratoire de W. Richardson, à
Londres ; voir figure 21 plus bas) ou olig2-creER/Rosa-GFP (Takebayashi et al. 2002). On
procèderait à l’induction de la recombinaison dans ces souris vers E16 (équivalent de E17
chez le rat, c’est-à-dire juste avant qu’apparaissent les OPC dans la NH) et on les sacrifierait à
différents temps pour visualiser par l’expression de la GFP la zone d’origine des OPC et leur
migration éventuelle le long de la tige pituitaire et dans la NH. Finalement, l’identité des
cellules GFP+ devrait être confirmée par des techniques d’immunomarquage, en utilisant
d’une part des marqueurs d’OPC (Olig2) puis de pituicytes (S100).
2. Recherche de signaux de migration des OPC dans la NH
Un autre axe de recherche intéressant concerne les signaux qui régulent la migration
des OPC jusque dans la NH en développement. De nombreuses molécules impliquées dans la
migration des OPC ont été identifiées (de Castro & Bribian 2005). Certaines agissent par
contact et influencent plutôt la motilité des cellules, c’est-à-dire leur capacité à se déplacer,
sans nécessairement guider cette migration. C’est le cas de molécules comme PSA-NCAM, la
N-cadhérine, NG2, les récepteurs Eph des éphrines, etc (de Castro & Bribian 2005). Pour ce
qui est de la NH, des études sur des cultures ont montré l’implication de PSA-NCAM dans la
dispersion des OPC à partir d’explants de NH (Wang et al. 1994). Cependant, cette action de
PSA-NCAM est-elle importante in vivo ? En fait, des recherches effectuées au sein de notre
institut et fondées sur l’étude de souris déficientes en PSA-NCAM n’ont pas mis en évidence
59
d’effet notable sur le développement des pituicytes (données non publiées). D’autres
molécules agissant sur la migration des OPC sont sécrétées et influencent leur guidage plutôt
que leur motilité, comme le FGF-2, la netrine-1, les sémaphorines de classe 3, etc (de Castro
& Bribian 2005). Néanmoins, certains facteurs agissent à la fois sur la motilité et sur le
guidage, tel que le PDGF-AA (Noble et al. 1988; Armstrong et al. 1990).
Quoi qu’il en soit, les mécanismes moléculaires de la migration des OPC n’ont pas
encore été étudiés spécifiquement dans la NH et mériteraient de l’être. Pour déterminer quels
signaux agissent au niveau de la NH, une approche simple serait d’étudier des molécules dont
l’effet sur les OPC du nerf optique a déjà été démontré, en utilisant des techniques similaires.
Après avoir identifié des candidats d’après la littérature, il faudrait commencer par analyser
leur expression et celle de leurs récepteurs dans le système hypothalamo-neurohypophysaire
(la NH et les neurones des noyaux hypothalamiques qui y projettent leur axone) au moment
où apparaissent les OPC. Par exemple, le Vascular Endothelial Growth Factor C (VEGFC) vient d’être identifié comme un facteur stimulant la migration (et la prolifération) des OPC
du nerf optique (Le Bras et al. 2006). L’expression du VEGF et de ses récepteurs dans
l’hypophyse n’a jusqu’à présent été étudiée que chez l’adulte (Ochoa et al. 2000) ou dans
l’adénohypophyse au cours du développement (Nakakura et al. 2006) : il reste à la
caractériser dans la NH périnatale. Les candidats retenus seraient alors testés
fonctionnellement in vitro. Premièrement, on pourrait utiliser des cultures d’explants de NH
dans du gel de collagène ou du Matrigel, qui permettent d’observer la distribution des OPC
qui migrent hors des explants (voir Sugimoto et al. 2001; Spassky et al. 2002). L’objectif de
ces cultures serait plus précisément d’analyser comment cette distribution est perturbée
lorsque des cellules transfectées avec le facteur candidat sont cultivées dans le même puits : si
le facteur attire les OPC, on s’attend à ce que les OPC sortent en plus grand nombre de
l’explant dans la direction des cellules transfectées. Un autre type de tests de migration
possibles est fondé sur la chambre de Boyden, un dispositif de culture où deux compartiments
d’un puits de culture sont séparés par une membrane de cellulose. Ce test permet de mesurer
la capacité de migration des cellules à travers la membrane en réponse à un facteur
potentiellement attractif (« transwell assay ») : des gradients chimiotactiques sont établis en
plaçant différentes concentrations du facteur à tester dans les compartiments inférieur et
supérieur de la chambre et, après quelque temps en culture, on compte les cellules qui sont
passées dans le puits inférieur. C’est notamment de cette manière qu’a été démontré l’effet
stimulant du VEGF-C sur la migration des OPC chiasmatiques issus de souris à E18.5 (Le
Bras et al. 2006). Le même test peut être directement appliqué aux OPC de la NH,
préalablement sélectionnés par tri magnétique (Virard et al. 2006). Par la suite, on pourra
60
déterminer si l’effet observé passe par tel ou tel récepteur du facteur étudié. On utilisera pour
cela des bloqueurs (anticorps bloquants, inhibiteurs chimiques des récepteurs…) sur les
cultures d’explants ou en chambre de Boyden. Dans tous les cas, il faudra également vérifier
si le facteur agit spécifiquement sur la migration ou s’il est aussi impliqué dans la
prolifération, comme c’est le cas du VEGF-C (Le Bras et al. 2006). Pour contrôler cela, on
peut bloquer la prolifération en ajoutant un agent antimitotique (par exemple, la β-Darabinofuranosylcytosine) au milieu de culture (Article 1, Fig. 3). Enfin, une confirmation in
vivo de l’effet d’un facteur donné sur la migration des OPC de la NH pourra peut-être être
obtenue en analysant le développement des OPC de la NH et des pituicytes dans des souris
knock-out pour ces candidats ou leurs récepteurs.
3. Existence possible de sous-populations d’OPC dans la NH périnatale
Pour terminer cette partie, mentionnons que ces expériences pourraient mettre en
évidence l’existence de sous-populations d’OPC dans la NH. Par exemple, des cultures en gel
de collagène ont montré que les OPC du nerf optique sont hétérogènes quant à leur réponse
aux molécules de guidage : la nétrine-1 repousse un sous-type de progéniteurs NG2+/PLP+
avec un petit noyau, alors que la sémaphorine-3a repousse une population de progéniteurs
avec un gros noyau et qui n’expriment ni NG2 ni PLP (Sugimoto et al. 2001). Dans le même
ordre d’idées, des recherches au sein de mon équipe ont eu pour but d’étudier la migration des
OPC issus de la NH mis en présence de différentes combinaisons des facteurs trophiques
PDGF-AA, NT3 et FGF-2. Lors d’expériences encore non publiées, les cellules A2B5+
autour des explants de NH néonatale ont été dénombrées : elles sont moins nombreuses avec
une combinaison de FGF-2 et de NT3 qu’avec l’ensemble des trois facteurs, mais cette
différence n’est pas significative. Il serait intéressant de poursuivre ces études en analysant
plus avant l’identité des cellules en migration. Il est notamment probable que, sans le PDGFAA, la migration de progéniteurs PDGFRα+ soit spécifiquement affectée, ce qui expliquerait
la baisse observée du nombre de cellules A2B5+ autour des explants. Ces travaux pourraient
servir à établir une correspondance entre les sous-populations d’OPC définies
fonctionnellement in vitro et des sous-types d’OPC observés in vivo (Spassky et al. 2000).
En effet, plusieurs sous-types d’OPC ont été identifiés in vivo sur la base de
l’expression des marqueurs plp et pdgfrα (Spassky et al. 1998). De ces différences
d’expression découlent des différences dans la réponse à certains facteurs trophiques, les OPC
pdgfrα- n’étant logiquement pas sensibles au PDGF-AA, ce qui résulte en des variations au
niveau de processus biologiques comme la prolifération et la survie (Spassky et al. 1998;
61
Spassky et al. 2000). Qu’en est-il au niveau de la NH ? Y existe-t-il plusieurs sous-types
d’OPC ?
Tel qu’indiqué dans la figure 2 de l’article 1 on trouve dans la NH à P0 une
population pdgfrα+/olig1+/Olig2+/sox10+/Nkx2.2+. Cette combinaison de marqueurs permet
d’affirmer que ce sont certainement des OPC. Expriment-ils plp/dm20 ? Des résultats non
publiés de marquages doubles avec la sonde plp/dm20 et l’anticorps anti-Olig2 montrent que,
dans la NH de rat entre P0 et P10, toutes les cellules plp/dm20+ expriment Olig2. Or, toutes
les cellules Olig2+ sont aussi pdgfrα+ (Article 1, Fig. 2). On peut en déduire que toutes les
cellules plp/dm20+ expriment à la fois plp/dm20, Olig2 et pdgfrα. Cela écarte l’existence
d’OPC plp+/pdgfrα- dans la NH. Bref, les OPC de la NH à P0 sont tous
pdgfrα+/olig1+/Olig2+/sox10+/Nkx2.2+, et une minorité d’entre eux exprime aussi
plp/dm20.
Ces deux populations d’OPC, l’une plp+ et l’autre plp-, arrivent-elles séquentiellement
dans la NH ou s’agit-il en réalité d’une seule population qui exprime d’abord pdgfrα puis se
met à exprimer plp/dm20 ? Une façon de le savoir serait de comparer le potentiel des OPC
plp+ et plp- à générer des pituicytes. Pour cela, on suivrait leur devenir in vivo grâce à des
souris génétiquement modifiées plp-cre (Doerflinger et al. 2003) et olig1-cre (Lu et al. 2002),
qui permettent respectivement de suivre, d’une part, les OPC plp+ et, d’autre part, les OPC
olig1+, donc l’ensemble des OPC plp+ et plp-. Les souris olig1-cre nous ont déjà permis de
montrer que les OPC olig1+ de la NH génèrent les pituicytes (Article 1, Fig. 6). Il faudrait
tout d’abord faire une analyse quantitative plus poussée de la proportion de pituicytes qui
descendent des OPC olig1+, en utilisant des souris où le gène rapporteur est plus facile à
détecter que la β-Galactosidase, par exemple la GFP. Ensuite, cette même analyse serait
effectuée sur des souris plp-cre/Rosa-GFP. Si l’on obtenait les mêmes résultats avec les deux
lignées de souris, cela signifierait que les OPC plp+ donnent naissance aux pituicytes dans les
mêmes proportions que les OPC olig1+. Cela conforterait l’idée que la NH ne contient qu’un
seul lignage d’OPC, qui exprime d’abord pdgfrα (et olig1) puis plp, et enfin se différencie en
pituicytes.
III. Contrôle de la différenciation des OPC périnataux en pituicytes
Mes résultats développementaux montrent que la NH de rongeur contient autour de P0
des cellules qui expriment une combinaison de marqueurs d’OPC (Article 1, Fig. 1 et 2) et
qui présentent, in vitro et après transplantation, des propriétés fonctionnelles caractéristiques
des OPC (Article 1, Fig. 3 et 4). Cependant, ces OPC ne génèrent pas par la suite des
62
oligodendrocytes, comme ailleurs dans le SNC, mais plutôt des pituicytes, tel que démontré
grâce aux souris olig1-cre/RosaLacZ (Article 1, Fig. 6). Une question vient immédiatement à
l’esprit et pourrait être le sujet de travaux futurs : qu’est-ce qui empêche ces OPC de se
différencier en oligodendrocytes dans la NH, ou encore qu’est-ce qui induit leur
différenciation en pituicytes ?
La capacité des OPC à générer des oligodendrocytes est au moins en partie
programmée intrinsèquement : la différenciation des OPC du nerf optique mis en culture obéit
à une horloge interne à chaque cellule (Temple & Raff 1986; Durand & Raff 2000).
Cependant, d’autres études ont démontré que la différenciation en oligodendrocyte dépend
également de facteurs présents dans l’environnement cellulaire.
1. Provenance des facteurs de différenciation en pituicytes
Avant d’aborder l’identité de ces facteurs environnementaux, on peut se poser la
question de leur origine. Des observations faites dans d’autres systèmes permettent d’avancer
plusieurs hypothèses : ces facteurs proviennent-ils des cellules endothéliales, des pituicytes
déjà différenciés, ou encore des axones hypothalamiques ? La différenciation en
oligodendrocytes peut en effet être modulée via des signaux axoniques (voir Bozzali &
Wrabetz 2004 pour une revue). En particulier, la sécrétion neuronale d’adénosine, notamment
induite par l’activité électrique, promeut la formation d’oligodendrocytes myélinisants dans
des co-cultures de neurones et d’OPC, tel que démontré par imagerie calcique,
immunomarquages et microscopie électronique (Stevens et al. 2002). Les cellules
endothéliales ou des signaux dérivés du sérum pourraient également jouer un rôle important
dans la différenciation des OPC de la NH. Une telle interaction entre vaisseaux sanguins et
progéniteurs gliaux ne serait pas surprenante puisque, par exemple, les cellules endothéliales
induisent la différenciation des astrocytes du nerf optique dans des co-cultures de cellules
endothéliales et de précurseurs d’astrocytes purifiés (Mi et al. 2001).
Pour déterminer quelles cellules poussent les OPC de la NH vers un destin
pituicytaire, une approche similaire de co-culture peut être envisagée. Il s’agirait d’abord de
cultiver des OPC de NH d’animaux transgéniques chez lesquels la GFP est exprimée de façon
ubiquitaire, ce qui permet de distinguer leurs cellules dans des cultures mixtes. La
différenciation des OPC en oligodendrocytes GalC+ et en cellules GFAP+ serait testée par
immunomarquage, en présence ou non de pituicytes périnataux ou de cellules endothéliales de
NH purifiées. L’hypothèse serait qu’au moins l’un de ces types cellulaires fait diminuer la
proportion d’oligodendrocytes différenciés au profit des cellules GFAP+. Cependant, il faut
63
souligner que, dans ce genre d’étude, une difficulté serait de confirmer que ces cellules
GFAP+ sont des pituicytes et non des astrocytes. Il faudrait auparavant avoir caractérisé les
différences entre ces deux types cellulaires in vitro. Quoi qu’il en soit, l’objectif de ces
expériences serait de découvrir si l’une des composantes cellulaires de la NH peut influencer
la différenciation des OPC.
Ensuite, une autre question intéressante serait de déterminer si ces cellules agissent par
contact direct avec les OPC ou bien par sécrétion de facteurs qui agissent à distance. Pour
tester cela, il faudrait alors analyser la proportion d’oligodendrocytes obtenus à partir d’une
culture d’OPC maintenus dans un milieu conditionné par des pituicytes ou par des cellules
endothéliales : si le pourcentage d’oligodendrocytes diminue autant en milieu conditionné
qu’en présence des cellules, c’est que les cellules agissent du moins en grande partie par le
biais de molécules sécrétées.
2. Identité potentielle des facteurs de différenciation
La suite logique de ces expériences serait de trouver l’identité des facteurs
potentiellement responsables de la différenciation des OPC en pituicytes. Une analyse de la
littérature sur le développement des OPC dans le reste du système nerveux permet d’établir
une longue liste de candidats : Bone Morphogenetic Proteins (BMP), cytokines de la famille
CNTF/LIF, adénosine, neurégulines, intégrines, Insulin-like Growth Factor 1 (IGF-1), etc
(Ware et al. 1995; Johe et al. 1996; Bonni et al. 1997; Nakashima et al. 1999; Dubois-Dalcq
& Murray 2000; Lee et al. 2000; Stevens et al. 2002; Bozzali & Wrabetz 2004; Miller et al.
2004). Notons que ces facteurs ont essentiellement été découverts par le biais d’expériences in
vitro. En effet, in vivo, l’étude de la différenciation des OPC est limitée par le fait que, bien
souvent, les facteurs qui influencent la différenciation ont aussi des effets plus précoces, par
exemple sur la prolifération ou la survie des progéniteurs. A titre d’illustration, l’hormone
thyroïdienne (T3) agit tout au long du développement des oligodendrocytes, depuis leur
détermination jusqu’à leur maturation en cellules myélinisantes (Rodriguez-Pena 1999).
Quand de tels facteurs aux propriétés multiples sont étudiés in vivo, notamment par
inactivation génétique, l’effet sur la différenciation est masqué par l’effet premier sur la
spécification ou la prolifération. Ce genre de problème pourra être contourné avec la création
de souris modifiées génétiquement chez lesquelles on peut induire l’inactivation d’un gène
donné à un moment bien déterminé du développement (Beglopoulos & Shen 2004).
En attendant, plusieurs hypothèses peuvent être avancées quant à l’identité des
facteurs qui orientent la différenciation des OPC en pituicytes. Dans un premier cas de figure,
64
la différenciation en oligodendrocytes peut être réprimée et, par défaut, c’est la différenciation
en pituicytes qui a lieu. Inversement, des facteurs qui induisent activement la différenciation
en pituicytes peuvent être présents dans la NH en développement. On peut supposer que ces
facteurs sont apparentés aux molécules favorisant le destin astrocytaire, puisqu’ils induiraient
notamment l’expression de marqueurs communs aux astrocytes et aux pituicytes (S100,
GFAP). Toutefois, cette distinction entre facteurs réprimant la formation d’oligodendrocytes
et favorisant celle des pituicytes est sans doute purement théorique puisque ces deux effets
sont vraisemblablement liés.
Parmi les facteurs connus comme des répresseurs de la différenciation en
oligodendrocytes, les BMP représentent des candidats intéressants. En effet, en plus de leur
rôle bien établi dans la spécification des oligodendrocytes (Hall & Miller 2004), les BMP
semblent aussi impliquées dans la différenciation gliale. Par exemple, des cultures d’OPC
corticaux néonataux ont montré que les BMP pouvaient orienter les OPC vers une destinée
astrocytaire aux dépens d’une différenciation oligodendrocytaire (Mabie et al. 1997). L’action
inhibitrice des BMP sur la différenciation en oligodendrocytes explique aussi en partie
l’absence d’oligodendrocytes dans la rétine de rat ou de souris (Gao et al. 2006).
Pour chaque facteur candidat, il s’agira d’abord d’examiner son expression dans la NH
en développement, par hybridation in situ ou immunohistochimie. Cela servira à découvrir
des molécules dont le patron d’expression au cours du développement est en accord avec leur
implication potentielle dans la maturation des pituicytes. Des marquages doubles permettront
aussi de déterminer leur localisation dans tel ou tel type de cellules de la NH (axones, cellules
gliales ou endothéliales). A ce propos, il pourra également être utile d’observer si un facteur
est particulièrement exprimé dans la partie de la NH la plus éloignée de la tige pituitaire. En
effet, au cours du développement périnatal de la NH, les marqueurs d’OPC olig1, olig2 et plp,
et même sox10 dans une moindre mesure, sont exclus de la partie distale de la NH (Article 1,
Fig. 1), qui pourrait donc contenir une source de facteurs inhibant leur expression. Pour en
revenir à l’exemple des BMP, leur expression n’a, à ma connaissance, pas été caractérisée
spécifiquement dans la NH périnatale et mériterait d’être étudiée, en parallèle avec celle de
leurs récepteurs. L’effet des candidats retenus sur la différenciation gliale pourra enfin être
testé sur des cultures d’OPC de NH purifiés par tri magnétique (Virard et al. 2006).
65
B. Les pituicytes adultes : une population gliale hétérogène et
proliférative
I. Hétérogénéité de la population de pituicytes
Une conclusion notable de mon étude concerne l’hétérogénéité des pituicytes dans la
NH adulte, fondée sur l’expression de différents marqueurs gliaux (Article 2, Fig. 1). C’est là
un résultat nouveau : l’hétérogénéité des pituicytes avait simplement été remarquée sur des
critères morphologiques, avec des résultats variables selon les études (Bucy 1932; Dellmann
& Owsley 1969; Krsulovic & Bruckner 1969; Galabov & Schiebler 1978; Takei et al. 1980),
et sur des patrons d’expression pour les ARNm des IGFBP-2 et 5 (Green et al. 1994), sans
être caractérisée davantage.
1. Existence de sous-populations de pituicytes définies par des marqueurs
astrocytaires
La figure 1 de l’article 2 illustre les proportions de pituicytes exprimant les
marqueurs gliaux vimentine, S100 et GFAP, ainsi que différentes combinaisons de ces
marqueurs. Nos comptages indiquent que la protéine S100 doit être considérée comme le
marqueur principal des pituicytes, du moins chez des rats de six semaines. Par contre, on
détecte peu de vimentine et de GFAP dans la NH adulte, et même pas de GFAP du tout chez
la souris (mentionné dans l’article 1). Cette expression de filaments intermédiaires
relativement faible par rapport aux astrocytes avait déjà été remarquée et soupçonnée d’être
liée à la plasticité morphologique des pituicytes (Miyata & Hatton 2002). Dans le même ordre
d’idées, nous avons avancé l’hypothèse que les différentes sous-populations de pituicytes
identifiées chez l’adulte pourraient représenter des étapes de maturation d’un seul lignage.
Pour rejoindre l’idée de Miyata et Hatton, les cellules qui expriment plus fortement GFAP
pourraient être plus matures et moins plastiques. Cependant, la chronologie d’apparition des
trois marqueurs vimentine, S100 et GFAP durant le développement de la NH ne vient pas
appuyer cette hypothèse de maturation. En effet, S100 et GFAP sont détectées à partir de E20
chez le rat, puis vimentine à P0 (Article 1, Fig. 5 et résultats non publiés) : selon notre
hypothèse, on s’attendrait à voir GFAP apparaître le plus tard. Quoi qu’il en soit, il est
concevable que les pituicytes GFAP+ soient tout de même moins plastiques même s’ils ne
naissent pas les derniers au cours du développement. Sur la base de l’expression de vimentine,
S100 et GFAP, on pourrait donc distinguer non pas des étapes de maturation des pituicytes à
66
proprement parler, mais plutôt des sous-populations de pituicytes avec différents niveaux de
plasticité morphologique.
2. Découverte de pituicytes pdgfrα+
Par ailleurs, ce travail a permis de mettre en évidence l’existence de cellules pdgfrα+
au sein de la NH adulte (Article 1, Fig. 1 et Article 2, Fig. 1). Parce qu’elles ne co-expriment
pas plusieurs autres marqueurs gliaux, notamment NG2 et Olig2, ces cellules semblent
différentes des cellules pdgfrα+ du reste du SNC (appelées OPC adultes ou synantocytes).
Néanmoins, il existe plusieurs sous-populations de cellules pdgfrα+ dans le SNC, comme
l’indiquent notamment des variations dans leur morphologie et leur fonction présumée (Polito
& Reynolds 2005). Par exemple, certaines sont vraisemblablement des OPC adultes (Polito &
Reynolds 2005) et d’autres présentent des propriétés de progéniteurs neuronaux dans
l’hippocampe (Belachew et al. 2003). Ainsi, il est pour l’instant difficile de définir clairement
les OPC adultes du SNC et, par conséquent, de trancher quant aux relations possibles entre
ces OPC adultes et les cellules pdgfrα+ de la NH.
Les cellules pdgfrα+ peuvent-elles être considérées comme des pituicytes ? Elles sont
distinctes des cellules des vaisseaux sanguins ILB4+ mais aussi des pituicytes S100+ (Article
2, Fig. 1), ce qui les classerait dans une catégorie à part. Cependant, puisque pdgfrα est un
marqueur glial, il semble logique de placer les cellules pdgfrα+ parmi l’ensemble des
pituicytes, qui en paraît ainsi encore plus hétérogène.
Des études plus poussées doivent être menées pour mieux comprendre la nature et la
fonction de ces cellules pdgfrα+. En particulier, des analyses avec un plus grand nombre de
marqueurs neuraux seraient utiles pour caractériser ces cellules. Par exemple, sont-elles les
cellules nestine+ essentiellement distinctes des cellules S100+ et GFAP+ identifiées lors
d’une étude précédente (Krylyshkina et al. 2005) ? Il me semble également important
d’analyser le profil électrophysiologique des cellules pdgfrα+ de la NH et de le comparer au
profil si particulier des cellules NG2+ du cerveau (Lin & Bergles 2002), qui reçoivent des
synapses fonctionnelles des neurones voisins (Bergles et al. 2000). Dans cette optique, il
faudrait aussi établir par microscopie électronique si les cellules pdgfrα+ de la NH forment
des contacts synaptoïdes avec les axones. De telles jonctions neurono-gliales ont en effet été
observées dans la NH adulte (Monroe & Scott 1966) et leur distribution n’est pas régulière : il
peut y en avoir plusieurs sur un pituicyte alors que la cellule voisine ne semble en compter
aucun (Wittkowski & Brinkmann 1974). Il serait donc intéressant de savoir si les neurones
contactent préférentiellement certains pituicytes, notamment les cellules pdgfrα+.
67
J’ai voulu répondre à toutes ces questions mais j’ai été confrontée à des difficultés
techniques importantes. D’une part, l’anticorps anti-nestine dont je dispose ne fonctionne pas
après hybridation in situ avec la sonde pdgfrα et les anticorps anti-PDGFRα disponibles dans
le commerce ne donnent pas de marquage satisfaisant dans la NH de rat. Ensuite, les
tentatives d’enregistrement électrophysiologique des cellules pdgfrα+ de la NH n’ont pas
abouti parce que les cellules gliales de la NH sont particulièrement petites et difficiles à
distinguer et donc à « patcher ». Avant de poursuivre ces expériences, il faudrait créer des
souris pdgfrα-GFP capables de survivre jusqu’à l’âge adulte, des mutants conditionnels par
exemple, qui permettraient de visualiser les cellules pdgfrα+ et faciliteraient par conséquent
leur étude par électrophysiologie. Enfin, avec l’aide du service de microscopie électronique de
mon institut, j’ai essayé de déterminer quelles cellules de la NH reçoivent des contacts
synaptoïdes des axones et si les cellules pdgfrα+ ont une distribution particulière par rapport
aux axones ou aux vaisseaux sanguins. Des expériences préliminaires ont permis d’observer
l’ultrastructure unique de la NH, mais nous n’avons pas encore pu distinguer les cellules
pdgfrα+, faute d’avoir un anticorps utilisable en microscopie électronique.
3. Présence de progéniteurs gliaux et absence de cellules souches neurales dans la
NH adulte
Ensuite, j’ai continué l’étude des cellules de NH adulte par des expériences de culture.
Elles ont montré que parmi ces cellules se trouvent aussi des progéniteurs gliaux. En effet, des
explants de NH adulte peuvent générer des oligodendrocytes (Article 2, Fig. 2), ce qui
suggère la présence de cellules progénitrices dans la structure. De plus, les cellules de NH
adulte peuvent former des neurosphères (Article 2, Fig. 3), indiquant également qu’elles
contiennent des précurseurs neuraux capables de proliférer. Par rapport aux neurosphères
issues de ZSV, les neurosphères de NH sont moins nombreuses et plus petites : cela reflète
respectivement une plus faible densité de progéniteurs dans la NH et une capacité moindre à
proliférer. Cette dernière caractéristique peut résulter d’une vitesse de division inférieure, ou
alors découler du fait que les progéniteurs de la NH génèrent peu de cellules elles-mêmes
capables de proliférer. Cette dernière explication est sans doute juste car les neurosphères
primaires de NH ne peuvent donner naissance à des neurosphères secondaires, ce qui montre
que les progéniteurs de la NH n’engendrent pas de nouveaux précurseurs.
Ainsi, les cellules de la NH ne prolifèrent pas indéfiniment : elles ne renferment donc
pas de cellules souches neurales. Cela constitue un résultat nouveau, puisque d’autres sites de
plasticité du SNC (ZSV, CVD…), où l’expression de la molécule PSA-NCAM est maintenue
chez l’adulte, sont également des zones d’où ont été isolées des cellules souches (Lois &
68
Alvarez-Buylla 1993; Rousselot et al. 1995; Bouzioukh et al. 2001; Charrier et al. 2006).
Contrairement à ces régions, la NH est le site d’une importante plasticité morphofonctionnelle reliée à l’expression de PSA-NCAM (Theodosis et al. 1991) mais ne contient
pas de cellules souches.
Inévitablement, on se demande alors quelle est in vivo l’identité des cellules
progénitrices décelées en culture. Ce ne sont pas des cellules souches neurales, puisqu’elles
ont une capacité de prolifération limitée, ni des OPC adultes classiques, étant donné l’absence
de marqueurs spécifiques. Plusieurs hypothèses sont envisageables : les oligodendrocytes
issus des explants et les sphères primaires obtenues à partir de NH adulte pourraient dériver
des cellules pdgfrα+, de pituicytes S100+, ou de cellules encore non identifiées. On peut aussi
imaginer que ces cellules progénitrices pourraient provenir des vaisseaux sanguins. Par
exemple les péricytes, cellules de la paroi des vaisseaux d’origine neuroectodermique (Korn
et al. 2002), présentent in vitro des propriétés de cellules souches neurales (Dore-Duffy et al.
2006) et pourraient donc être les précurseurs détectés dans la NH adulte.
Afin de discriminer entre ces différentes possibilités, l’idéal serait de pouvoir dissocier
les cellules de NH adulte et les trier pour tester in vitro leurs potentialités de prolifération et
de différenciation. Pour réussir ce tri, il serait pratique de trouver des marqueurs de surface
caractéristiques des différentes sous-populations cellulaires. Le récepteur PDGFRα est situé à
la surface des cellules mais l’anticorps dont je dispose reconnaît un antigène interne : il ne
peut donc pas servir pour un tri sur cellules vivantes.
II. Hypothèse quant à l’origine développementale des cellules pdgfrα+
La population de cellules pdgfrα+ dérive-t-elle aussi des OPC de la NH périnatale,
comme les pituicytes S100+ ? Ce ne serait pas étonnant, mais d’un autre côté, ces cellules
pdgfrα+ semblent si différentes des autres populations gliales du SNC que rien ne permet
d’affirmer qu’elles appartiennent au lignage oligodendrocytaire. En examinant leur apparition
au cours du développement, j’ai remarqué que des cellules pdgfrα+ distinctes des OPC sont
détectées dans la partie distale de la NH dès E20 (Article 1, Fig. 1). Les cellules pdgfrα+ se
développent donc à une période où des OPC sont présents dans la NH. Cela est compatible
avec une relation de lignage entre ces deux types de cellules mais ne la prouve pas. Pour la
montrer, il faudrait poursuivre notre analyse des souris olig1-cre/RosaLacZ (Figure 20) ou,
mieux, utiliser des souris olig1-cre/Rosa-GFP. On procéderait à un double marquage pdgfrα
et XGal (ou anti-GFP). Si les cellules pdgfrα+ de la NH sont XGal+ (ou GFP+), c’est qu’elles
descendent des OPC olig1+.
69
III. Lignage présumé entre cellules pdgfrα+ et pituicytes S100+ chez
l’adulte
Le travail présenté dans l’article 1 a démontré que les pituicytes S100+ dérivent
d’OPC périnataux olig1+, qui expriment aussi pdgfrα. Naturellement, nous avons émis
l’hypothèse que les cellules pdgfrα+ présentes dans la NH adulte (Article 2, Fig. 1 I)
pourraient faire partie du lignage des pituicytes et représenter des progéniteurs maintenus
chez l’adulte, par exemple dans le but d’y générer de nouveaux pituicytes.
Une première façon de vérifier ce lignage consisterait à trouver quelques cellules qui
co-expriment à la fois pdgfrα et S100 : elles représenteraient un stade de transition entre deux
étapes successives d’un même lignage. J’ai fait des marquages doubles pdgfrα/S100 (voir par
exemple la figure 1 K de l’article 2) mais les résultats obtenus ne sont pas satisfaisants. En
effet, seules de rares cellules qui semblent doublement marquées sont observées dans la NH
après stimulation (non montré), mais chacun des deux marquages est très faible. Il est possible
que les cellules pdgfrα+ se différencient en pituicytes S100+ mais diminuent leur expression
de pdgfrα avant que S100 soit clairement détectable.
Une autre manière de déterminer si les cellules pdgfrα+ génèrent des pituicytes chez
l’adulte serait de les marquer par incorporation de BrdU pendant la phase S du cycle cellulaire
et de suivre ensuite leur différenciation (Figure 11). J’ai pu observer des cellules pdgfrα+ qui
avaient incorporé la BrdU (Article 2, Fig. 5). Malheureusement, il se trouve que les pituicytes
différenciés (S100+ ou GFAP+) peuvent continuer de se diviser, puisque j’ai aussi vu des
cellules S100+ ou GFAP+ exprimant le marqueur de cycle cellulaire Ki67 (Article 2, Fig. 5).
Les cellules S100+ ou GFAP+ marquées à la BrdU ne proviennent donc pas forcément de la
division d’un progéniteur potentiel pdgfrα+, mais peuvent aussi descendre de pituicytes
S100+ ou GFAP+.
La seule approche pour démontrer incontestablement une relation de lignage entre les
cellules pdgfrα+ et les pituicytes S100+ passe par un outil génétique. Il s’agirait de suivre le
devenir des cellules pdgfrα+, par exemple grâce à des souris pdgfrα-creER/Rosa26-GFP
(Figure 21 A). Ces souris ont été créées dans le laboratoire du Dr Richardson, à Londres,
avec lequel nous avons établi une collaboration. L’induction de la recombinase par injection
de Tamoxifen a demandé une mise au point laborieuse qui vient juste d’aboutir et permet de
détecter avec la GFP les cellules pdgfrα+ de la moelle épinière et du cerveau antérieur (non
montré). De plus, quelques cellules GFP+ sont visibles dans la NH adulte (figure 21 B). A
présent, il s’agit de vérifier qu’elles expriment pdgfrα. Finalement, en attendant un certain
temps après l’induction, et éventuellement après une ou plusieurs stimulations par
70
déshydratation, il faudra effectuer un marquage anti-S100 : si des cellules GFP+/S100+ sont
présentes, cela démontrera que ces pituicytes descendent chez l’adulte de cellules pdgfrα+.
Ainsi, grâce à cette approche, nous pourrons établir qu’il existe une relation de lignage entre
les cellules pdgfrα+ et les pituicytes S100+ et, possiblement, montrer qu’une fonction des
cellules pdgfrα+ consiste à remplacer ces pituicytes lors d’une stimulation de la NH.
Figure 21 : Analyse du lignage des cellules pdgfrα+
grâce à des souris pdgfrα-creER/Rosa26-GFP
A. Des souris pdgfrα-creER (1) ont été générées dans le laboratoire du Dr W. Richardson
afin qu’une recombinase Cre inductible soit exprimée dans les OPC adultes pdgfrα+. Leur
croisement avec une lignée Rosa26 (2) portant le gène de la GFP précédé d’une séquence
STOP floxée permet d’obtenir des souris doublement hétérozygotes (3) chez lesquelles toutes
les cellules pdgfrα+ expriment la recombinase Cre inductible. Après injection (4) d’une
molécule inductrice (le Tamoxifen), qui induit la translocation nucléaire de la Cre, certaines
de ces cellules et leur descendance activent l’expression du gène rapporteur et sont donc
GFP+. Ce système permet de marquer des cellules pdgfrα+ et leur lignage à partir du
moment de l’induction.
B. Quelques cellules GFP+ sont détectées dans la NH adulte. Notre objectif est à présent de
vérifier si ces cellules GFP+ sont pdgfrα+ et ensuite de déterminer si elles génèrent des
pituicytes S100+, éventuellement après avoir stimulé la prolifération cellulaire par un
protocole de déshydratation. Barre d’échelle: 25 µm.
71
IV. Prolifération et mort cellulaire dans la NH adulte
Un dernier résultat qui se doit d’être discuté concerne la prolifération accrue observée
dans la NH adulte après stimulation et la régulation simultanée du nombre de cellules par
mort programmée.
Dans la situation normale, il y a une prolifération basale parmi les cellules de la NH,
puisque environ 11% d’entre elles sont marquées après des injections quotidiennes de BrdU
pendant 9 jours chez les rats témoins (Article 2, Fig. 4). Ce phénomène avait déjà été
rapporté (Paterson & Leblond 1977; Murugaiyan & Salm 1995). De plus, ces études
précédentes avaient souligné que la prolifération de base touche à la fois les pituicytes (en
particulier les pituicytes GFAP+) et d’autres types de cellules, notamment celles des
vaisseaux sanguins. J’ai confirmé ces résultats, et ajouté à la liste des types cellulaires
impliqués les pituicytes S100+ et pdgfrα+, puisque certains sont BrdU+ ou Ki67+ (Article 2,
Fig. 5).
Après notre protocole de stimulation, le nombre de cellules BrdU+ triple (Article 2,
Fig. 4). Quelles cellules sont ainsi induites à se diviser ? Notre analyse montre que ce sont
toutes les populations étudiées qui sont davantage marquées à la BrdU, à savoir les pituicytes
GFAP+, S100+ ou pdgfrα +, ainsi que les cellules des vaisseaux sanguins ILB4+ (Article 2,
Fig. 5). Des marquages doubles avec Ki67 ont également permis d’identifier des cellules en
cours de cycle parmi chacune de ces populations (Article 2, Fig. 5), même si une analyse
quantitative n’a pas été possible à cause du faible nombre de cellules gliales Ki67+.
Par ailleurs, l’augmentation de la prolifération est accompagnée d’une augmentation
concomitante de la mort cellulaire : le nombre de cellules TUNEL+ atteint un maximum
durant la phase de réhydratation (Article 2, Fig. 4). Ce constat conduit à se poser la question
de l’identité des cellules éliminées. Nous avons émis l’hypothèse que ce sont des pituicytes
GFAP+ moins plastiques (voir plus haut) qui seraient préférentiellement touchés par
l’apoptose. Malheureusement, il est difficile de le vérifier : le nombre de cellules TUNEL+ est
trop faible et leur morphologie trop affectée par le processus d’apoptose pour qu’elles
puissent être clairement identifiées par des marquages doubles (par exemple GFAP/TUNEL).
Pour éclaircir ce point, il faudrait donc poursuivre les expériences sur un nombre plus grand
d’animaux, éventuellement en utilisant des marqueurs précoces d’apoptose, telle la caspase-3
activée.
72
Figure 22 : Hypothèse sur la régulation du nombre de cellules dans la NH adulte
Selon cette hypothèse de travail, les cellules pdgfrα+ constituent une population de
progéniteurs gliaux maintenus dans la NH adulte afin de générer de nouveaux pituicytes (les
points d’interrogation indiquent que cette relation de lignage reste à démontrer). Ces
progéniteurs seraient particulièrement sollicités lors d’une stimulation de la NH. A cette
occasion, l’accroissement de la prolifération est accompagné par une mort cellulaire plus
importante, qui pourrait concerner préférentiellement les pituicytes les plus matures, c’est-àdire les moins capables de plasticité morphologique.
Au final, il semble exister un équilibre entre le nombre de cellules formées et
éliminées, puisque le nombre total de cellules ne varie pas significativement dans la NH
(Article 2, Fig. 4), ni d’ailleurs les proportions de chaque population cellulaire étudiée
(Article 2, Fig. 5). Sur ces points, nos résultats ne concordent pas tout à fait avec ceux
d’études précédentes qui avaient noté une hypertrophie de la NH après stimulation. Par
exemple, Murugaiyan et Salm avaient remarqué après neuf jours de déshydratation une
croissance transitoire de la surface de la NH, ainsi qu’une augmentation significative du
nombre de cellules GFAP+ après réhydratation (Murugaiyan & Salm 1995). Cette différence
est peut-être due à l’âge des rats utilisés, les nôtres étant encore de jeunes adultes (de six
semaines, au lieu de deux mois à deux mois et demi), ou peut simplement représenter des
variations entre deux lots d’expériences.
L’équilibre entre le nombre de cellules nouvellement générées et celui des cellules qui
meurent est une forme d’homéostasie tissulaire retrouvée dans tout l’organisme (Hetts 1998).
Par exemple, dégénérescence neuronale et neurogenèse sont étroitement liées. Ainsi, dans
l’épithélium olfactif sain, situé dans le système nerveux périphérique, il existe un
renouvellement permanent des cellules, où chaque neurone qui meurt est remplacé (Comte
2003). De même, les deux zones principales de neurogenèse secondaire dans le SNC (ZSV et
73
gyrus dentelé de l’hippocampe) contiennent de nombreuses cellules en apoptose (Biebl et al.
2000). Cette mort cellulaire sert probablement à éliminer les neurones surnuméraires pour
réguler le nombre total de cellules. Inversement, quand des neurones meurent dans des
situations pathologiques, les zones neurogéniques sont sollicitées pour compenser les pertes
cellulaires, et de la neurogenèse a parfois même lieu dans des régions normalement non
neurogéniques (Ming & Song 2005).
Dans le cas particulier de la NH, on peut se demander si la stimulation par
déshydratation entraîne la mort de certaines cellules, ce qui déclenche leur remplacement, ou
bien si c’est parce que de nouvelles cellules se forment que l’élimination par apoptose est
ensuite accrue pour maintenir constant le nombre total de cellules dans la structure. Pour
répondre à cette question, observons le décours temporel des deux événements. La
prolifération cellulaire augmente rapidement après stimulation, comme l’indiquent
l’incorporation renforcée de BrdU dès le troisième jour de déshydratation (Murugaiyan &
Salm 1995) et l’augmentation du nombre de cellules Ki67+ après cinq jours de déshydratation
(Article 2). En revanche, la mort cellulaire connaît un accroissement important seulement
après une stimulation plus longue, avec un pic dans le nombre de cellules TUNEL+ trois jours
après la fin d’une déshydratation de neuf jours (Article 2, Fig. 4). Bien que je n’aie pas
quantifié l’apoptose dans les premiers jours de déshydratation, cela laisse supposer que c’est
la prolifération qui se produit d’abord et qui provoque ensuite la mort cellulaire.
V. Régulation de la prolifération cellulaire dans la NH
Au niveau moléculaire, cet équilibre reflète un système de régulation fine : des
signaux doivent contrôler en parallèle la prolifération, la différenciation et la survie des
cellules. Un thème de recherche futur pourrait être d’identifier les facteurs moléculaires qui
régulent cet équilibre homéostatique dans la NH adulte.
Une première approche pour déterminer l’identité des facteurs responsables de la
prolifération au sein de la NH adulte serait d’analyser la présence dans la NH de molécules
déjà impliquées dans la régulation de la prolifération dans d’autres types cellulaires. Par
exemple, un bon candidat serait l’adénosine, qui influence la division des cellules souches
neurales (Mishra et al. 2006) et des OPC (Stevens et al. 2002). Or, il se trouve que ce
nucléoside déclenche chez des pituicytes en cultures des changements morphologiques
(étoilement ; Rosso et al. 2002a) qui rappellent la rétraction de leurs prolongements observés
in vivo durant une stimulation physiologique de la NH. L’adénosine pourrait donc être l’un
des facteurs sécrétés dans la NH pendant la déshydratation et jouer un rôle dans la plasticité,
74
tant au niveau de la forme des cellules que de leur prolifération. Elle pourrait également
influencer l’apoptose, comme cela a notamment été décrit pour les astrocytes (Jacobson et al.
1999). Le VEGF, dont j’ai discuté l’action sur la prolifération et la migration des OPC (Le
Bras et al. 2006), est également exprimé dans la NH adulte (Ochoa et al. 2000). Il y régule
probablement la plasticité et le maintien de la fenestration des capillaires (Kamba et al. 2006),
mais peut-être aussi la prolifération gliale. De même, on peut imaginer une fonction dans la
prolifération pour plusieurs neuromodulateurs trouvés dans la NH adulte, y compris la
vasopressine et l’ocytocine (voir Miyata & Hatton 2002 pour une revue de ces modulateurs).
En effet, il a déjà été démontré que la vasopressine a un effet mitogène sur différents types
cellulaires (Thibonnier et al 2000 ; Lagumdzija et al. 2004). Par ailleurs, des puces à ADN
ont
récemment
servi
à
comparer
le
transcriptome
du
système
hypothalamo-
neurohypophysaire de rats témoins et déshydratés (Hindmarch et al. 2006) : ces résultats
pourront permettre de trouver d’autres facteurs candidats peut-être impliqués dans la
régulation de la prolifération. Par exemple, l’un des gènes dont l’expression est augmentée
dans l’hypophyse après déshydratation est Chi3l1 (chitinase 3-like 1/cartilage glycoprotein39), qui encode une protéine dont le rôle mitogène a déjà été démontré dans différents types
cellulaires non neuraux (De Ceuninck et al. 2001; Recklies et al. 2002).
Il s’agirait ensuite de vérifier l’expression des candidats retenus dans la NH ainsi que
celle de leurs récepteurs sur les pituicytes. Pour vérifier leur fonction, des cultures de
pituicytes seraient traitées avec les molécules à tester, ainsi que des bloqueurs de leurs
récepteurs si c’est possible, afin de mesurer l’effet sur l’incorporation de BrdU et donc la
prolifération cellulaire. Dans les cas où des souris mutantes pour le facteur étudié existent,
notamment des knock-out inductibles chez l’adulte, il serait intéressant de voir si la
prolifération cellulaire dans la NH est affectée, notamment lors d’une stimulation.
75
CONCLUSION : Apports de l’étude de la NH à la
compréhension de la gliogenèse dans le SNC
A. Intérêts et limites de la NH comme modèle d’étude de la
gliogenèse : aspects techniques
D’un point de vue technique, la NH présente plusieurs propriétés qui la désignent
comme un modèle de choix pour l’étude de la gliogenèse dans le SNC. En effet, la NH offre
l’avantage de pouvoir servir dans un éventail assez large d’approches. En premier lieu, sa
localisation en fait une structure accessible, facile à disséquer, ce qui a permis de procéder à
des cultures et des greffes. De plus, la stimulation de la NH avait déjà été l’objet de
recherches antérieures sur lesquelles j’ai pu fonder mes propres expériences de
déshydratation.
En contrepartie, nous avons vu que la NH est une structure assez petite, ce qui
empêche de l’utiliser pour des expériences où un grand nombre de cellules est nécessaire, par
exemple pour un tri cellulaire à fluorescence (FACS). La NH se prête également mal à
l’analyse par électrophysiologie du fait de la difficulté d’identifier les éléments cellulaires
dans des coupes fraîches, du moins chez des animaux sauvages. La création de souris
porteuses d’un gène rapporteur dans certaines cellules de la NH pourra peut-être atténuer ce
problème.
B. Application des mêmes stratégies à l’étude d’autres zones de
gliogenèse
Dans quelle mesure cette étude sur la NH est-elle pertinente pour d’autres sites de
gliogenèse dans le SNC ? Avant tout, mon travail a souligné l’existence de particularités
locales dans le domaine des lignages gliaux. Par exemple, les OPC ne donnent en général pas
naissance in vivo à des cellules qui expriment des marqueurs astrocytaires, alors que je l’ai
démontré dans la NH (Article 1). Ces conclusions montrent la nécessité de réexaminer en
détails les populations gliales dans le reste du SNC, sans possibilité de généraliser à partir de
résultats obtenus sur une région précise. On peut notamment imaginer employer les mêmes
stratégies pour des études de lignage sur d’autres populations gliales. Les souris olig1cre/RosaLacZ peuvent ainsi servir pour déterminer si des OPC (ou d’autres types de cellules
olig1+) génèrent d’autres populations gliales du SNC. C’est d’ailleurs par ce genre
d’approche que Masahira et ses collaborateurs ont récemment démontré que des cellules
76
olig2+ donnent naissance non seulement à des oligodendrocytes et des motoneurones dans la
moelle épinière, mais aussi à des sous-types d’astrocytes et de cellules épendymaires
(Masahira et al. 2006). De la même manière, il serait intéressant d’analyser l’origine de
l’aldynoglie (un terme générique regroupant pituicytes, tanycytes, glie engainante du bulbe
olfactif, glie de l’épiphyse, de Bergmann et de Müller). En effet, il a été proposé
précédemment qu’elle pouvait être commune pour tous ces types cellulaires, d’après des
similitudes morphologiques et biochimiques et l’expression partagée de certains marqueurs
tels GFAP, S100, O4, p75 et ERα (Cameron & Rakic 1991; Gudino-Cabrera & NietoSampedro 2000). Le lignage de la glie engainante du bulbe olfactif semble toutefois assez
éloigné des autres types d’aldynoglie, puisqu’elle dérive de la placode olfactive et a donc une
origine périphérique (Wewetzer et al. 2002). Il serait alors surprenant qu’elle descende
d’OPC. Par contre, le lignage des autres populations d’aldynoglie demeure en grande partie
méconnu. A ma connaissance, l’origine des tanycytes et de la glie de l’épiphyse n’a pas été
étudiée, et celle des glies de Bergmann et de Müller l’a seulement été par histochimie
(Bhattacharjee & Sanyal 1975; Edwards et al. 1990; Sievers et al. 1994; Peterson et al. 2001).
Ces lignages gliaux particuliers restent donc à vérifier par des méthodes de traçage,
notamment génétique.
C. Mise en évidence de l’hétérogénéité des cellules gliales et de la
complexité de leurs lignages
En fait, l’intérêt majeur de mon étude pour une compréhension globale de la glie a été
de révéler la complexité des lignages gliaux. En montrant que les pituicytes appartiennent au
lignage oligodendrocytaire, je me suis rendu compte de combien les frontières entre les soustypes de glie sont floues. Les différentes cellules gliales devraient être considérées non pas
comme des ensembles bien distincts mais comme un éventail de sous-populations comprenant
les astrocytes et les oligodendrocytes, mais aussi une multitude de populations intermédiaires
et chevauchantes. Au sein même d’une population donnée, il peut également exister une
grande hétérogénéité. Je l’ai constaté parmi les pituicytes (Article 2), ainsi que parmi les
oligodendrocytes et les cellules NG2+ du cerveau adulte qui me servaient de témoins positifs
pour les marqueurs gliaux. Cette variété avait déjà été remarquée auparavant. En effet,
différentes caractéristiques morphologiques, biochimiques et fonctionnelles ont depuis
longtemps permis de distinguer plusieurs types d’oligodendrocytes (Miller 2002). Plus
récemment, des groupes ont également cherché à définir la population d’oligodendrocytes en
se basant sur l’expression de marqueurs comme Olig1, Olig2 ou Nkx2.2 (voir par exemple
77
Kitada & Rowitch 2006). Cependant, ces études n’en sont qu’à leurs débuts et il reste à établir
la correspondance avec les sous-types d’oligodendrocytes définis morphologiquement et
biochimiquement d’une part, et d’après l’expression de marqueurs d’autre part. De même, les
cellules NG2+ (dites « OPC adultes » ou « synantocytes ») présentes chez l’adulte constituent
une population cellulaire hétérogène (Polito & Reynolds 2005). C’est justement dans
l’optique de clarifier le phénotype de ces cellules (oligodendrocytes et OPC adultes) que mon
équipe a lancé une étude concernant leur expression d’une large gamme de marqueurs gliaux,
dans différentes régions du SNC adulte intact. Ces résultats seront ensuite à compléter au
moyen d’analyses fonctionnelles, par électrophysiologie notamment, afin de caractériser ces
sous-populations d’OPC adultes et de tenter de comprendre leur rôle. Nous espérons ainsi
parvenir à une représentation peut-être plus complexe mais surtout plus exacte des
populations gliales adultes. Ces données fondamentales permettront peut-être aux chercheurs
de demain de mieux comprendre le fonctionnement du SNC et ainsi d’en limiter les
dysfonctionnements.
78
ANNEXE : RESULTATS COLLABORATIFS
Dans cette dernière partie sont présentés des résultats obtenus en collaboration avec
d’autres groupes de recherche, au sein de mon institut et à l’hôpital de la Timone (Marseille).
D’une part, j’ai participé à des études sur la migration et la différenciation de cellules souches
et progénitrices de ZSV après transplantation à différents endroits du cerveau de souris adulte.
Il est en effet crucial de pouvoir estimer les potentiels de migration et de différenciation de
ces cellules pour pouvoir ensuite élaborer des stratégies de thérapie cellulaire de maladies
neurodégénératives. D’autre part, j’ai contribué à deux études ayant pour but d’améliorer la
classification des tumeurs gliales du SNC et de mieux comprendre leur genèse.
C’est essentiellement par ma connaissance des lignages neuraux et des marqueurs
cellulaires, notamment gliaux, que j’ai contribué à ces études. De plus, j’ai transmis à mes
collaborateurs certains savoir-faire acquis lors de mes travaux sur la neurohypophyse, en
particulier la technique d’hybridation in situ sur coupes et celle de tri cellulaire magnétique
(MACS), que j’avais déjà employée pour sélectionner les OPC de la neurohypophyse
périnatale (Article 1).
A. Migration et différenciation des cellules de la zone sousventriculaire de souris après transplantation dans différentes
régions du cerveau adulte
I. Introduction
1. Neurogenèse adulte : le système ZSV-RMS-BO
Contrairement à ce qui a longtemps été affirmé, le système nerveux adulte maintient
en son sein une population de cellules souches qui génère de nouveaux neurones dans des
zones spécifiques du cerveau. L’une de ces régions est la partie antérieure de la zone sousventriculaire (ZSV), qui borde la paroi des ventricules latéraux. Tel qu’illustré sur la
figure 23, les cellules souches de la ZSV donnent naissance à des progéniteurs (appelés
cellules C, ou progéniteurs d’amplification transitoire) qui se divisent rapidement pour
générer des précurseurs neuronaux (cellules A). Ces derniers migrent en chaînes le long d’un
trajet bien défini, le flux migratoire rostral (Rostral Migratory Stream ou RMS) jusqu’au
bulbe olfactif (BO), où ils se différencient en interneurones GABAergiques et
dopaminergiques (Lois & Alvarez-Buylla 1994; Doetsch & Alvarez-Buylla 1996; Doetsch et
al. 1997; Doetsch et al. 1999; Alvarez-Buylla et al. 2001).
79
Figure 23 : Neurogenèse dans le système olfactif de rongeur adulte
Le processus de neurogenèse secondaire dans le système olfactif est schématisé sur une
coupe parasagittale de cerveau de rongeur adulte colorée au violet de crésyl. Des cellules
souches neurales (cellules B) résident dans la zone sous-ventriculaire (ZSV) du cerveau de
rongeur adulte. Elles y prolifèrent lentement et génèrent des progéniteurs d’amplification
transitoire (cellules C). Ceux-ci se divisent rapidement et donnent naissance à des
précurseurs neuronaux (cellules A), qui migrent en chaînes le long du Rostral Migratory
Stream (RMS). A leur arrivée dans le bulbe olfactif (BO), ils adoptent un mode de migration
radiaire puis se différencient en interneurones.
2. Intérêt pour la thérapie cellulaire
La découverte de cette neurogenèse adulte a suscité de grands espoirs pour le
traitement de maladies neurodégénératives. En effet, une approche thérapeutique possible
consisterait à transplanter ou recruter les cellules souches ou précurseurs multipotents
présents dans le cerveau mature et à orienter leur migration vers les lésions et leur
différenciation dans le type cellulaire perdu (Gage 2000). Des études récentes ont justement
montré que des lésions cérébrales (ischémie ou traumatisme) entraînent un recrutement des
cellules souches ou progénitrices endogènes de la ZSV vers les lésions, où elles se
différencient de façon à remplacer les cellules affectées (Arvidsson et al. 2002; Nakatomi et
al. 2002; Jin et al. 2003). D’autres travaux ont mis en évidence que des progéniteurs de la
ZSV ou du RMS peuvent être recrutés vers des lésions démyélinisantes (Nait-Oumesmar et
al. 1999; Picard-Riera et al. 2002). Cependant, ces tentatives naturelles de réparation ne
suffisent pas à obtenir un rétablissement fonctionnel complet. Afin de pouvoir utiliser les
cellules souches adultes pour la réparation du SNC par transplantation ou recrutement à partir
de leur zone de genèse, il est nécessaire de mieux comprendre les bases moléculaires et
80
cellulaires qui gouvernent la prolifération, la migration et la différenciation des cellules de la
ZSV.
3. Modèle de transplantation hétérotypique pour étudier les potentialités
des cellules de ZSV
Afin d’étudier les potentialités des cellules de la ZSV en termes de survie, de
migration et de différenciation in vivo, la technique la plus appropriée est la greffe
hétérotypique de cellules de ZSV. Dans nos études, pour suivre le devenir des cellules
greffées, nous les avons prélevées sur des souris génétiquement modifiées, exprimant une
protéine verte fluorescente (enhanced GFP ou EGFP) sous le contrôle du promoteur de
l’actine (Hadjantonakis et al. 1998). Ainsi, toutes les cellules de ces souris peuvent être
repérées grâce à ce gène rapporteur. Il est ensuite possible de compter les cellules qui ont
survécu, de mesurer la distance parcourue à partir du point d’injection, ou encore d’étudier
leur différenciation en examinant leur expression de marqueurs caractéristiques.
Notons que ce type de greffes est classiquement effectué à partir de ZSV immature et
dans des animaux hôtes assez jeunes, souvent nouveau-nés, afin de favoriser l’intégration des
cellules greffées dans le tissu et dans l’optique d’examiner leur participation à la neurogenèse
et à la gliogenèse en cours. Or, l’objectif ultime de nos études est d’utiliser les cellules de la
ZSV pour des thérapies chez l’adulte. Il est par conséquent indispensable de tester leurs
potentialités de survie, de migration et de différenciation dans un contexte mature. Les
travaux présentés ci-dessous ont donc été faits sur des souris hôtes adultes et à partir de ZSV
de souris nouveau-nées mais aussi adultes.
II. Résultats
I. Article 3 : Conversion gliale de précurseurs neuronaux issus de la zone
sous-ventriculaire après transplantation ectopique dans le cerveau adulte
(Seidenfaden et al. 2006)
Dans ce travail, j’ai collaboré avec l’équipe du Dr Cremer, dans notre institut, afin
d’étudier le devenir de précurseurs neuronaux transplantés dans différentes zones du cerveau
adulte. Notre objectif était d’analyser leur survie et d’établir leur potentiel de différenciation
en neurones et cellules gliales dans un environnement cérébral adulte différent de leur
environnement neurogénique normal (le système RMS-BO). Nous avons choisi le striatum
pour implanter les greffons car cette structure est affectée dans des maladies
81
neurodégénératives. En particulier, dans la maladie de Parkinson, le striatum perd ses
afférences dopaminergiques en provenance de la substance noire.
Dans des expériences témoins, nous avons transplanté des morceaux de ZSV de souris
EGFP de façon homotypique dans la ZSV de souris sauvages : les cellules greffées se sont
intégrées au RMS, ont migré jusqu’au bulbe olfactif et s’y sont différenciées en neurones. Par
contre, trois semaines après transplantation dans le striatum adulte, les cellules de ZSV n’ont
pas migré et ne se sont pas différenciées en neurones : certaines ont survécu (et ce, au moins
jusqu’à six mois) mais, d’après leur morphologie et l’expression de marqueurs, semblent
s’être différenciées en cellules gliales. En effet, la moitié des cellules greffées présentent des
caractéristiques d’astrocytes (GFAP+, vimentine+) et l’autre moitié, d’oligodendrocytes
(Olig2+, CNPase+). Par ailleurs, nous avons obtenu des résultats similaires lorsque les
cellules avaient été greffées dans le cortex moteur et le thalamus.
Afin de déterminer si les deux types cellulaires observés dérivaient de souspopulations différentes, nous avons isolé parmi les cellules de la ZSV les précurseurs engagés
dans la voie neuronale (cellules A2B5-/PSA+) en utilisant le tri cellulaire magnétique
(MACS). Ici encore, nous avons observé que les cellules greffées triées génèrent les deux
mêmes types de cellules gliales, dans les mêmes proportions que sans le tri.
Ainsi, notre étude a démontré que les précurseurs neuronaux de la ZSV se
différencient en cellules gliales et non en neurones lorsqu’ils sont transplantés dans le
striatum, le cortex ou le thalamus adultes. Si l’on souhaite orienter la différenciation de
précurseurs de la ZSV vers une destinée neuronale, comme dans le cas du Parkinson,
l’environnement non neurogénique de ces régions devra donc être modifié ou les cellules
manipulées avant leur greffe. En revanche, ces résultats augurent bien de l’utilisation
potentielle de ces cellules si l’on désire obtenir des cellules gliales, notamment des
oligodendrocytes, par exemple dans des cas de maladies démyélinisantes.
2. Article 4 : Potentiel de migration et de myélinisation de progéniteurs
neuraux de la zone sous-ventriculaire dans les faisceaux de matière blanche
du cerveau de rongeur adulte (Cayre et al. 2006)
Cette seconde étude, menée au sein de mon laboratoire par le Dr Cayre, avait
justement pour objectif de développer une stratégie de remplacement cellulaire pour
promouvoir la remyélinisation dans des pathologies démyélinisantes.
Chez l’homme, la maladie démyélinisante la plus fréquente est la sclérose en plaques,
qui affecte le SNC chez le jeune adulte. La démyélinisation y apparaît sous forme de plaques
82
disséminées dans l’ensemble du SNC et particulièrement au niveau de la matière blanche
périventriculaire (Barnard & Triggs 1974, cité dans Gean-Marton et al. 1991). Le
remplacement cellulaire constitue une stratégie de réparation du SNC envisageable pour la
sclérose en plaques, comme pour de nombreuses maladies neurodégénératives (Bjorklund &
Lindvall 2000; Lindvall & Kokaia 2006). Dans cette optique, une possibilité thérapeutique est
le recrutement in situ des cellules souches du cerveau adulte.
Dans ce contexte, il avait déjà été démontré que les cellules de la ZSV peuvent être
recrutées au niveau de lésions démyélinisantes et se différencier en oligodendrocytes.
Cependant cette réponse spontanée restait faible (Nait-Oumesmar et al. 1999; Picard-Riera et
al. 2002). Afin de la favoriser, on pouvait envisager d’optimiser trois paramètres dans le
cerveau adulte:
1. le nombre de précurseurs neuraux recrutés à partir de la ZSV/du RMS;
2. la migration/dispersion de ces cellules vers les lésions, hors de leur trajet normal (le RMS);
3. leur survie et leur différenciation en oligodendrocytes myélinisants.
Dans notre analyse, nous nous sommes affranchis du problème du recrutement en
effectuant des transplantations de morceaux ou de cellules de ZSV dans le cerveau de souris
adulte et nous nous sommes concentrés sur les questions de migration et de différenciation en
oligodendrocytes. Des études précédentes n’avaient pas permis de montrer que les
progéniteurs de la ZSV peuvent migrer sur de longues distances en dehors du RMS (Herrera
et al. 1999). De plus, la capacité de ces cellules à générer efficacement des oligodendrocytes
myélinisants n’avait pas été établie in vivo dans le cerveau adulte.
Lors de notre étude, nous avons observé que les cellules de ZSV adultes peuvent
migrer sur des distances importantes, de l’ordre du millimètre le long des faisceaux de fibres
sous-corticales (corps calleux et cingulum). Ces migrations ne semblent influencées ni par
l’état des cellules au moment de la transplantation (morceaux de ZSV, cellules dissociées ou
neurosphères) ni par l’âge des souris donneuses (nouveau-nées ou adultes). Par contre, la
distance de migration est plus grande 22 jours après la greffe que 7 jours après, ce qui indique
que les cellules greffées poursuivent leur migration pendant ce temps. Qui plus est, nombre de
ces cellules expriment des marqueurs du lignage oligodendrocytaire (Olig2, NG2) et sont
capables de générer des oligodendrocytes matures myélinisants (MBP+) lorsqu’elles sont
transplantées dans des cerveaux de souris shiverer déficientes en myéline. Enfin, nous avons
voulu déterminer quelles sous-populations de cellules de la ZSV donnent naissance à ces
oligodendrocytes. Par tri cellulaire magnétique, nous avons sélectionné les progéniteurs
neuronaux PSA+ (type A) qui, après transplantation, ont généré des oligodendrocytes
83
Olig2+/MBP+ aussi bien que la fraction de cellules PSA- (toutes les autres populations de
cellules de la ZSV).
III. Discussion
1. Les cellules de la ZSV migrent efficacement le long des fibres souscorticales
Ces deux études confirment que les cellules de ZSV, même néonatales, ne migrent pas
après transplantation dans de nombreuses zones du cerveau adulte, en particulier le cortex, le
thalamus et le striatum, tel que montré précédemment (Herrera et al. 1999). Par contre, elles
migrent sur de longues distances lorsqu’elles sont greffées au niveau des faisceaux souscorticaux de matière blanche. C’est, à notre connaissance, la première démonstration que ces
faisceaux représentent des voies permissives pour la migration de cellules souches ou
progénitrices issues de la ZSV adulte.
Des études précédentes avaient déjà permis d’établir que d’autres types de cellules
(astrocytes en culture, cellules de moëlle osseuse humaine, cellules souches embryonnaires,
cellules tumorales humaines, etc) greffées dans le cerveau de rongeur adulte migrent
préférentiellement le long des fibres myélinisées, notamment le long du corps calleux (voir
par exemple Andersson et al. 1993; Go et al. 1996; Azizi et al. 1998; Hoehn et al. 2002;
Hellmann et al. 2006). Cette permissivité migratoire serait donc une propriété intrinsèque des
fibres sous-corticales et ce, indépendamment du type cellulaire greffé. Elle pourrait
s’expliquer par l’arrangement spatial des fibres dans ces structures, qui favoriserait le passage
des cellules le long des axones. Une alternative serait que des facteurs guidant la migration
soient présents dans ces faisceaux de fibres. Quoi qu’il en soit, on peut envisager d’utiliser ces
structures permissives pour guider la migration de cellules progénitrices vers des lésions
cérébrales. Il se trouve justement que les faisceaux de fibres de la matière blanche, notamment
périventriculaire, sont très souvent touchées dans des maladies démyélinisantes comme la
sclérose en plaques (Barnard & Triggs 1974, cité dans Gean-Marton et al. 1991).
Par ailleurs, dans le cas particulier des cellules de ZSV, une autre étude indique que
leur potentiel de migration in vivo le long du RMS devient plus limité après culture sous
forme de neurosphères, qu’il s’agisse de sphères issues de ZSV de souriceaux nouveau-nés ou
de souris adultes (Soares & Sotelo 2004). De même, nous avons observé que les précurseurs
amplifiés in vitro sous forme de neurosphères migrent légèrement moins loin le long des
faisceaux sous-corticaux que les cellules de ZSV non amplifiées, mais cette différence n’est
84
pas significative. On pourrait penser que nos résultats diffèrent de ceux de Soares et Sotelo à
cause de différences dans les protocoles d’injection : nous ne dissocions pas les neurosphères
avant de les greffer alors que Soares et Sotelo le font, ce qui pourrait leur être fatal.
Cependant, dans notre laboratoire, des expériences de greffes nous ont également montré que
des cellules issues de neurosphères transplantées dans le RMS ne migrent presque pas par
comparaison avec les transplantations de morceaux de ZSV (observations non publiées). Les
fibres sous-corticales sont donc plus permissives à la migration de ces cellules que le RMS.
Par conséquent, à moins que l’on réussisse à les manipuler pour améliorer leur capacité
migratoire, des neurosphères utilisées dans des stratégies de réparation neuronale devront être
transplantées directement au site de la lésion ou près d’une voie permissive comme les fibres
sous-corticales.
2. Les cellules de la ZSV ont un potentiel neurogénique limité hors du
système ZSV-RMS-BO
Lors de ces deux études, nous n’avons pas pu mettre en évidence la production de
nouveaux neurones à partir de cellules de ZSV en dehors du BO. Les perspectives
thérapeutiques pour des atteintes neuronales semblent donc limitées. Bien sûr, ces résultats
sur le faible potentiel neurogénique des cellules de la ZSV pourraient ne pas s’appliquer à un
tissu lésé : il n’est pas impossible que l’environnement cellulaire modifié au niveau d’une
lésion puisse favoriser la genèse de nouveaux neurones. Toutefois, une transplantation telle
que celles que nous effectuons peut être apparentée à une lésion locale aiguë. Il reste donc à
vérifier comment réagissent les cellules de ZSV transplantées dans un cerveau atteint d’une
lésion plus importante ou chronique, par exemple après une ischémie ou dans un modèle de
maladie neurodégénérative. Quelques auteurs se sont déjà penchés sur la réaction des cellules
de la ZSV endogènes (et non pas transplantées) et leurs résultats sont parfois encourageants :
bien qu’on observe une baisse de la prolifération dans la ZSV dans des modèles de maladie de
Parkinson (Hoglinger et al. 2004), il semble se produire une réorientation des neurones
nouvellement générés vers une différenciation dopaminergique (Winner et al. 2006).
De plus, on peut imaginer modifier le comportement des cellules de la ZSV en les
manipulant en culture avant leur transplantation. Meissner et ses collaborateurs ont d’ailleurs
obtenu des résultats prometteurs sur des modèles animaux de la maladie de Parkinson : dans
des souris lésées à la 6-hydroxydopamine, des progéniteurs multipotents obtenus à partir de
ZSV adulte, amplifiés sous forme de neurosphères puis greffés dans le striatum lésé peuvent y
85
former des neurones dopaminergiques (Meissner et al. 2005). Cette transplantation induit
également une amélioration fonctionnelle au niveau moteur.
Enfin, tous ces résultats doivent être vérifiés chez l’humain. Il semblerait d’ailleurs
que les cellules de la ZSV humaine aient une destinée très différente de celles de rongeurs. En
effet, même si la ZSV adulte humaine contient des cellules en prolifération et peut générer des
neurones in vitro, on n’observe pas ou très peu de neuroblastes en migration chez l’humain
(Sanai et al. 2004; Quinones-Hinojosa et al. 2006). Le rôle principal des cellules humaines en
prolifération reste donc à élucider.
3. Intérêt thérapeutique des cellules de la ZSV pour les maladies
démyélinisantes
Notre approche a permis d’identifier un potentiel de réparation des lésions
démyélinisantes par différenciation en oligodendrocytes des progéniteurs de la ZSV, que l’on
croyait pourtant majoritairement restreints à une destinée neuronale. En particulier, nous
avons montré que les cellules PSA+ (de type A), considérées comme des progéniteurs
neuronaux, peuvent modifier leur programme de différenciation et former des
oligodendrocytes.
Si les cellules de la ZSV peuvent migrer et se différencier en oligodendrocytes,
comment alors expliquer qu’elles participent si peu à la réparation des lésions de la myéline
(Nait-Oumesmar et al. 1999; Picard-Riera et al. 2002) ? L’étape limitante pourrait être le
nombre de cellules disponibles ou leur recrutement en dehors du système ZSV-RMS-BO. Les
cellules de la ZSV ne sont peut-être pas mises à contribution parce qu’il existe déjà à
proximité des lésions des progéniteurs d’oligodendrocytes, responsables principaux de la
remyélinisation spontanée (Godfraind et al. 1989; Scolding et al. 1998). Cependant, puisque
cette réparation naturelle ne suffit pas, il faut la favoriser, par exemple en augmentant la
prolifération des cellules souches ou progénitrices de la ZSV et/ou les déviant de leur trajet
habituel vers le BO.
Différents travaux suggèrent la possibilité de stimuler l’activation de progéniteurs
endogènes par l’utilisation de facteurs de croissance. Le laboratoire du Dr Baron-Van
Evercooren a montré qu’une injection unique de Fibroblast Growth Factor-2 (FGF-2) ou de
Transforming Growth Factor-alpha (TGFα) stimule la prolifération dans la ZSV et le RMS
(Decker et al. 2002). Cependant, ce traitement n’encourage pas le recrutement vers les lésions
démyélinisantes chez les souris âgées. Dans une autre étude, l’administration de Neuronal
Growth Factor (NGF) chez des rats atteints d’encéphalomyélite auto-immune expérimentale
86
(EAE), un modèle animal de sclérose en plaques, entraîne une prolifération accrue dans la
ZSV (Triaca et al. 2005). L’action du NGF sur la migration vers les lésions démyélinisantes
n’a, à notre connaissance, pas été analysée. Des études similaires sont en cours dans notre
équipe pour déterminer l’effet d’autres facteurs sur le recrutement des cellules de la ZSV et
du RMS, notamment l’injection intranasale d’Epidermal Growth Factor (EGF), dont le rôle
mitogène et gliogène est déjà connu (Kuhn et al. 1997).
Une stratégie légèrement différente consiste à greffer des cellules qui serviraient à la
fois à la réparation en se différenciant en cellules neurales adéquates et à la stimulation des
cellules progénitrices endogènes en sécrétant des facteurs trophiques et/ou chimio-attractants.
C’est une approche déjà expérimentée par le laboratoire du Dr Bjorklund, en Suède, pour
régénérer des neurones (voir par exemple Martinez-Serrano et al. 1995). Notre laboratoire est
en train de la tester dans des modèles de démyélinisation.
Selon une approche complémentaire et globale, nous testons dans le laboratoire si un
enrichissement environnemental et social peut favoriser les tentatives naturelles de réparation.
En effet, un tel enrichissement induit une augmentation locale des niveaux de neurotrophines
dans le cerveau (Pham et al. 1999; Ickes et al. 2000) et peut stimuler la neurogenèse chez des
animaux sains (Kempermann et al. 1997; Kempermann et al. 1998; van Praag et al. 1999).
L'enrichissement peut aussi favoriser la survie neuronale dans des conditions pathologiques
(Young et al. 1999; Carro et al. 2001). Cela se traduit également par des améliorations
comportementales dans des modèles d'ischémie (Biernaskie & Corbett 2001), de maladies de
Huntington (van Dellen et al. 2000), d’Alzheimer (Lazarov et al. 2005) et de Parkinson
(Bezard et al. 2003; Faherty et al. 2005). Notre laboratoire s’est donc intéressé à l’influence
de l’environnement sur des modèles de pathologies démyélinisantes. Les résultats obtenus
montrent que chez des souris atteintes d’EAE, l’enrichissement environnemental retarde et
atténue le déficit fonctionnel. Dans un environnement enrichi, on observe également une
prolifération accrue dans la ZSV, un recrutement plus important de cellules de la ZSV dans
les lésions démyélinisantes ainsi qu’une différenciation plus marquée en oligodendrocytes
(M. Cayre, résultats non publiés). Ainsi, l’enrichissement environnemental mérite d’être
considéré comme une approche non invasive à employer en complément des traitements
chimiques (ou éventuellement cellulaires) des maladies démyélinisantes.
Evidemment, tel que rappelé plus tôt, il est impératif de confirmer tous ces résultats
chez l’humain. Une équipe australienne s’est déjà intéressée à la réaction de la ZSV à la
sclérose en plaques (Petratos et al. 2004). Elle a montré que des cellules exprimant le
récepteur p75 aux neurotrophines (p75NTR) apparaissent parfois dans la ZSV chez des patients
atteints de sclérose en plaques, ce qui suggère que p75NTR pourrait par exemple moduler la
87
survie, le phénotype ou la migration des cellules progénitrices en réponse à la
démyélinisation. Des analyses plus nombreuses chez l’humain sont nécessaires avant de
pouvoir espérer mettre sur pied des thérapies cellulaires fondées sur l’utilisation des cellules
souches de la ZSV.
IV. Conclusion
En résumé, nos études basées sur la transplantation de cellules de ZSV ont abouti à
deux conclusions principales : d’une part, ces cellules peuvent migrer sur de longues distances
le long de faisceaux sous-corticaux de matière blanche et, d’autre part, en dehors de leur
système d’origine, elles adoptent une différenciation préférentiellement gliale et non pas
neuronale. D’un point de vue thérapeutique, ces résultats indiquent que les cellules de ZSV
seraient davantage intéressantes pour la réparation de lésions du SNC dans les maladies
démyélinisantes.
A l’avenir, des recherches devront être menées pour identifier des facteurs (chimiques,
mais également environnementaux) qui permettraient d’améliorer le recrutement des cellules
de ZSV vers les lésions démyélinisantes et de favoriser leur différenciation en
oligodendrocytes.
88
www.elsevier.com/locate/ymcne
Mol. Cell. Neurosci. 32 (2006) 187 – 198
Glial conversion of SVZ-derived committed neuronal precursors after
ectopic grafting into the adult brain
Ralph Seidenfaden,a,* Angélique Desoeuvre,a Andreas Bosio,b Isabelle Virard,a
and Harold Cremer a
a
b
Institut de Biologie du Développement de Marseille, CNRS, Université de la Méditeranée, Campus de Luminy-case 907, 13288 Marseille cedex 9, France
Miltenyi Biotec, Stoeckheimer Weg 1, 50829 Cologne, Germany
Received 5 January 2006; revised 27 March 2006; accepted 6 April 2006
In the adult mouse forebrain, large numbers of neuronal precursors,
destined to become GABA- and dopamine-producing interneurons of
the olfactory bulb (OB), are generated in the subventricular zone
(SVZ). Although this neurogenic system represents a potential
reservoir of stem and progenitor cells for brain repair approaches,
information about the survival and differentiation of SVZ-derived cells
in ectopic brain regions is still fragmentary. We show here that ectopic
grafting of SVZ tissue gave rise to two morphologically distinguishable
cell types displaying oligodendrocytic or astrocytic characteristics.
Since SVZ tissue contains neuronal and glial progenitors, we used
magnetic cell sorting to deplete A2B5+ glial progenitors from the
dissociated SVZ and to positively select cells that express PSA-NCAM.
This procedure allowed the purification of neuronal precursors
expressing TUJ1, DCX and GAD65/67. Transplantation of these cells
led again to the generation of the same two glial cell types, showing that
committed interneuron precursors undergo glial differentiation outside
their normal environment.
D 2006 Elsevier Inc. All rights reserved.
Introduction
In the olfactory system of the postnatal and adult rodent
forebrain, large numbers of new neuronal precursors are generated
in the subventricular zone (SVZ), from where they migrate via the
rostral migratory stream (RMS) to the olfactory bulb (OB). After
radial migration to the periphery of the OB, these precursors finally
become GABAergic and dopaminergic interneurons in the granular
and glomerular layers of the OB (Luskin, 1993; Kosaka et al.,
1995; Alvarez-Buylla and Garcia-Verdugo, 2000). This ongoing
neurogenesis attracted considerable attention over the last years.
* Corresponding author. Fax: +33 4 91 26 9726.
E-mail address: [email protected] (R. Seidenfaden).
Available online on ScienceDirect (www.sciencedirect.com).
1044-7431/$ - see front matter D 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.mcn.2006.04.003
First, the demonstration that new neurons can be generated and
integrated into the existing circuitry fundamentally changed our
view of brain development and function. Second, the adult SVZRMS-OB system became an important model to study the
molecular and cellular mechanisms that underlie neurogenesis in
general. Third, the discovery of comparable neural stem cells and
progenitors in humans raised hope for the use of this adult
neurogenesis for cell-based brain repair (Liu and Martin, 2003;
Bedard and Parent, 2004; Lie et al., 2004; Sanai et al., 2004).
The rodent SVZ consists of at least 6 principal cell types
(Doetsch et al., 1997): committed neuronal precursor cells
migrating to the OB (type A cells), glial cells (type B2 cells,
representing probably the stem cells of the system), astrocytes
(type B1 cells) forming tunnel-like structures around the
migrating neuronal precursors, rapidly dividing progenitors (type
C cells), tanycytes (type D cells), ependymal cells (type E cells)
lining the ventricle and 2% of so far unidentified cells. At least at
the neonatal stage the SVZ also contains glial progenitor cells that
migrate into white matter, cortex and striatum to generate
astrocytes and oligodendrocytes (Marshall et al., 2003). Among
these different cell types, committed neuronal precursor cells are
the best characterized subpopulation, accounting for 33% of SVZ
cells (Doetsch et al., 1997) and probably representing the largest
reservoir of immature but clearly committed neuronal precursor in
the adult brain (Goldman and Luskin, 1998; Alvarez-Buylla and
Garcia-Verdugo, 2000). The neuronal identity of these cells is
defined by ultrastructure and antigenic markers like expression of
the polysialylated form of the neural cell adhesion molecule
(PSA-NCAM), neuronal class III h-tubulin (TUJ1, Doetsch et al.,
1997), doublecortin (DCX, Nacher et al., 2001), GABA (Bolteus
and Bordey, 2004), ER81 and DLX (Stenman et al., 2003).
Furthermore, homotypic grafting of SVZ tissue or retroviral
infection experiments led exclusively to the generation of
interneurons in the granular and periglomerular layers of the
OB (Luskin, 1993; Doetsch and Alvarez-Buylla, 1996; Coskun et
al., 2001; Hack et al., 2002; Hack et al., 2005; Kohwi et al.,
2005).
188
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
A variety of factors that regulate the proliferation and migration
of neuronal SVZ precursors have been described over the past
decade (Hagg, 2005). Thus, neuronal precursors from the SVZ
allow studying the behavior of a well-defined committed neuronal
cell population that is present in the adult brain. A particular
characteristic of these precursors is a clear binary terminal
differentiation behavior, either dopaminergic or GABAergic. This
type of precursors might be suitable for cell therapy approaches
requiring the reconstitution of GABAergic or dopaminergic
transmission like Huntington’s or Parkinson’s Diseases (Cao et
al., 2002; Lindvall et al., 2004).
Despite the obvious potential of these cells for therapeutic
applications, information about their survival and differentiation
in heterotypic positions is still fragmentary and in part
contradictory. It was described that early postnatal mouse SVZ
tissue grafted into the adult striatum showed little or no
migration (Lois and Alvarez-Buylla, 1994) and predominantly
astrocytic differentiation (Herrera et al., 1999), while a study in
rats using early postnatal SVZ cells suggested migration away
from the injection site and the differentiation into a phenotype
morphologically resembling OB interneurons (Zigova et al.,
1998).
In all these studies, a heterogeneous mixture of SVZ cells
containing all of the above-described cell populations was transplanted. However, recent work demonstrated the presence of
additional, non-neuronal types of precursors in postnatal SVZ
tissue, for example an astrocyte precursor population (Staugaitis et
al., 2001) and new multipotent type C-like cells (Aguirre et al.,
2004). Although it appears that gliogenesis from the SVZ does not
persists in the normal adult brain (Marshall et al., 2003),
oligodendrocyte recruitment from the SVZ was described after
lysolecithin-induced demyelination of the corpus callosum (NaitOumesmar et al., 1999), suggesting that glial progenitors cells
persist in the adult structure.
In the above-mentioned grafting studies, the donor cells were
discriminated either by using a neuron-specific enolase-lacZ
reporter (Lois and Alvarez-Buylla, 1994; Herrera et al., 1999)
or by prelabeling with BrdU (Zigova et al., 1998). These
approaches limited the possibilities to determine the phenotype
of the surviving cells by their morphology and immunocytofluorescence. In this work, we analyzed the differentiation and
survival of ectopically grafted SVZ tissue and cells by using
actin-EGFP transgenic donor mice (Hadjantonakis et al., 1998),
which allows a high-resolution morphologic analysis with
multicolor-immunofluorescence. Using the phenotype-independent EGFP-label, we tested a broad panel of differentiation
markers to characterize the fate of surviving cells and describe
two morphologically distinguishable cell types showing specific
glial properties. By grafting purified subpopulations from
dissociated SVZ using magnetic activated cell sorting (MACS),
we identified the surviving cells as derivatives of committed
neuronal precursors. These data reveal the gliogenic potential of
SVZ interneuron precursors after grafting outside their normal
neurogenic environment in the OB. Thus, the use of these cells to
restore neuronal functions requires manipulating their differentiation prior to or during the grafting process, they might be useful
in CNS disorders linked to astrocyte cell death (Broe et al., 2004;
Dienel and Hertz, 2005) and their application in remyelination
attempts is validated (Keirstead et al., 1999; Vitry et al., 2001;
Cayre et al., 2006).
Fig. 1. Homotypic transplantation of SVZ-derived EGFP+ cells into the adult brain results in migration to the olfactory bulb and differentiation into
interneurons. (a) Low magnification EGFP fluorescence of an adult forebrain 4 weeks after transplantation. EGFP-fluorescence allows the visualization of the
host tissue and the graft-derived EGFP+ cells. EGFP+ SVZ-tissue has been grafted into the wild-type subventricular zone underlying the corpus callosum (CC).
EGFP+ cells migrate from the injection site (IS) via the rostral migratory stream (RMS) into the olfactory bulb (OB). In the OB, the cells differentiate into
interneurons of the granular cell layer (GrL) and the glomerular layer (GL), scale bar: 300 Am, the white square in the GL represents the position of the high
magnifications shown in panels b – e. (b) EGFP fluorescence of graft-derived periglomerular cells; (c) NeuN fluorescence showing glomerular neurons; (d)
Hoechst fluorescence; (e) merged EGFP/NeuN/Hoechst fluorescence showing neuronal differentiation of graft-derived cells in the GL, scale bar: 10 Am.
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
Results
Survival and differentiation of transplanted SVZ tissue
Grafting of SVZ tissue from actin-EGFP transgenic donor mice
allowed visualization of EGFP+ cells in the wild-type host
environment (Figs. 1 and 2). After homotypic transplantation,
graft-derived cells underwent migration and differentiation like the
endogenous precursor cells (Fig. 1, Lois and Alvarez-Buylla,
1994). During these processes, EGFP expression in the graftderived cells remained unchanged and after 4 weeks neuronal
differentiation of grafted cells is indicated by expression of NeuN
(Fig. 1). Thus, SVZ cells transplanted into homotypic positions
generated neurons in the OB. Due to its importance as a target
structure for cell therapy, the adult striatum was chosen as ectopic
host environment. Transplanted SVZ cells were clearly identifiable
in the host striatum by their EGFP-fluorescence 3 weeks (Fig. 2a)
and 6 months after transplantation (Fig. 2b). A large portion of
grafted SVZ tissue underwent cell death during the first 3 weeks
after grafting (Figs. 2c and e; white arrowheads indicate strongly
189
fluorescent cellular debris; hatched arrowheads point to morphologically intact cells, n = 16 animals). However, surviving cells
were still evident after 6 months (Figs. 2d and f, n = 3 animals for
each donor tissue). The comparison of neonatal (P5) and adult
(P75)-derived SVZ donor tissue showed the same dynamics of
initial cell death and long-term survival (Figs. 2c – f). The host
tissue at the graft site presented normal gross microanatomy
already 3 weeks after transplantation (Fig. 2g) and grafted cells
were individually integrated in the fiber tracts (striosomes) or the
striatal matrix (Fig. 2h), not showing an evident preference for one
of the compartments. Furthermore, the spatial extension of EGFP+
cells was restricted and no long distance migration occurred in
either case. To compare the survival of SVZ cells from neonatal
versus adult donor tissue, we determined the density of EGFP+
cells in the center of the graft site 3 weeks after transplantation.
Quantitative analysis of confocal image stacks from neonatal tissue
revealed 275 (T115 SD) cells per frame and animal, while P75
tissue resulted in 39 (T11 SD) cells per frame. Accordingly, using
comparable amounts of freshly dissected SVZ tissue from neonatal
or adult SVZ, after dissociation of the tissue but before
Fig. 2. Long-term survival, tissue integration and morphological phenotype of SVZ-derived EGFP+ cells after transplantation into the striatum. Normarski
contrast and EGFP fluorescence (green) showing the site and extent of grafted tissue 3 weeks (a) or 6 months (b) after transplantation. CT: cerebral cortex, CC:
corpus callosum, ST: striatum, LV: lateral ventricle, scale bar: 200 Am. Postnatal day 5 (P5: c, d) and postnatal day 75 (P75: e, f) SVZ tissue 3 weeks (c, e) or 6
months (d, f) after grafting. (c – f) Scale bar: 10 Am, z-stacks: 5.4 Am, EGFP (green), Hoechst 33258 (blue), arrowheads point towards intact cell (black) or
cellular debris (white). (g – h) Integration of grafted cells in the matrix and striosome compartments of the striatum 3 weeks after transplantation: Normarski
contrast (g); EGFP/Hoechst fluorescence (h), scale bar: 200 Am, z-stack: 59 Am. (i) High magnification from panel h showing the two distinct morphologies of
the surviving cells: type 1 and 2, scale bar: 5 Am, z-stack: 15 Am.
190
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
transplantation, we found 8 times less cells for adult tissue (P5: 4 105 T 6 104 SD cells versus P75: 5 104 T 5 103 cells). Thus,
it is likely that the lower number of cells that we found after
transplantation of adult SVZ compared to neonatal corresponds to
the lower number of initially injected cells per tissue volume.
Morphological analysis revealed two clearly distinguishable
cell types. First, a bipolar cell type with an elongated cell soma
carrying large diameter processes (Fig. 2i, cell type 1). Second,
an irregular spherical cell type with highly arborized low
diameter processes (Fig. 2i, cell type 2). Both cell types could
be identified at 3 weeks as well as at 6 months (Fig. 2f)
postgrafting, regardless if neonatal of adult donor tissue was used.
An unequivocal criterion to distinguish the two cell types was the
mean process thickness at the soma border: 4.4 Am for cell type 1
(mean process length 126 Am T 28 Standard Deviation, SD) and
0.4 Am for cell type 2 (the mean process length was not
measurable due to morphological complexity). The morphologies
of the two cell types were clearly different from the phenotypes
observed after homotypic grafting of SVZ cells, where cells
display the typical morphology of either migrating neuroblasts
(leading process 24 Am T 7 SD, trailing process 5 Am T 2 SD),
differentiating neurons or mature interneurons (see Lois and
Alvarez-Buylla, 1994; Hack et al., 2002; Hack et al., 2005).
Each cell type represented about 50% of the surviving cells,
independent of the postnatal stage of the donor mice (Fig. 3a, n = 3
animals for each donor tissue). To determine if the two cellular
phenotypes occurred specifically in response to the striatum (ST)
as a host environment, we also grafted SVZ tissue into the cerebral
motor cortex (CT) and the lateral posterior thalamic nucleus (TH).
Again, the two cell types shown in Fig. 2i in the ST could be
morphologically distinguished in CT and TH (data not shown) and
quantification revealed that each cell type again represented about
50% of the surviving cells in the different host structures (Fig. 3b).
SVZ-derived cells in ectopic positions display glial properties
In the next step, the properties of the two cell types were
analyzed by immunocytofluorescence (Fig. 4) and the use of a
broad panel of differentiation markers. This analysis revealed that
both cell types were characterized by expression of mainly glial
markers (for specificity of the markers, see Satoh and Kim, 1995;
Doetsch et al., 1997; Doetsch et al., 1999; Farrer and Quarles,
1999; Zhang, 2001; Hachem et al., 2005), while mitotic and early
neural markers were not detectable in graft-derived cells (Table 1).
Both cell types expressed S100h (Figs. 4i – l), a protein
expressed in the entire glial lineage. Cell type 1 was also positive
for GFAP (Figs. 4a – d) and Vimentin (Figs. 4q – t), indicative of the
astrocyte lineage, while cell type 2 expressed Olig2 (Figs. 4e – h)
and CNPase (Figs. 4m – p), markers of the oligodendrocyte lineage.
Combination of the morphological properties with the immuncytocharacterization (Table 1) assigned cell type 2 to a non-mitotic,
non-migratory oligodendrocyte phenotype. In contrast, cell type 1
displayed properties of non-mitotic mature astrocytes. This
astrocytic phenotype is also underlined by the observation of
cellular processes contacting blood vessels with an astrocyte-like
endfoot (data not shown, see Simard et al., 2003). Surprisingly, cell
type 1 also expressed glutamate decarboxylase (GAD65/67, Figs.
4u and w) and its product GABA (Table 1). In the SVZ, GABA
represents a marker of neuronal differentiation expressed by the
migrating neuronal precursor cells (Bolteus and Bordey, 2004) and
the majority of terminal differentiated interneurons in the OB
(Kosaka et al., 1995). However, GABA expression was also
described in astrocytes (Lin et al., 1993; Ochi et al., 1993; Jow et
al., 2004) and therefore could either be attributed to glial properties
or represent a rudiment of the originally neuronal commitment of
the grafted cells. Other cellular phenotypes occurred very rarely.
That is, out of 378 analyzed immunoreactive cells, one expressed
NeuN and one NG2 (data not shown).
Purification and transplantation of committed neuronal precursor
cells
As the SVZ contains different neuronal and glial progenitor
populations, we aimed at determining the origin of the generated
two cell types. Therefore, we characterized the different cell
populations and established a protocol to isolate the committed
neuronal precursor subpopulation by using cell surface antigens in
combination with MACS. These experiments were performed with
Fig. 3. Grafted neonatal or adult SVZ tissue shows the same morphological differentiation into distinct cell types 1 and 2, independent of the ectopic target
structure in the host brain. Percentage of the two morphologically distinguishable cell types shown in Fig. 2i (a) after grafting of dissociated SVZ cells from
neonatal (SVZ-P5) or adult (SVZ-P75) animals into the striatum and (b) after grafting into 3 different ectopic positions: striatum (ST), cerebral motor cortex
(CT) or lateral posterior thalamic nucleus (TH, means T SD).
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
191
Fig. 4. Characterization of SVZ cells grafted into the striatum by immunocytofluorescence and neural differentiation markers 3 weeks after transplantation.
Differential expression of astrocytic markers in cell type 1 and oligodendrocytic markers in cell type 2. Grafted EGFP+ cells (green) are morphologically
determined as cell types (1) and (2) by their process diameters. The blue fluorescence corresponds to a nuclear counterstain with Hoechst 33258. (A) EGFPfluorescence (-fl) and double immunostaining against GFAP (red, upper row) and Olig2 (red lower row) show mutually exclusive expression of these markers:
GFAP is expressed in cell type 1 (with thick processes, upper row) and the oligodendroglial marker Olig2 in the nucleus of cell type 2 (lower row). (c, d, f – h)
High magnifications from panels a and e. (a) Hoechst-, GFAP-, EGFP-fl. (b) Normarski contrast and EGFP-fl showing a cell type 1 and 2 lining a striosome fiber
tract. (c) EGFP- and GFAP-fl; (d) GFAP- and Hoechst-fl; (e) Hoechst-, Olig2-, EGFP-fl; (f) EGFP-fl; (g) EGFP- and Olig2-fl (h) Hoechst-, Olig2- fl. Scale bars:
in panel a for panels a, b, e and in panel c for panels c – h: 10 Am, z-stack: 2 Am. (B – E) EGFP-fl and immunostainings (red) against S100h (B), CNPase (C),
Vimentin (D), Glutamate decarboxylase 65/67 (E). (i) Cell type 1, high diameter processes and (j) high magnification from panel i. (k) Cell type 2 and (l) high
magnification from panel k. (m) Cell type 2 and (n) high magnification from panel m. (o) Cell type 1 and (p) high magnification from panel p. (q) Cell type 1,
high diameter processes and (r) high magnification from panel q. (s) Cell type 2 and high diameter process cell type 1. (t) High magnification from panel r. (u)
Cell type 1 and 2. (v) High magnification cell type 2 from panel u and (w) high magnification of cell type 1 from panel u. Scale bars (i – w): 10 Am, z-stack: 2 Am.
192
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
Table 1
Morphological and immunocytochemical phenotype of SVZ cells 3 weeks
to 6 months after grafting
Cell
Type 1
Type 2
Morphology
54% elongated
bipolar few
bifurcations
4.4 – 0.3 Am
46% spherical
irregular arborized
+
+
+
+
Process diameter
Immunofluorescence markers
Early neural
Glial
Neuronal
Ki-67, GD2, Nestin,
PSA, CD24
S100h
m/p GFAP
Vimentin
Olig-2
NG2
CNPase
MBP
TUJ1, Nf, MAP-2
Calretinin, Calb.
NeuN
Th
ChAt
Gad65/67, GABA
0.4 – 0.02 Am
+
+
+
m/p: mono/polyclonal; marker abbreviations, see Table 2.
neonatal SVZ, since this tissue produced the same cell phenotypes
after grafting (Fig. 3a) but contained higher cell numbers when
compared to P75 tissue (see above), thereby making it easier to
obtain sufficient cells for the sorting procedure.
Committed neuronal precursor in the SVZ has been shown to
express neuronal class III h-tubulin (TUJ1) and PSA-NCAM
(Doetsch et al., 1997). Accordingly, after 1 h in vitro, dissociated
neonatal SVZ cells include a majority of TUJ1+ cells that also
present the surface antigen PSA-NCAM (PSA, Figs. 5a and c, cell
type i). Furthermore, the tissue contains oligodendrocyte progenitors expressing PSA and A2B5 (Ben-Hur et al., 1998; Farrer and
Quarles, 1999, Figs. 5a and c, cell type ii) and glial or O2A
oligodendrocyte progenitors that expressed only A2B5 (Figs. 5a –
c, cell type iii, Dietrich et al., 2002). The identity of glial
progenitors was further confirmed by expression of CD44 in
A2B5+/PSA-NCAM cells (Fig. 5b, cell type iii, Bouvier-Labit
et al., 2002; Liu et al., 2004).
Based on this information, we devised a two-step protocol of
MACS. In a first step, the SVZ cell suspension was incubated
with A2B5 specific and magnetic bead-linked antibodies to
remove the A2B5+ cells. The A2B5 depleted cell suspension was
subsequently incubated with PSA-specific and magnetic bead
linked antibodies to isolate PSA-NCAM+ cells. This protocol
allowed us to isolate 2 subpopulations: the A2B5+ fraction
(corresponding to enriched glial progenitors) and the A2B5 /
PSA-NCAM+ fraction (corresponding to committed neuronal
precursors).
Using this immunopurification by MACS from 6 106
dissociated cells, an average of 1.1 106 A2B5+ cells and 1.4
106 A2B5 /PSA-NCAM+ cells were recovered. In vitro
characterization of unsorted SVZ suspensions by immunocytofluorescence showed that 62% (T4.2 SD) of the cells were TUJ1+,
and thus represented neuronal precursors (Figs. 6a and b). Of the
remaining cells, 36% expressed A2B5 (Fig. 6a), a subpopulation
was TUJ1+/A2B5+ (2% T 1.6), and 3% T 1.2 of the cells were
TUJ1 /PSA-NCAM /A2B5 (data not shown). In the A2B5+
selected fraction, a relatively high number of TUJ1+ cells were
observed (39% T 3.7; Figs. 6a and b). Lastly, the positive selection
for PSA-NCAM from the A2B5-depleted flow through resulted in
a 98% (T1.6) pure population of TUJ1+ neuronal precursor cells,
nearly all of them (99% T 1) co-expressed PSA-NCAM (Figs. 6a
and b). The neuronal identity of this SVZ fraction was further
confirmed by expression of Gad65/67 in 93% (T2.7) and DCX in
96% (T0.3) of the cells (Fig. 6a). Thus, the antigenic expression
profile of this SVZ cell type in vitro indicated that they did not
correspond to multipotent precursors (type C cells), but represent
neuronal precursors corresponding to type A cells (Doetsch et al.,
1997; Aguirre et al., 2004).
We then compared the differentiation and survival of the
unsorted, A2B5+ or A2B5 /PSA-NCAM+ SVZ-fractions after
transplantation into the striatum. For each condition, 5 104 cells
were injected into the host striatum. Three weeks after grafting, all
three suspensions exclusively led to the generation of the two
described glial cell types above (Fig. 6c). Moreover, the relative
percentage of the two cell types was similar in control and sorted
cells (Fig. 5d). Interestingly, the amount of these surviving glial
cells was negatively correlated with the amount of injected A2B5+
cells (compare Figs. 6e and f), while there was a striking positive
correlation with the number of injected TUJ1+ cells (compare
Figs. 6b and f). This strongly indicates that the surviving cells
displaying glial properties originate from the committed neuronal
precursors.
Discussion
The present study investigates the survival and differentiation
of neonatal and adult SVZ tissue, after grafting into ectopic
positions of the adult brain. Our study leads to three major
conclusions. First, SVZ-derived cells are able to survive in
ectopic brain regions for at least 6 months. Second, the SVZ-cells
differentiate into two cell types displaying either oligodendrocytic
or astrocytic characteristics. Third, these surviving glial cells
originate from committed interneuron precursors.
These results have a general significance for cell therapeutic
approaches in the adult brain. First clinical studies indicated that
transplantation of fetal neurons can abrogate the clinical manifestations of neurodegeneration in Huntington’s or Parkinson’s
Diseases. Since there are a number of problems with the use of
human fetal tissue in clinical trials, alternative sources of
transplantable cells are required. Important candidates are in vitro
differentiated embryonic stem cells and neural stem cells that have
been expanded as neurospheres. Both approaches include the risks
of inducing neoplasms through the grafting of immature cells.
Furthermore, in general, impure cell populations with low numbers
of the desired neuronal phenotype are used for transplantation
(reviewed in Bjorklund and Lindvall, 2000; Cao et al., 2002;
Lindvall et al., 2004).
In principle, SVZ precursors represent an alternative source of
transplantable cells both present in the adult and committed to
neuronal differentiation. Although the comparability of human and
mouse olfactory neurogenesis is still a matter of debate, there is in
vitro (Kirschenbaum et al., 1994) and in vivo evidence for the
presence of interneuron precursors in adult humans (Liu and
Martin, 2003; Bedard and Parent, 2004; Sanai et al., 2004; Lie et
al., 2004). In addition, it appears likely that precursors, like the
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
193
Fig. 5. Characterization of glial progenitor cells in dissociated cultures from the neonatal SVZ after 1 h in vitro. (a) Triple-immunofluorescence for A2B5, PSANCAM (PSA) and TUJ1 reveals three different cell types (i – iii) that can be classified as different progenitors as indicated in panel c. (i) Committed neuronal
precursors, (ii) migrating oligodendrocyte preprogenitors and (iii) glial progenitors that can give rise to astrocytes or oligodendrocytes. (b) Staining for A2B5,
PSA-NCAM and CD44 confirms the glial identity of A2B5+/PSA-NCAM cells. Scale bar: 10 Am.
ones present in mouse SVZ, represent differentiation intermediates
in all neurogenetic events. In case such cells can be produced and
purified in sufficient quantities in vitro, they might represent an
interesting candidate for transplantation-based therapy in the
nervous system.
Only two previous studies used grafting approaches to
investigate the differentiation of SVZ-derived tissue in ectopic
brain positions. Herrera et al. (1999) used electron microscopy in
association with grafts derived from mice carrying a neuronspecific enolase (NSE) promoter to express LacZ as a transgene.
Their finding of predominantly astrocyte-like cells showing coexpression of NSE-LacZ, rather a neuronal marker, is in agreement
with our observation that the astrocytic subpopulation co-expressed
the neuronal marker GABA. Furthermore, in the absence of a pancellular marker like actin-EGFP, it is well possible that the
immature oligodendrocyte-like type 2 cells that we describe here
were not detected. Indeed our analyses showed that, unlike in
astrocyte-like type 1 cells, all analyzed neuronal markers are absent
from cell type 2. Thus, it appears probable that the NSE promotor
was not active in type 2 cells, making their identification as graftderived cells impossible. A further discrepancy concerns the
existence of cells with characteristics of chain migrating neuro-
blasts in the surviving graft, which have been described in the
study by Herrera et al. (1999). In our experiments, neither the use
of antigenic markers like PSA-NCAM or TUJ1, nor close
morphological observation revealed the existence of type A cells,
even after a short survival time of 3 weeks.
A second publication by Zigova et al. (1998) also investigated
the consequences of SVZ-tissue grafting. This work showed more
striking contradictions with the outcome of our study. The authors
describe the predominant generation and long-term survival of
cells with characteristics of OB interneurons, a phenotype never
observed in our experimental setups. However, several experimental differences might account for these differences. First, the
authors performed 6-OHDA lesion of the dopaminergic neurons in
the substantia nigra before the grafting of postnatal SVZ tissue into
the striatum. Although Herrera et al. (1999) showed that the
behavior of grafted cells was largely independent of precedent
lesions in the target structure, this might explain the acquisition of
a neuronal phenotype. Along this line, it was shown that precedent
lesions can improve the survival of transplanted fetal striatum cells
(Mundt-Petersen et al., 2000). Nevertheless, the inconsistencies
might also be due to differences in the identification and
characterization of grafted cells. While our study relies on
194
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
Fig. 6. Purification of SVZ subpopulations by magnetic-activated cell sorting (MACS) using the cell surface antigens A2B5 and PSA-NCAM (PSA). (a) In
vitro analysis of dissociated cells from the neonatal SVZ after MACS. Immunofluorescence for TUJ1, GAD65/67 (GAD) or DCX (neuronal precursors,
green) and A2B5 (glial progenitors, red) in the different fractions; control: unsorted SVZ cells, A2B5+: SVZ cells positively selected for A2B5 expression,
A2B5 /PSA+: SVZ cells depleted of A2B5+ cells and positively selected for PSA-NCAM+ cells. Scale bar: 50 Am. (b) Quantification of neuronal precursors
identified by TUJ1 expression in control (unsorted) and the different MACS-purified cell fractions A2B5+ and A2B5 /PSA+ after 1 h in culture, means T
standard error of the mean (SEM). (c) Cell morphologies of A2B5 /PSA+-purified neuronal precursor cells from the SVZ 3 weeks after transplantation into
the striatum reveal the same distinct cells types (type 1 and 2) as transplantation of the whole tissue (Fig. 2h and i). Scale bar: 10 Am, z-stacks: 3.6 Am. (d)
Percentage of the two morphologically distinguishable cell types shown in Fig. 2i after grafting of the different MACS-purified cell fractions (unsorted,
A2B5+ and A2B5 /PSA+, means T SEM). (e) Quantification of A2B5 expressing cells in control (unsorted) and the different MACS-purified cell fractions
(A2B5+ and A2B5 /PSA+, means T SEM). (f) Number of surviving cells 3 weeks after transplantation of 50,000 EGFP+ control (un-sorted) or MACSpurified cells (means T SEM).
genetically labeled graft tissue in combination with multiple
immunological labelings and confocal microscopy, Zigova et al.
(1998) used mainly morphological criteria to identify long-term
surviving cells. But since small neurons such as OB interneurons
look similar in size, shape, and tinctorial properties to glia (Rakic,
2002), a doubtless distinction by cresyl violet staining and
morphology is a difficult task.
Both studies discussed above used whole SVZ tissue as grafting
material. However, it was shown that, both in the neonatal and in
the adult animal, the SVZ is a heterogeneous tissue containing a
variety of differentiated as well as stem and progenitor cell types
(Doetsch et al., 1997; Marshall et al., 2003). Many progenitor cell
types have been characterized by differential expression of cell
surface markers. The large population of committed neuronal
precursors expresses the cell surface marker PSA-NCAM (Doetsch
and Alvarez-Buylla, 1996). Oligodendrocyte preprogenitors are
also positive for PSA-NCAM (Ben-Hur et al., 1998) but co-express
A2B5 (Farrer and Quarles, 1999). Glial progenitors express A2B5
(Dietrich et al., 2002) and CD44 (Bouvier-Labit et al., 2002; Liu et
al., 2004), but are negative for PSA-NCAM (Mayer-Proschel et al.,
1997). All the different types of mature astrocytes, oligodendrocytes, and ependymocytes lack PSA-NCAM expression (Doetsch
et al., 1997). Based on these cell surface markers, we devised a
MACS-based method that allows the purification of the committed
neuronal precursor subpopulation from the heterogeneous SVZ.
We depleted A2B5+ cells and positively selected PSA-NCAM+
cells from the remaining cell population. The A2B5 /PSANCAM+ population was characterized by homogenous expression
of an antigen pattern demonstrating neuronal commitment (PSANCAM+/TUJ1+/DCX+/GAD65/67+), typical of adult neuroblasts
in vivo (Doetsch et al., 1997; Nacher et al., 2001; Bolteus and
Bordey, 2004). Surprisingly, grafting of this population did neither
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
lead to higher cell death nor to the survival of cells with neuronal
phenotypes, but again gave rise to the two cell types with astrocytic
or oligodendrocytic properties. The general survival rate of
transplanted cells was low (2.5 – 4.3% of the injected cells) and it
appears possible that the surviving cells derived from a specific
subpopulation of the A2B5 /PSA-NCAM+ cells that are solely
able to survive. In case of the existence of such a subpopulation,
they are included in the PSA-NCAM+/TUJ1+/DCX+/GAD65/67+
cells, the SVZ fraction which correlated with the number of
surviving cells. This raises further the question if such a population
is homogenous or if it includes two different precursors, each one
responsible for the generation of one of the two cell types. The
existence of separate precursor populations would be a prerequisite
to specifically isolate and use cell type 2 (displaying oligodendrocyte characteristics) for remyelination attempts (Keirstead et al.,
1999; Vitry et al., 2001, Cayre et al., 2006) or cell type 1 (showing
astrocytic properties) in CNS disorders due to loss of astrocytes
(Broe et al., 2004; Dienel and Hertz, 2005).
Adult neurogenesis is considered to be possible within a
particular niche that allows neuronal differentiation from multipotent progenitors. Inhibition of gliogenic BMP signaling by
noggin has been implicated in the generation of this niche
(Alvarez-Buylla and Lim, 2004; Lie et al., 2004; Ma et al.,
2005). The A2B5 /PSA-NCAM+ committed neuronal precursors
have already received the instructive signals that determine their
neuronal fate. Thus, after ectopic grafting into the striatum, these
precursors receive glial inducing cues that are able to revert the
neuronal commitment. This demonstrates the inhibition of
neuronal differentiation in mature brain tissue outside the
195
neurogenic niches. A multitude of recent reports showed that
under certain experimental conditions, compensatory neurogenesis and recruitment in response to neurodegeneration in
non-neurogenic brain regions are possible (Fallon et al., 2000;
Arvidsson et al., 2002, Lindvall et al., 2004; Goldman, 2005).
This demonstrates that under specific conditions progenitor cells
are able overcome the glia instructing signals of the mature
brain. Discovery of such signals should allow the generation of
tools that can be used for their inhibition. Such tools are
crucially important for the use of SVZ precursors and also other
stem and progenitor cells in therapeutic approaches for neuronal
replacement.
Experimental methods
Mice
Six to ten-week-old C57BL/6 mice were purchased from IffaCredo and
used as host animals. Donor actin-EGFP transgenic mice (Hadjantonakis et
al., 1998) on a C57BL/6 background were produced in our animal facilities.
Animals were housed under standard conditions with ad libitum access to
water and food on a normal 12 h light/dark cycle. Experiments were
performed in accordance with the principles for laboratory animals
published by the French Ethical Committee.
Transplantation
Postnatal day 5 (P5) mice were anesthetized by hypothermia and
killed by rapid decapitation; P75 mice were killed by cervical dislocation.
Brains were dissected out and the hindbrain was removed by cutting
Table 2
Primary antibodies used for immunohistofluorescence
Antigen
Antiserum
Source
Dilution
A2B5
Calb. (Calbindin D28K)
Calretinin
CD24
CD44-FITC
ChAt (choline acetyltransferase)
CNPase (2V3V cyclic nucleotide 3Vphosphodiesterase)
DCX (doublecortin)
GD2
GAD65/67 (glutamate decarboxylase)
GABA (gamma-aminobutyric acid)
GFAP (glial fibrillary acidic protein)
Mouse IgM
Mouse IgG1
Rabbit IgG
Rat IgG
Rat IgG
Rabbit IgG
Mouse IgG1
Guinea pig IgG
Mouse
Rabbit
Rabbit IgG
Mouse IgG1
Rabbit IgG
Rabbit
Mouse IgG1
Mouse IgG1
Mouse IgG1
Mouse IgG1
Mouse IgG1
Rabbit IgG
Rabbit IgG
Rabbit IgG
Mouse IgG2a
Mouse IgM
Rabbit IgG
Rabbit IgG
Mouse IgG2a
Rabbit IgG
Mouse IgM
G. Rougon, Marseille, France
Sigma, Saint Louis, MO
Swant, Bellinzona, Switzerland
G. Rougon, Marseille, France
M. Kursar, Berlin, Germany
Chemicon, Temecula, CA
Sigma
Chemicon
Chemicon
Sigma
Sigma
Sigma
Sigma
abcam, Cambridge, UK
Neomarkers, Westinghouse, CA
Chemicon
Hybridoma Bank, Iowa, IA
Chemicon
Sigma
Sigma
Chemicon
Dana-Farber Cancer Institute, Boston MA
R. Gerardy-Schahn, Hannover, Germany
G. Rougon, Marseille, France
Dako Cytomation, Glostrup, DK
Covance, Berkeley, CA
Covance
Chemicon
Sigma
1:400
1:1000
1:800
1:250
1:200
1:200
1:100
1:500
1:500
1:400
1:200
1:1000
1:800
1 :400
1:200
1:200
1:400
1:200
1:200
1:400
1:200
1:20,000
1:400
1:1000
1:400
1:2000
1:500
1:400
1:200
Ki-67
MAP-2
MBP (Myelin Basic Protein)
Nestin
NeuN
Neurofilament (Nf ) 68, 160, 200 kDa
200 kDa
NG2 (chondroitinsulfate proteoglycan)
Olig2
Polysialic acid (PSA) 735
MenB
S100h
TUJ1 (neuronal class III h-tubulin)
Th (tyrosine hydroxylase)
Vimentin
196
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
between the cerebral cortex and cerebellum. The forebrain was embedded
in 4% agar – agar and cut into 400 Am coronal sections using a vibratome
(Leica). The anterior part of the SVZ was dissected from the striatal wall
in 20 mM HBSS medium (Gibco) using slices between the opening of the
lateral ventricle and the beginning of the hippocampus. SVZ tissue was
cut into explants 100 Am in diameter and stereotaxically grafted into the
striatum, cortex or thalamus using a Kopf apparatus and a 2 Al Hamilton
syringe at the following coordinates: striatum (1.5 mm anterior to bregma,
2.0 mm lateral and 3.0 mm deep), cerebral motor cortex (1.5 mm anterior
to bregma, 2.0 mm lateral and 1.0 mm deep) and lateral posterior thalamic
nucleus (1 mm posterior to bregma, 1.5 mm lateral and 2.0 mm deep). In
the same way, we injected suspensions of SVZ-derived cells, either
unsorted or purified by MACS (procedure: see below), containing 50,000
cells/Al. To assess cell viability and capability to generate neurons, in each
series of grafts, some of the SVZ tissue or cell suspension was
transplanted homotypically into the SVZ of the host animals (1 mm
anterior to bregma, 1 mm lateral and 2.4 mm deep) as previously
described (Lois and Alvarez-Buylla, 1994; Hack et al., 2002).
Three weeks or 6 months after the grafting, the animals were
perfused intracardially with a 3.8% paraformaldehyde solution in
phosphate buffer (PB). Brains were dissected out, postfixed for 24
h and serial sagittal sections (35 Am) were cut with a vibratome. Grafted
EGFP+ cells were detected with a laser scanning microscope and an
argon laser at 488 nm (LSM 510 Meta, Zeiss) and analyzed using a
software module allowing measurements of cell process length and
diameter. To verify the localization of the graft, the host tissue was
additionally visualized by Normarski differential interference contrast.
For quantification of the total number of surviving grafted cells, the host
tissue containing EGFP+ cells was imaged using a 20 magnification
with a confocal z-stack depth corresponding to the section thickness.
Hoechst/EGFP double-positive cell bodies were counted and morphological identification of different cell types was performed on 3 randomly
selected z-stacks per animal.
Immunohistofluorescence
Fixed brains were cryoprotected and frozen in liquid nitrogen with 3
repeated cycles of thawing and freezing. Saggital sections (20 Am) were
serially cut using a freezing sliding microtome (Leica). Immunofluores-
cence staining of free-floating sections was performed with primary
antibodies as listed in Table 2. Sections were blocked for 1 h at room
temperature (RT) in 3% BSA/PB and afterwards incubated for 48 h at 4-C
in fresh blocking solution containing a mixture of two primary antibodies.
The sections were then rinsed in 3% BSA/PB and incubated in blocking
solution with species specific secondary antibodies for 2 h at RT.
Subsequently, the sections were washed, transferred to slides and airdried. Fluorescence was detected using a laser scanning microscope
(Zeiss) with a 405 nm laser diode for Hoechst and lasers for EGFP
(Argon, 488 nm), Cy3 (Helium Neon, 543 nm) and Cy5 or Alexa 633
(Helium Neon, 633 nm).
Dissociation and MACS purification of SVZ tissue
SVZ tissue from 12 postnatal day 5 brains was minced and incubated
with 0.5% trypsin (Gibco) at 37-C for 10 min, after 5 min 0.5 mg/ml
DNAse I (Roche) and 12 mM MgCl2 were added (final volume: 2 ml). The
suspension was gently triturated with fire polished pipettes with decreasing
tip diameters and diluted in 8 ml DMEM containing 10% (v/v) FCS and 1%
(v/v) penicillin/streptomycin (all from Gibco). The cells were centrifuged at
300g for 7 min and the pellet (about 6 106 cells) was resuspended in
200 Al HBSS-BSA (Miltenyi) containing 0.6 Al c-ganglioside-specific
mouse IgM A2B5 ascites (ATCC CRL-1520, kindly provided by G.
Rougon, Marseille) and incubated on a gently rocking rotator at 4-C for 30
min. Afterwards the cells were washed in 10 ml HBSS-BSA with
subsequent centrifugation at 300g for 7 min. The same incubation and
washing conditions were applied for all further antibodies. The pellet was
resuspended in 20% (v/v) anti-mouse IgM MicroBeads (Miltenyi) in 200
Al and, after incubation and washing, resuspended in 1 ml HBSS-BSA.
Cells were separated using an MS Column and a MiniMACSTM Separator
(Miltenyi) according to the manufacturer’s instruction. The A2B5+ fraction
retained in the column was eluted and kept on ice, while the flow-through
was incubated with 5 Ag/ml PSA-specific mouse IgG2a 735 antibody
(kindly provided by R. Gerardy-Schahn, Hannover). Using 20% (v/v) antimouse IgG MicroBeads in 100 Al HBSS-BSA as secondary antibody
against 735, the marked cells were selected by retention in a column placed
in a MiniMACSTM Separator. Based on the expression of respective marker
molecules in vitro, 98% of this A2B5 /PSA-NCAM+ fraction corresponds
to the committed neuronal precursor cells from the SVZ in vivo.
Table 3
Combinations of secondary antibodies for multiple immunofluorescence staining
Combination of primary antibodies
Combination of antiserums
Source
Dilution
Mouse IgM
Mouse IgG
Rabbit IgG
Goat anti-mouse IgM Alexa 488
Goat anti-mouse IgG Fc Cy3
Goat anti-rabbit IgG Cy5
Molecular Probes/Invitrogen Cergy Pontoise, France
Jackson ImmunoResearch Laboratories
Cambridgeshire, UK
1:2000
1:1000
1:800
Mouse IgG
Rabbit IgG
Donkey anti-mouse IgG Cy3
Goat anti-rabbit IgG Cy5
Jackson
1:400
1:800
Mouse IgG
Rabbit IgG
Goat anti-mouse IgG Alexa 633
Donkey anti-rabbit Cy3
Molecular Probes
Jackson
1:1000
1:400
Mouse IgM
Mouse IgG
Goat anti-mouse IgM Alexa 633
Goat anti-mouse IgG Fc Cy3
Molecular Probes
Jackson
1:800
1:1000
Mouse IgM
Rabbit IgG
Goat anti-mouse IgM Cy3
Goat anti-rabbit IgG Cy5
Jackson
1:1000
1:800
Mouse IgG
Rat IgG
Goat anti-mouse IgG Alexa 633
Goat anti-rat Alexa 546
Molecular Probes
1:1000
1:1000
Guinea pig IgG
Mouse IgM
Donkey anti-guinea pig IgG Cy3
Goat anti-mouse IgM Alexa 488
Jackson
Molecular Probes
1:400
1:2000
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
In vitro characterization of SVZ progenitors
Dissociated SVZ cells were cultured in DMEM: Ham’s F12 medium
(3:1) containing 2 mM Glutamax, 1% (v/v) N2 supplement, 1% (v/v)
B27, 1% penicillin/streptomycin (v/v, all from GIBCO).We seeded 50,000
cells per well on poly-l-lysine-coated (0.01%, Sigma) glass coverslips in
4-well plates in 500 Al culture medium. A2B5 ascitic fluid was added
1:400 to the living cells for 20 min. The cells were fixed after 1 h to
avoid in vitro differentiation. After fixation in 3.8% PFA in PB for 20 min
at RT, they were washed and 3% BSA/PB was added as blocking buffer
before incubation for 30 min. Primary antibodies (Table 2) were diluted in
blocking buffer and applied for 2 h at RT. After washing, the cells were
incubated 1 h with secondary antibodies (Table 3). After application of
the secondary antibodies, the cells were washed 2 10 min in PB, 1 10 min in distilled water, air-dried and mounted with Vectashield H-1000
(Abcys). Fluorescence microscopy was performed using a Zeiss Axioplan2 equipped with an ApoTome imaging module, an AxioCam MRc
digital camera and the AxioVison 4.2 software (Zeiss).
Acknowledgments
We thank Dr. M. Bancila for help with stereotaxic graftings,
Drs. P. Durbec, R. Gerardy-Schahn, M. Kursar, S. Pennartz, G.
Rougon, D. Rowitch and C. Stiles for antibodies and Dr. L.
Aniksztejn for patch clamp of the grafted cells. We are grateful to
Drs. P. Durbec, J. Falk and M.C. Tiveron for critically reading of
the manuscript. This work was supported by grants to R.S. from
the Deutsche Forschungsgemeinschaft and to H.C. from the
Fédération pour la Recherche sur le Cerveau, the European
Community Network of Excellence NeuroNE and the Association
Française contre les Myopathies.
References
Aguirre, A.A., Chittajallu, R., Belachew, S., Gallo, V., 2004. NG2expressing cells in the subventricular zone are type C-like cells and
contribute to interneuron generation in the postnatal hippocampus. J.
Cell Biol. 165, 575 – 589.
Alvarez-Buylla, A., Garcia-Verdugo, J.M., 2000. Neurogenesis in adult
subventricular zone. J. Neurosci. 22, 629 – 634.
Alvarez-Buylla, A., Lim, D.A., 2004. For the long run: maintaining
germinal niches in the adult brain. Neuron 41, 683 – 686.
Arvidsson, A., Collin, T., Kirik, D., Kokaia, Z., Lindvall, O., 2002.
Neuronal replacement from endogenous precursors in the adult brain
after stroke. Nat. Med. 8, 963 – 970.
Bedard, A., Parent, A., 2004. Evidence of newly generated neurons in the
human olfactory bulb. Brain Res. Dev. Brain Res. 19 (151), 159 – 168.
Ben-Hur, T., Rogister, B., Murray, K., Rougon, G., Dubois-Dalcq, M.,
1998. Growth and fate of PSA-NCAM+ precursors of the postnatal
brain. J. Neurosci. 18, 5777 – 5788.
Bjorklund, A., Lindvall, O., 2000. Cell replacement therapies for central
nervous system disorders. Nat. Neurosci. 3, 537 – 544.
Bolteus, A.J., Bordey, A., 2004. GABA release and uptake regulate
neuronal precursor migration in the postnatal subventricular zone. J.
Neurosci. 24, 7623 – 7631.
Bouvier-Labit, C., Liprandi, A., Monti, G., Pellissier, J.F., FigarellaBranger, D., 2002. CD44H is expressed by cells of the oligodendrocyte
lineage and by oligodendrogliomas in humans. J. Neuro-oncol. 60,
127 – 134.
Broe, M., Kril, J., Halliday, G.M., 2004. Astrocytic degeneration relates
to the severity of disease in frontotemporal dementia. Brain 127,
2214 – 2220.
197
Cao, Q., Benton, R.L., Whittemore, S.R., 2002. Stem cell repair of
central nervous system injury. J. Neurosci. Res. 68, 501 – 510.
Cayre, M., Bancila, M., Virard, I., Borges, A., Durbec, P., 2006. Migrating
and myelinating potential of subventricular zone neural progenitor cells
in white matter tracts of the adult rodent brain. Mol. Cell. Neurosci. 31
(4), 748 – 758.
Coskun, V., Venkatraman, G., Yang, H., Rao, M.S., Luskin, M.B., 2001.
Retroviral manipulation of the expression of bone morphogenetic
protein receptor Ia by SVZa progenitor cells leads to changes in their
p19(INK4d) expression but not in their neuronal commitment. Int. J.
Dev. Neurosci. 19, 219 – 227.
Dienel, G.A., Hertz, L., 2005. Astrocytic contributions to bioenergetics of
cerebral ischemia. Glia 50, 362 – 388.
Dietrich, J., Noble, M., Mayer-Proschel, M., 2002. Characterization of
A2B5+ glial precursor cells from cryopreserved human fetal brain
progenitor cells. Glia 40, 65 – 77.
Doetsch, F., Alvarez-Buylla, A., 1996. Network of tangential pathways for
neuronal migration in adult mammalian brain. Proc. Natl. Acad. Sci. U.
S. A. 93, 14895 – 14900.
Doetsch, F., Garcia-Verdugo, J.M., Alvarez-Buylla, A., 1997. Cellular
composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J. Neurosci. 17,
5046 – 5061.
Doetsch, F., Caille, I., Lim, D.A., Garcia-Verdugo, J.M., Alvarez-Buylla,
A., 1999. Subventricular zone astrocytes are neural stem cells in the
adult mammalian brain. Cell 97, 703 – 716.
Fallon, J., Reid, S., Kinyamu, R., Opole, I., Opole, R., Baratta, J., Korc, M.,
Endo, T.L., Duong, A., Nguyen, G., Karkehabadhi, M., Twardzik, D.,
Patel, S., Loughlin, S., 2000. In vivo induction of massive proliferation,
directed migration, and differentiation of neural cells in the adult
mammalian brain. Proc. Natl. Acad. Sci. U. S. A. 19 (97), 14686 – 14691.
Farrer, R.G., Quarles, R.H., 1999. GT3 and its O-acetylated derivative are
the principal A2B5-reactive gangliosides in cultured O2A lineage cells
and are down-regulated along with O-acetyl GD3 during differentiation
to oligodendrocytes. J. Neurosci. Res. 57, 371 – 380.
Goldman, S., 2005. Stem and progenitor cell-based therapy of the human
central nervous system. Nat. Biotechnol. 23, 862 – 871.
Goldman, S.A., Luskin, M.B., 1998. Strategies utilized by migrating
neurons of the postnatal vertebrate forebrain. Trends. Neurosci. 21,
107 – 114.
Hachem, S., Aguirre, A., Vives, V., Marks, A., Gallo, V., Legraverend, C.,
2005. Spatial and temporal expression of S100B in cells of oligodendrocyte lineage. Glia 51, 81 – 97.
Hack, I., Bancilla, M., Loulier, K., Carroll, P., Cremer, H., 2002. Reelin is a
detachment signal in tangential chain-migration during postnatal
neurogenesis. Nat. Neurosci. 5, 939 – 945.
Hack, M.A., Saghatelyan, A., de Chevigny, A., Pfeifer, A., Ashery-Padan,
R., Lledo, P.M., Gotz, M., 2005. Neuronal fate determinants of adult
olfactory bulb neurogenesis. Nat. Neurosci. 8, 865 – 872.
Hadjantonakis, A.K., Gertsenstein, M., Ikawa, M., Okabe, M., Nagy, A.,
1998. Generating green fluorescent mice by germline transmission of
green fluorescent ES cells. Mech. Dev. 76, 79 – 90.
Hagg, T., 2005. Molecular regulation of adult CNS neurogenesis: an
integrated view. Trends Neurosci. 28, 589 – 595.
Herrera, D.G., Garcia-Verdugo, J.M., Alvarez-Buylla, A., 1999. Adultderived neural precursors transplanted into multiple regions in the adult
brain. Ann. Neurol. 46, 867 – 877.
Jow, F., Chiu, D., Lim, H.K., Novak, T., Lin, S., 2004. Production of
GABA by cultured hippocampal glial cells. Neurochem. Int. 45,
273 – 283.
Keirstead, H.S., Ben-Hur, T., Rogister, B., O’Leary, M.T., Dubois-Dalcq,
M., Blakemore, W.F., 1999. Polysialylated neural cell adhesion
molecule-positive CNS precursors generate both oligodendrocytes and
Schwann cells to remyelinate the CNS after transplantation. J. Neurosci.
19, 7529 – 7536.
Kirschenbaum, B., Nedergaard, M., Preuss, A., Barami, K., Fraser, R.A.,
Goldman, S.A., 1994. In vitro neuronal production and differentiation
198
R. Seidenfaden et al. / Mol. Cell. Neurosci. 32 (2006) 187 – 198
by precursor cells derived from the adult human forebrain. Cereb.
Cortex 4, 576 – 589.
Kohwi, M., Osumi, N., Rubenstein, J.L., Alvarez-Buylla, A., 2005. Pax6 is
required for making specific subpopulations of granule and periglomerular neurons in the olfactory bulb. J. Neurosci. 25, 6997 – 7003.
Kosaka, K., Aika, Y., Toida, K., Heizmann, C.W., Hunziker, W., Jacobowitz,
D.M., Nagatsu, I., Streit, P., Visser, T.J., Kosaka, T., 1995. Chemically
defined neuron groups and their subpopulations in the glomerular layer
of the rat main olfactory bulb. Neurosci. Res. 23, 73 – 88.
Lie, D.C., Song, H., Colamarino, S.A., Ming, G.L., Gage, F.H., 2004.
Neurogenesis in the adult brain: new strategies for central nervous
system diseases. Annu. Rev. Pharmacol. Toxicol. 44, 399 – 421.
Lin, R.C., Polsky, K., Matesic, D.F., 1993. Expression of gamma-aminobutyric acid immunoreactivity in reactive astrocytes after ischemiainduced injury in the adult forebrain. Brain Res. 600, 1 – 8.
Lindvall, O., Kokaia, Z., Martinez-Serrano, A., 2004. Stem cell therapy for
human neurodegenerative disorders—How to make it work. Nat. Med.
10, 42 – 50.
Liu, Y., Han, S.S., Wu, Y., Tuohy, T.M., Xue, H., Cai, J., Back, S.A.,
Sherman, L.S., Fischer, I., Rao, M.S., 2004. CD44 expression identifies
astrocyte-restricted precursor cells. Dev. Biol. 276, 31 – 46.
Liu, Z., Martin, L.J., 2003. Olfactory bulb core is a rich source of neural
progenitor and stem cells in adult rodent and human. J. Comp Neurol.
459, 368 – 391.
Lois, C., Alvarez-Buylla, A., 1994. Long-distance neuronal migration in the
adult mammalian brain. Science 264, 1145 – 1148.
Luskin, M.B., 1993. Restricted proliferation and migration of postnatally
generated neurons derived from the forebrain subventricular zone.
Neuron 11, 173 – 189.
Ma, D.K., Ming, G.L., Song, H., 2005. Glial influences on neural stem cell
development: cellular niches for adult neurogenesis. Curr. Opin.
Neurobiol. 15, 1 – 7.
Marshall, C.A., Suzuki, S.O., Goldman, J.E., 2003. Gliogenic and
neurogenic progenitors of the subventricular zone: who are they, where
did they come from and where are they going? Glia 43, 52 – 61.
Mayer-Proschel, M., Kalyani, A.J., Mujtaba, T., Rao, M.S., 1997. Isolation
of lineage-restricted neuronal precursors from multipotent neuroepithelial stem cells. Neuron 19, 773 – 785.
Mundt-Petersen, U., Petersen, A., Emgard, M., Dunnett, S.B., Brundin, P.,
2000. Caspase inhibition increases embryonic striatal graft survival.
Exp. Neurol. 164, 112 – 120.
Nacher, J., Crespo, C., McEwen, B.S., 2001. Doublecortin expression in the
adult rat telencephalon. Eur. J. Neurosci. 14, 629 – 644.
Nait-Oumesmar, B., Decker, L., Lachapelle, F., Avellana-Adalid, V.,
Bachelin, C., Van Evercooren, A.B., 1999. Progenitor cells of the
adult mouse subventricular zone proliferate, migrate and differentiate
into oligodendrocytes after demyelination. Eur. J. Neurosci. 11,
4357 – 4366.
Ochi, S., Lim, J.Y., Rand, M.N., During, M.J., Sakatani, K., Kocsis, J.D.,
1993. Transient presence of GABA in astrocytes of the developing optic
nerve. Glia 9, 188 – 198.
Rakic, P., 2002. Neurogenesis in adult primate neocortex: an evaluation of
the evidence. Nat. Rev., Neurosci. 3, 65 – 71.
Sanai, N., Tramontin, A.D., Quinones-Hinojosa, A., Barbaro, N.M., Gupta,
N., Kunwar, S., Lawton, M.T., McDermott, M.W., Parsa, A.T., ManuelGarcia, V.J., Berger, M.S., Alvarez-Buylla, A., 2004. Unique astrocyte
ribbon in adult human brain contains neural stem cells but lacks chain
migration. Nature 19 (427), 740 – 744.
Satoh, J., Kim, S.U., 1995. Ganglioside markers GD3, GD2, and A2B5 in
fetal human neurons and glial cells in culture. Dev. Neurosci. 17,
137 – 148.
Simard, M., Arcuino, G., Takano, T., Liu, Q.S., Nedergaard, M., 2003.
Signaling at the gliovascular interface. J. Neurosci. 23, 9254 – 9262.
Staugaitis, S.M., Zerlin, M., Hawkes, R., Levine, J.M., Goldman, J.E.,
2001. Aldolase C/zebrin II expression in the neonatal rat forebrain
reveals cellular heterogeneity within the subventricular zone and early
astrocyte differentiation. J. Neurosci. 21, 6195 – 6205.
Stenman, J., Toresson, H., Campbell, K., 2003. Identification of two
distinct progenitor populations in the lateral ganglionic eminence:
implications for striatal and olfactory bulb neurogenesis. J. Neurosci.
23, 167 – 174.
Vitry, S., Avellana-Adalid, V., Lachapelle, F., Baron-van Evercooren, A.,
2001. Migration and multipotentiality of PSA-NCAM+ neural precursors transplanted in the developing brain. Mol. Cell. Neurosci. 17,
983 – 1000.
Zhang, S.C., 2001. Defining glial cells during CNS development. Nat. Rev.,
Neurosci. 2, 840 – 843.
Zigova, T., Pencea, V., Betarbet, R., Wiegand, S.J., Alexander, C.,
Bakay, R.A., Luskin, M.B., 1998. Neuronal progenitor cells of
the neonatal subventricular zone differentiate and disperse following transplantation into the adult rat striatum. Cell Transplant. 7,
137 – 156.
www.elsevier.com/locate/ymcne
Mol. Cell. Neurosci. 31 (2006) 748 – 758
Migrating and myelinating potential of subventricular zone neural
progenitor cells in white matter tracts of the adult rodent brain
Myriam Cayre,1 Mircea Bancila,1 Isabelle Virard, Ana Borges, and Pascale Durbec*
UMR 6216, Institut de Biologie du Développement de Marseille Luminy, Case 907, 13288 Marseille Cedex 9, France
Received 5 September 2005; revised 23 November 2005; accepted 4 January 2006
Available online 14 February 2006
Adult neural stem cells in the subventricular zone (SVZ) produce
neuronal progenitors that migrate along the rostral migratory stream
(RMS) and generate olfactory interneurons. Here, we evaluate the
migratory potential of SVZ cells outside the RMS and their capacity to
generate oligodendrocytes in the adult brain. We show that SVZ cells
migrate long distances when grafted into white matter tracts such as
the cingulum (Ci) and corpus callosum (CC). Furthermore, 22 days
postinjection, most present morphologic and phenotypic characteristics
of cells committed to the oligodendrocyte lineage. Cells grafted in
shiverer CC and Ci become MBP-positive oligodendrocytes, abundantly myelinating these white matter tracts. Type A progenitors are
involved in this myelinating process. Altogether, this study reveals the
migrating and myelinating potential of SVZ cells in a new environmental context. Therefore, SVZ cells stand as interesting candidates for
the development of novel therapeutic strategies for demyelinating
diseases.
D 2006 Elsevier Inc. All rights reserved.
Keywords: Subventricular zone; Graft; Migration; Oligodendrocyte; Myelin
repair; White matter
Introduction
Recently, the discovery of neural stem cells in the adult SVZ
lining the lateral ventricles (Chiasson et al., 1999) has pointed them
out as a potential source of cells for brain repair. In multiple
sclerosis, the most common demyelinating disease of the central
nervous system (CNS) affecting young adults, demyelination is
multifocal and occurs throughout the entire white matter, with
areas of predilection such as the periventricular fiber tracts. Thus,
in this disease, cells used for repair would need to possess the
following key properties: (i) a high migration potential in order to
migrate towards and within the many areas of demyelination and
* Corresponding author. Fax: +33 491 26 97 48.
E-mail address: [email protected] (P. Durbec).
1
These authors contributed equally to this work.
Available online on ScienceDirect (www.sciencedirect.com).
1044-7431/$ - see front matter D 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.mcn.2006.01.004
(ii) the ability to differentiate into myelin-forming cells capable of
restoring conduction to demyelinated axons (Blakemore and
Franklin, 2000). In the adult SVZ, neural stem cells give rise to
neuronal progenitors (type A cells), which migrate from the SVZ to
the olfactory bulb (OB) following a well-defined pathway, the
rostral migratory stream (RMS) (Lois and Alvarez-Buylla, 1994).
This cell migration occurs in a cooperative process called chain
migration (Wichterle et al., 1997). However, in contrast to this
stereotyped behavior in the adult brain, during development SVZ
neural progenitor cells also give rise to glia migrating to other parts
of the brain. These glial progenitor cells migrate radially out of the
SVZ into the overlying white matter and cortex where they
generate astrocytes and oligodendrocytes (Suzuki and Goldman,
2003). This gliogenesis decreases with age, though adult SVZ
progenitors transplanted to nonneurogenic brain regions primarily
differentiate into astrocytes (Herrera et al., 1999). Furthermore,
adult SVZ cells grafted into newborn shiverer mice brain survive
and generate myelin-forming oligodendrocytes (Lachapelle et al.,
2002). Besides, recent studies have shown that endogenous
progenitors from the SVZ/RMS could be recruited to induced
demyelination lesions (Nait-Oumesmar et al., 1999; Picard-Riera et
al., 2002). However, this recruitment was relatively poor and the
differentiation into oligodendrocytes limited. This restricted
response might partly be due either to the low migration efficiency
of SVZ progenitors outside the SVZ/RMS or to their failure to
differentiate into oligodendrocytes in a mature environment.
Therefore, these SVZ progenitors, with their self-renewal
capacity, migratory behavior, and glial differentiation potentialities
present interesting properties in the context of demyelinating
diseases. However, although endogenous SVZ progenitors migrate
efficiently along the RMS, there is no clear evidence that they
could perform long distance migration outside their normal
migratory pathway (Herrera et al., 1999). In addition, their
potential to generate oligodendrocytes in the adult brain has never
been established in vivo.
In this study, in order to evaluate the usefulness of SVZ neural
progenitors for myelin repair, we examined their potentialities in
the adult brain. We grafted SVZ cells from either neonatal or adult
mice into different structures of adult mouse brain and analyzed
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
migration distances and differentiation phenotypes at 7 and 22 days
postgrafting. We show that (i) whereas SVZ cells do not migrate
when grafted into cortex or striatum, white matter tracts represent
permissive structures for SVZ progenitor cell migration in the adult
brain; (ii) myelin deficiency does not impair this migratory
process; (iii) grafted cells exhibit phenotypic commitment to the
oligodendrocyte lineage in wild-type mice; (iv) in a myelindeficient context, the majority of grafted cells differentiate into
mature myelinating oligodendrocytes; (v) type A cells from the
SVZ participate in this oligodendrocyte production.
Results
Grafted SVZ cells perform long distance migration along white
matter tracts in the adult brain
To study the migration potential of SVZ cells in the adult
mature brain, we grafted calibrated pieces of SVZ tissue from 3day-old or adult GFP-expressing mice into different brain regions
and evaluated the migration distances covered by GFP-labeled
progenitors 7 or 22 days after transplantation (Fig. 1). Pieces of
SVZ tissue were first grafted into the SVZ of adult mice. As
expected, GFP-positive cells were found in the RMS and the OB at
7 days posttransplantation (Fig. 2A). When grafts were performed
into the cortex or the striatum, little or no dispersion from the SVZ
explants was observed (not shown). By contrast, cells injected at
the level of the subcortical white matter tracts exhibited extensive
migration within these structures (Figs. 2B – E). On sagittal
sections, we observed that cells from neonatal (Figs. 2B, C) and
adult (Fig. 2D) SVZ migrated along the Ci. Analysis of frontal
sections showed that GFP-positive cells also migrated within the
CC and had even reached the contralateral hemisphere (Fig. 2E).
Few or no cells were observed migrating radially towards the pial
surface in the cortex. By contrast to the chain migration occurring
in the RMS, SVZ cells appeared to migrate as isolated cells in the
subcortical white matter (Figs. 2C, E and 4A). In order to check
that migration along these fibers does not result from passive
dispersion due to injection pressure, we sacrificed 3 mice 4 h after
grafting dissociated SVZ cells. In this case, the cell dispersion
observed was much smaller than 7 days later (260 T 57 Am versus
1000 T 50 Am). Furthermore, we grafted dissociated SVZ cells
749
killed by freezing and sacrificed the mice 7 days postinjection.
Frozen cells did not migrate along white matter tracts but remained
close to the injection site (cell dispersion = 334 T 5 Am; Fig. 2F).
These results demonstrate that the migration pattern observed
results from an active migration process.
In conclusion, while SVZ cells derived from neonatal or adult
brains display a poor migration potential in the striatum and the
cortex, they are able to migrate efficiently along the Ci and the CC,
outside the RMS, their normal migration pathway. Thus, white
matter tracts represent permissive migration pathways for SVZ
cells in the mature adult brain.
At 7 days postinjection, migration of GFP-positive cells was
quantified by measuring the distance separating the most distal
cells along the rostro-caudal axis for the Ci and along the lateromedial axis for the CC (Table 1; see Experimental methods). Cells
from grafted neonatal SVZ fragments migrating along the fiber
tracts covered a maximal distance of 1032 T 56 Am along the Ci
and 1046 T 147 Am along the CC (n = 5). Similarly, cells from
grafted SVZ fragments taken from adult mice covered a maximal
distance of 963 T 137 Am and 1356 T 171 Am along the Ci and CC
respectively (n = 4; Table 1). Therefore, it appears that SVZ cells
derived from neonatal and adult mice present a similar migration
potential along white matter tracts ( P = 0.556 and P = 0.190 for Ci
and CC, respectively).
In order to compare the migratory behavior of freshly isolated
SVZ cells with that of in vitro expanded neural progenitors,
neurospheres from actin-GFP neonatal mouse SVZ were cultured
and grafted into adult brains. Quantitative analysis showed that, 7
days after injection, neural progenitors from neurospheres grafted
into white matter tracts migrated as efficiently rostro-caudally in
the Ci (885 T 93 Am; n = 3) and latero-medially in the CC (959 T
172 Am; n = 3) as did SVZ-derived progenitors from neonatal
explants ( P = 0.571 and 0.786 for Ci and CC respectively; Table
1). In another set of experiments, we also injected dissociated SVZ
cells in order to determine if cell migration could be modulated
depending on the state of cell – cell interactions of the grafted cells
(dissociated cells versus tissue fragments). In this case again, no
significant difference was observed when neonatal SVZ cell
migration was quantified along the Ci (1120 T 79 Am versus
1032 T 56 Am; P = 0.571) and the CC (1392 T 272 Am versus 1046 T
147 Am; P = 0.190; Table 1). These results demonstrate that, in this
context, SVZ cells migrate as efficiently as isolated cells or as
Fig. 1. Schematic representation of the different sets of experiments. SVZ was removed from vibratome brain sections of neonatal or adult GFP mice and
injected into periventricular white matter tracts at the level of the Ci of wild-type or shiverer recipient mice. Grafted tissues were injected either as tissue
fragments, dissociated cells or neurospheres. Recipient mice were sacrificed at 7 and 22 days postgrafting. cc, corpus callosum; ob, olfactory bulb; SVZ,
subventricular zone from the lateral wall of the anterior lateral ventricle horn.
750
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
explants. Furthermore, the distribution of grafted cells along the
rostro-caudal and the latero-medial axis was quantified (Fig. 3A).
This analysis suggests a preferential migration orientation towards
caudal and medial directions.
At 22 days postgrafting, a similar pattern of migration was
observed, and quantification showed that cell migration was
increased compared to that observed along the Ci 7 days after
grafting (Table 1; Fig. 3B). This suggested that grafted cells were
still migrating rostro-caudally between 7 and 22 days postinjection.
The repartition of migrating cells along white matter tracts was
estimated in two representative animals at 7 and 22 days
postgrafting. Only 12.6% and 4.5% of the GFP-positive cells did
not migrate and were found at the injection site at respectively 7
and 22 days postinjection. Among the cells that had migrated,
64.6% showed a dispersion superior to 400 Am and 27.4% superior
to 800 Am 7 days after implantation (Fig. 3C). At 22 days
postimplantation, these numbers increased to 85.2% and 52.3%
respectively (Fig. 3C). These results underline that a large
proportion of grafted cells that integrate into the CC and Ci
exhibit a significant migratory behavior.
We therefore conclude that white matter tracts are permissive
routes of migration for SVZ cells or immature neural progenitors
expanded in vitro as neurospheres. These findings support the idea
that SVZ cells can migrate efficiently outside the RMS in a fully
mature CNS, which is a prerequisite for adult brain repair.
SVZ neural progenitors remain in an immature state while
migrating along fiber tracts in the adult brain
We then analyzed the antigenic and morphological phenotype
of the migrating cells. Seven days postgrafting, the majority of
GFP-migrating cells displayed a unipolar or bipolar morphology
(Fig. 4A), although rare cells (less than 10%) presented a
multipolar morphology close to the injection site (Fig. 4B). To
identify the phenotype of the GFP-positive cells, we performed
immunofluorescence on sections with a set of antibodies characteristic of neuronal and glial progenitors (n = 3 mice). The majority
of unipolar/bipolar migrating cells was found to express immature
neural progenitor markers such as Nestin (Figs. 4C, D) or PSANCAM (Figs. 4E, F), indicating that 7 days after injection, the
grafted cells remained uncommitted immature cells. Among these
cells, some were found to be Olig2-positive (Fig. 4G) and NG2positive (not shown), suggesting their commitment to the
oligodendrocyte lineage. No cell positive for the early neuronal
marker Tuj1 was observed, whereas few cells (mainly among the
multibranched cells located around the injection site) expressed
GFAP (not shown).
In order to estimate the proliferation status of the migrating
cells, animals grafted with adult SVZ cells were analyzed 7 or 22
Fig. 2. SVZ cells injected into white matter tracts exhibit long distance
migration along axonal fibers. (A) Migration of GFP-positive cells after
transplantation of SVZ explants into the SVZ. Seven days after
transplantation, GFP-positive cells are observed along the RMS and in
the OB viewed on a sagittal section. (B – D) Rostro-caudal migration along
the Ci 7 days after transplantation of SVZ explants from neonatal (B, C) or
adult (D) actin-GFP mice viewed on a sagittal brain section. (C)
Enlargement of the area defined in panel B by the dotted square showing
the cell migration front. (E) Latero-medial migration along the CC viewed
on a coronal section 22 days after transplantation of SVZ explants from
adult actin-GFP mice. (F) Dissociated SVZ cells were killed (frozen) prior
to injection. In such case, no migration is observed but only minor cell
dispersion due to the injection procedure. Insets in panels A, B, D, E, and F
show corresponding Nissl-stained sections on which is indicated the
location of the analyzed area. cc, corpus callosum; ci, cingulum; lv, lateral
ventricle; rms, rostral migratory stream; svz, subventricular zone; ob,
olfactory bulb. The asterisk in panels A, B, D, and E indicates the injection
site. Scale bars: A, B, D, 200 Am; C, 25 Am; E,150 Am and F, 100 Am. A–E:
cryostat sections; F: vibratome section.
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
751
Table 1
Quantitative analysis of cell migration along the Ci and the CC at 7 and 22 days postgraft
Postgrafting delay
Migration along the Ci (Am)
Migration along the CC (Am)
7 days
22 days
7 days
22 days
Neonatal SVZ fragments
Dissociated neonatal SVZ cells
Neonatal neurospheres
Adult SVZ fragments
Dissociated adult SVZ cells
1032 T 56 (n = 5)
1120 T 79 (n = 2)
885 T 93 (n = 3)
963 T 137 (n = 4)
nd
1369 T 157 (n = 4)
2092 T 131 (n = 3)
nd
nd
1724 T 466 (n = 3)
1046 T 147 (n = 5)
1392 T 272 (n = 2)
959 T 172 (n = 3)
1356 T 171 (n = 4)
nd
1041 T 405 (n = 4)
1275 T 141 (n = 3)
nd
nd
1584 T 39 (n = 3)
nd, not determined; (n) indicates the number of grafted animals for each condition.
days after transplantation. In all cases, bromodeoxyuridine (BrdU)
was injected twice a day for the last 5 days, and the animals were
sacrificed 2 h after the last BrdU injection. When the animals were
sacrificed 7 days postgrafting (n = 2), 66 T 6% of the GFP-positive
cells were BrdU-positive, indicating that a subpopulation of the
grafted cells were proliferating during this time window (Figs.
4H – J). We then investigated what was the proportion of dying
cells 7 days after grafting. We observed few cleaved-caspase-3positive cells in the RMS and OB of the animals, but virtually no
cells were cleaved-caspase-3-positive among the GFP-positive
cells (<0.5%, not shown), suggesting that the grafted cells did not
undergo significant cell death at this time point. When sacrifice
was performed 22 days after grafting (n = 2), the number of BrdUlabeled cells decreased, reaching only 26% of the GFP-positive
cells, and again virtually no cells (<0.5%) were seen to be cleavedcaspase-3-positive (Fig. 5J).
These results show that, while they migrate along white matter
tracts, SVZ-derived cells remain as uncommitted neural progenitors as evidenced by the expression of markers such as Nestin and
PSA-NCAM and by their proliferating potentiality. However, some
already express early oligodendroglial markers. In contrast to what
is observed in the RMS, these migrating cells never showed
neuronal commitment in such context.
SVZ neural precursors grafted into the subcortical white matter
tracts of wild-type mice express classical markers of the
oligodendrocyte fate
We then investigated if SVZ neural progenitors can differentiate
towards the oligodendrocyte fate in a normally myelinated
environment. We therefore examined the phenotype of grafted
SVZ cells 22 days after grafting (n = 3) into subcortical fiber tracts.
By this time, the majority of GFP-positive cells were found in the
CC, since many cells had clearly migrated from the Ci into the
depth of the CC (Fig. 5A). Most cells exhibited multibranched
morphologies typical of oligodendrocytes (Figs. 5B and F). Using
immunohistochemistry, we showed that 35 T 2% of the GFPpositive cells were immunoreactive for NG2, a marker for
oligodendrocyte progenitors (Figs. 5C – E), and that 52 T 8% were
immunoreactive for Olig2 (Figs. 5F – H), a marker of the entire
oligodendroglial lineage (from progenitors to mature oligodendrocytes) in the adult brain. By contrast, only few cells (3 – 4 cells per
section, i.e., <2%) differentiated into astrocytes, as indicated by
GFAP immunostaining (Fig. 5I), and very rare or even no cells (0 –
1 per section, i.e., <0.5%) appeared to be committed to a neuronal
fate, as revealed by Tuj1 labeling (not shown). It should be
underlined that these numbers are most likely underestimated due
to incomplete penetration of the antibodies into the sections, while
GFP-positive cells were directly visualized throughout the section
without any treatment. These results suggest that, in normally
myelinated brain, SVZ-derived cells grafted into white matter
tracts mainly adopt properties of the oligodendrocytic lineage.
SVZ neural precursors grafted into the subcortical white matter
tracts of myelin-deficient mice differentiate into mature
oligodendrocytes
To unambiguously determine whether grafted cells become
fully mature myelinating oligodendrocytes, we grafted SVZ cells
from adult GFP-mice into white matter tracts of shiverer mice and
performed anti-MBP labeling (n = 4). Myelin Basic Protein (MBP)
is a major constituent of the myelin sheath and is absent in shiverer
mice (Warrington et al., 1993). Since shiverer mice lack MBP and
are hypomyelinated, MBP labeling in their brain can only come
from the grafted cells. At 22 days postgrafting, GFP-positive cells
had migrated and were found dispersed all over the Ci and CC
(Fig. 6A), as previously observed in wild-type mice. Therefore,
defects in myelin compaction and fiber myelination in shiverer
mice did not affect SVZ cell migration along white matter tracts.
Moreover, 79 T 3% of these GFP-positive cells were immunoreactive for MBP (Fig. 6). The pattern of MBP labeling indicated that
grafted cells had formed myelin patches throughout the CC and the
Ci (Fig. 6D). Thus, such an environment reveals the potentiality of
SVZ cells to generate mature oligodendrocytes able to myelinate
shiverer axons.
The ability of adult SVZ cells to survive in the CC and Ci of
adult mice after migration and differentiation was confirmed at 3
months after transplantation in shiverer mice (Figs. 6E, F). Eleven
weeks posttransplantation, a dense network of GFP-positive cells
was found in the CC and Ci of all analyzed animals (4/4) (Fig. 6E).
The MBP immunostaining pattern clearly indicated that grafted
SVZ cells extensively myelinated shiverer axons (Fig. 6F).
In conclusion, these results demonstrate the potentiality of SVZ
cells to generate mature oligodendrocytes in adult subcortical white
matter after a heterotopic graft.
Adult PSA-positive SVZ progenitors grafted into the subcortical
white matter tracts differentiate into oligodendrocytes
To better identify which population of cells within the adult
SVZ gives rise to oligodendrocytes after migration in the adult
brain subcortical white matter, we isolated the PSA-NCAMpositive progenitor cell population (type A cells) from a
suspension of dissociated adult SVZ cells using magnetic
activated cell sorting. After purification, two fractions were
obtained: the PSA-positive fraction and the negative fraction
corresponding to the flow-through (see Experimental methods).
The PSA-positive fraction reached 98% purity (Fig. 7A), as
752
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
remained in the negative fraction (Fig. 7B). These two fractions
were grafted into white matter tracts of adult shiverer mice, and
the animals were sacrificed 22 days later. Cells from both
Fig. 3. (A) Quantitative analysis of cell migration rostro-caudally along the
cingulum and latero-medially along the corpus callosum 7 days after
transplantation. Migration was assessed with different types of SVZ-derived
grafts: neurospheres from neonates (NN spheres), dissociated cells from
neonates (NN cells), fragments from neonates (NN explants) or from adults
(Ad explants). (B) Quantitative analysis of SVZ cell migration along the Ci
and the CC at 7 and 22 days postgrafting. Since no statistical differences
were observed between the different experimental groups (neonatal or
adult; explants, dissociated cells or neurospheres), data were pooled at the
two analyzed time points. At 22 days postgrafting, the migration distance
was significantly increased along the Ci compared to the migration distance
observed 7 days postgrafting. Each bar represents the mean T SEM, and the
asterisks indicate a significant difference (**P < 0.01). (C) Quantitative
analysis of the proportion of grafted adult SVZ cells that had migrated
along the CC at 7 and 22 days postgrafting. The histograms illustrate, in
two representative animals, the distribution of migrating cells in various
distance ranges along the CC, and the curves indicate cumulative frequency
distributions.
estimated by PSA immunolabeling of plated sorted cells. The
negative fraction was virtually composed of the remaining cells
after sorting, namely the transient amplifying progenitors (C
cells) and the stem cells (B cells). However, we could also
observe some PSA-positive cells that had not been sorted and that
Fig. 4. Morphologic and phenotypic characterization of migrating cells
derived from adult SVZ, 7 days after transplantation. (A) Most migrating
cells exhibited a unipolar (arrow) or bipolar (arrowhead) morphology on the
Ci. (B) Rare cells presented a more complex branching, essentially within
the CC. Most migrating GFP-positive cells on the Ci expressed Nestin (C,
D) and PSA-NCAM (E, F), both markers of immature neural progenitors.
(G) Some of the GFP-positive cells, indicated by arrowheads, also
expressed Olig2. (H – J) BrdU treatment during the 5 days preceding
sacrifice resulted in labeling of numerous grafted cells. (A – G) Cryostat
sections, adult SVZ explants; (H – J) vibratome sections, adult dissociated
SVZ cells. cc, corpus callosum; ci, cingulum; Scale bars: 25 Am.
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
753
Fig. 5. Morphologic and phenotypic characterization of grafted dissociated SVZ cells from adult brain 22 days after transplantation. (A) After migrating rostrocaudally along the Ci, some cells exited this fiber tract and adopted a perpendicular trajectory to invade the underlying CC. (B) At this time, most cells
exhibited complex multibranched processes indicating their belonging to the glial lineage. Grafted cells were immunopositive for NG2 at the cell membrane
and processes (C – E) and for Olig2 in the nucleus (F – H), two classical oligodendroglial lineage markers. Arrowheads in panel F point to GFP/Olig2+ cells. (I)
Rare GFAP-immunopositive astrocytes were also clearly identified after migration in the CC and the Ci. Arrow in panel I points to astrocytic processes. (J) A
rare event of cell death among grafted cells evidenced by cleaved caspase-3 labeling (arrow). CC, corpus callosum; Ci, cingulum. Scale bars: 25 Am. A – E, I – J:
vibratome sections; F – H: cryostat sections.
fractions migrated and invaded the Ci and CC as previously
observed with total adult SVZ cell population (not shown).
Surprisingly, cells from the PSA-positive fraction (n = 1) were
able to give rise to myelinating oligodendrocytes in the Ci and
the CC, as shown by MBP labeling (Figs. 7C – F). Indeed, 94%
of the grafted cells appeared Olig2-positive, and 58% expressed
MBP (100% of the MBP-positive cells were Olig2-positive),
suggesting that these cells mainly became mature oligodendrocytes, and that those cells that were not myelinating were
however committed to an oligodendrocytic fate but had not fully
matured yet. The negative fraction also generated myelinating
oligodendrocytes in the adult white matter tracts (n = 2, not
shown): 94 T 1% and 74 T 1% of the grafted cells expressed
Olig2 and MBP respectively. These results suggest that different
SVZ cell populations participate in this myelinating process.
Interestingly, they also demonstrate the oligogenic potential of
type A cells of the adult SVZ, which are usually considered as
committed neuronal progenitors in the SVZ/RMS pathway.
Discussion
In this study, we examined the behavior of SVZ cells after
heterotopic transplantation into the adult mouse brain in order to
estimate their potential use for myelin repair. Two main criteria
were considered: (1) the potentiality of SVZ cells to migrate in a
mature brain, outside the RMS, their normal migratory pathway,
(2) the gliogenic potential of these cells in vivo and more precisely
their capacity to generate myelinating oligodendrocytes.
Subcortical white matter tracts are permissive pathways for SVZ
cell migration in the mature brain
Using heterotopic transplantation into the adult mouse brain, we
have observed that neonatal and adult SVZ cells can migrate
extensively along tracts of myelinated fibers in the CC and the Ci
in the mature CNS. Previous studies had already shown that SVZ
explants grafted into the anterior SVZ consistently migrated
754
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
Fig. 6. MBP immunolabeling on shiverer mice brain sections 3 (A – D) and 11 weeks (E, F) after transplantation of SVZ cells from adult actin-GFP mice. (A)
Grafted cells have invaded the CC and the Ci. They have differentiated into mature oligodendrocytes, as visualized by MBP labeling. (B) Enlargement of the
area delimited in panel A showing a GFP-positive myelinating oligodendrocyte with putative nodes and expressing MBP in the Ci (in red). (C) Isolated MBPpositive oligodendrocyte in the CC. Note the absence of MBP staining within the cytoplasm of the GFP-positive oligodendrocyte, indicating its complete
maturation. (D) Semi-serial sagittal sections through a shiverer adult brain 22 days after transplantation demonstrate widely disseminated MBP-positive myelin
patches throughout the CC and the Ci. Illustration of one representative brain among 4 analyzed. (E) Long-term survival of grafted cells and extensive
myelination of the CC, and the Ci is visualized by MBP labeling 11 weeks after transplantation. (F) Fiber tracts are clearly myelinated by SVZ cells from adult
GFP mice. The asterisk (D) indicates the injection site. A – C, E, F: vibratome sections, adult dissociated SVZ cells; D: cryostat sections, adult SVZ fragments.
CC, corpus callosum; Ci, cingulum. Scale bars: A, 25 Am; B – C – F, E, 100 Am 12 Am; D, 280 Am.
extensively from the graft site to the OB (Lim et al., 1997;
Torregrossa et al., 2004), while migration from such explants was
rare and very restricted when the transplantation was performed
into the adult cortex or striatum (Lim et al., 2002). Indeed, SVZ
explants grafted into the cortex or striatum maintained their typical
cytoarchitecture, suggesting that the tight intercellular interactions
of cells within the explants could have prevented efficient
migration of the cells (Herrera et al., 1999). However our results
indicate that, in a permissive environment, the native tridimensional cytoarchitecture of SVZ cells is neither necessary nor
deleterious for the initiation of cell dispersal and migration.
After transplantation into subcortical fiber tracts, cells migrate
in the tangential direction corresponding to that of the axon
bundles. Using shiverer mice, we have shown that myelin
deficiency does not impair this migratory process. Similar results
were obtained by Windrem et al. (2004), showing that human
oligodendrocyte progenitor cells (OPCs) grafted into the CC of
neonate (P0 – P1) shiverer mice extensively migrate and are found
widespread throughout the CC after 4 weeks. In the adult rodent
brain, these OPCs injected inside a focal demyelinating lesion
disperse within the lesion. However, they fail to migrate when
implanted into a normal adult subcortical white matter (Windrem et
al., 2002). Therefore, it seems that mouse SVZ cells exhibit a larger
migration potential in white matter tracts than human OPCs since
they are not inhibited by the myelination of axon bundles. If such a
potentiality were to be conserved in human SVZ cells, it would
allow cells to migrate between lesions in multifocal demyelinating
pathologies such as multiple sclerosis.
During development, perinatal SVZ glial progenitors migrate
along the unmyelinated axon fiber fascicles in the CC (Kakita et
al., 2003). During this process, these progenitors first migrate
tangentially along the CC and then turn radially into the neocortex
toward the pial surface (Suzuki and Goldman, 2003). In the present
study, although we sometimes observed radial migration from the
Ci into the CC (Fig. 5A), we never observed radial migration
toward the pial surface. In the adult brain, we show that subcortical
white matter tracts are the only permissive structure for migration,
even for neonatal SVZ cells. This indicates that these progenitors
derived from either neonatal or adult SVZ cannot completely
recapitulate the migration potential of neonatal SVZ glial
progenitors. Previous studies based either on in vitro analysis
(Wichterle et al., 1997) or heterochronic heterotopic transplantation
in the chick embryo (Durbec and Rougon, 2001) had suggested
that chain migration was an intrinsic property of SVZ cells.
However, in our analysis, SVZ cells grafted into white matter tracts
migrated as isolated cells in contrast to the cooperative chain
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
755
migration process observed in the RMS. During development,
neonatal SVZ glial progenitors can perform chain migration within
the RMS (Aguirre and Gallo, 2004), but they also migrate as
isolated cells along the CC and the neocortex (Kakita and
Goldman, 1999). In the latter case, they display a simple and
typical morphology while migrating (Kakita and Goldman, 1999).
In the present study, migrating cells exhibited either a unipolar or a
bipolar morphology, suggesting that they could extend a leading
process and operate migration by nuclear translocation as
previously described for neonate SVZ progenitors (Kakita and
Goldman, 1999). Overall, these observations highlight that the
migration mode of SVZ progenitor cells is not entirely determined
by intrinsic SVZ cell population properties but can also be
controlled by environmental cues. Schwann cells from neonate
mice and multipotent neural stem cells from neonate cerebellum
(C17.2 clone; gift from Snyder EI) presented the same migration
pattern when grafted into the cingulum and corpus callosum (our
unpublished data). We therefore propose that subcortical white
matter tracts present structural and/or biochemical properties
favorable to progenitor cell migration.
In agreement with the results observed after OPC grafts into
neonate shiverer mice brain (Windrem et al., 2004), our BrdU
experiments demonstrate that a fraction of the SVZ cells keeps
dividing after engraftment, but that this proliferation potential
decreases with time, as they mature from migrating progenitors to
myelinating oligodendrocytes. Observation of cell debris around
the injection site suggests that a fraction of the injected cells died
soon after transplantation due to the trauma of injection. However,
once integrated into the host tissue, it seems that cell survival is
high since we could not evidence any significant cell death among
the grafted cells neither at 7 nor at 22 days postinjection, using
both TUNEL (not shown) and an anti-activated caspase-3 antibody.
Furthermore, numerous GFP-positive cells were still present in the
CC and Ci 3 months after grafting. In summary, our transplantation
paradigm suggests that, in the adult brain, the restriction of SVZ
precursor cells to the SVZ/RMS might be imposed by environmental signals or by physical barriers such as glial tunnels
preventing precursor dispersion out of these structures. As the
brain matures, such signals may appear, preventing cells from
populating surrounding structures. Nevertheless, the adult SVZ
maintains cells with the potential to perform long distance
migration in permissive structures other than the RMS.
SVZ cells can generate oligodendrocytes in the mature brain
Fig. 7. Oligodendrocytic differentiation of sorted PSA-positive SVZ cells
22 days after grafting into adult shiverer mice. (A, B) PSA immunolabeling
on the PSA positive fraction (A) and negative fraction corresponding to the
flow-through (B) 6 h after plating. (C) Patches of MBP labeling surround
grafted GFP cells in the CC, indicating their complete maturation into
myelinating oligodendrocytes. (D – F) Furthermore, most GFP-positive cells
which do not express MBP in panel D (arrows) are nevertheless positive for
Olig2 (arrows). Scale bars: A, B, 12 Am; C – F, 20 Am. C – F: vibratome
sections.
Many studies have explored the potential use of SVZ cells to
replace lost neurons (reviewed in Temple, 2001; Lim et al., 2002).
In the present analysis, we have focused on the potential of such
cells to replace glial cells and more specifically oligodendrocytes.
It was already known that neonatal and adult SVZ cells can
produce glia in vitro (Lois and Alvarez-Buylla, 1994; Doetsch et
al., 1999). In vivo, neonatal SVZ generates astrocytes and
oligodendrocytes in the OB (Aguirre and Gallo, 2004), in the
CC, and the cortex (Kakita and Goldman, 1999; Kakita et al.,
2003). However, this gliogenic potential seems to cease by
postnatal day 14 (Levison and Goldman, 1997); from this stage
on and throughout adulthood, the adult anterior SVZ is considered
as a neurogenic niche (Marshall et al., 2003). Here, using a
transplantation paradigm, we show that adult SVZ cells can (1)
adopt an oligodendrocytic fate in normal adult brain and (2)
efficiently generate myelinating oligodendrocytes in vivo, in
756
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
shiverer background. In our study, NG2 is used as a marker for
OPCs and pre-oligodendrocytes that is not expressed anymore in
mature oligodendrocytes, although increasing evidence suggests the
existence of a NG2-positive cell population different from
conventional OPCs in the adult brain (Greenwood and Butt, 2003;
Nishiyama et al., 2002; Peters, 2004). To further characterize the
implanted cells, we used Olig2 which, in the adult, is specifically
expressed in cells committed to the oligodendrocyte lineage, from
OPCs to mature oligodendrocytes. A significant percentage of
grafted cells did not express any of the phenotypic markers we used,
suggesting that they remained as undifferentiated progenitors. However, we observed that a large proportion of the grafted cells
expressed either NG2 or Olig2, and we could therefore conclude that
they were committed to the oligodrendrocyte lineage. Technically, it
is difficult to unambiguously demonstrate that grafted cells matured
into fully myelinating oligodendrocytes in normal white matter
since myelin markers are densely expressed in this structure. Therefore, one can hardly distinguish whether myelin labeling really
originates from a grafted cell or from a neighboring cell. However,
many GFP/Olig2-positive cells exhibited a morphology very evocative of mature oligodendrocytes. Transplantation experiments using
adult shiverer mice as recipients demonstrated the myelinogenic
potential of adult SVZ cells grafted into the CC/Ci. Although the CC
of grafted shiverer mice exhibited extended patches of MBP labeling and presented long-term survival (Fig. 6), no obvious functional
improvement could be observed. Such a result is not surprising since
tremor, the most obvious defect of shiverer mice, cannot expect to be
reversed only by remyelination of the CC and Ci.
There remained the question of the identity of the cells from the
adult SVZ that can differentiate into oligodendrocytes after
transplantation into subcortical white matter tracts. Considering
the massive number of migrating cells which give rise to
oligodendrocytes in our experiments, it seems likely that the
candidate cells should be a major cell population of the SVZ. Then
such cells could be the type C cells present throughout the SVZ as
proliferative clusters of uncommitted precursor cells (Doetsch et
al., 1997). This hypothesis is supported by recent works identifying
in the SVZ a population of NG2/Olig2-positive cells sharing
functional and phenotypic characteristics (PSA-NCAM-negative
and GFAP-negative) with type C cells (Aguirre et al., 2004; Hack
et al., 2004, 2005). Alternatively, the neuronal progenitors (type A
cells), which normally generate interneurons in the OB, could be
re-specified during migration to generate glial cells, as it is the case
after lysolecithin-induced demyelination of the CC (Nait-Oumesmar et al., 1999). Our cell sorting experiment shows that A cells
can participate in the generation of oligodendrocytes after SVZ cell
grafting into the CC. Indeed, grafting the PSA-positive fraction of
adult SVZ into adult shiverer subcortical white matter tracts
resulted in patches of MBP labeling in the CC, surrounding grafted
GFP cells. In fact virtually all the surviving grafted cells were
committed towards the oligodendrocyte lineage (Olig2-positive),
and more than half of them were already myelinating 3 weeks after
grafting. However, the PSA-negative fraction gave similar results.
Although some PSA-positive cells remained in the negative
fraction, it is unlikely that they could account for the high
percentage of cells differentiating into mature oligodendrocytes.
These results therefore suggest that the population of transient
amplifying progenitors (C cells) of the adult SVZ also contribute to
producing MBP-positive cells in white matter tracts.
Altogether, our data clearly demonstrate that adult SVZ cells
can generate oligodendrocytes in a gliogenic environment.
Conclusion and implication for myelin repair
Although SVZ progenitors were believed to produce mainly
olfactory interneurons in the normal adult brain, and astrocytes
after heterotopic transplantation, our results revealed that they
massively generate myelinating oligodendrocytes when grafted
into subcortical white matter tracts. Furthermore, they exhibit good
migratory potential along these fiber bundles, which is not affected
by the absence of normally compacted myelin. These findings,
together with those of Pluchino et al. (2003) showing functional
recovery in experimental autoimmune encephalomyelitis mice after
injection of adult SVZ neurospheres, augur well in the perspective
of therapeutic uses of these cells for demyelinating pathologies
such as multiple sclerosis. However, autografts would require SVZ
biopsies in patients, which may not yet be a realistic approach. By
contrast, recruitment of endogenous SVZ progenitor cells for
repairing demyelinated lesions appears to be a promising strategy.
A limiting step for the use of these endogenous progenitors
remains the extraction of these cells from the SVZ and from their
natural migration pathway, the RMS. Future studies should focus
on determining the factors responsible for SVZ cell restriction to
the SVZ and to the RMS in order to break this chemical/
mechanical barrier and allow more massive recruitment towards
white matter fiber tracts.
Experimental methods
Solutions for cell culture were purchased from Invitrogen (Cergy
Pontoise, France) and other chemicals from Sigma (Saint Quentin Fallavier,
France), if not otherwise specified.
Animals
Animal experimentation conformed to European Community guidelines. C57/Bl6 mice were purchased from IFFA CREDO (L’Arbresle,
France). CD1 mice, actin-GFP mice (Hadjantonakis et al., 1998) and
homozygote shiverer mice (Jackson Laboratory, Maine, USA) were bred in
our animal house facilities. We used homozygote shiverer mice, all devoid
of immunodetectable MBP.
SVZ explant dissection, cell sorting, and neurosphere culture
SVZ explants were obtained as described by Chazal et al. (2000).
Briefly, 3-day-old or adult mice were sacrificed according to regulation.
Brains were dissected out and sectioned into 400-Am-thick slices using a
vibratome (Leica Microsystème, Rueil Malmaison, France). The SVZ from
the lateral wall of the anterior lateral ventricle horn was dissected in HBSS
medium and cut into 100-Am diameter explants. Dissection was performed
in order to obtain solely SVZ tissue excluding all adjacent structures,
namely white matter and striatum. SVZ fragments were dissociated after
enzymatic treatment (trypsin, 5 mg/ml). Neurospheres were prepared from
neonatal SVZ and propagated as previously described (Durbec and Rougon,
2001). The potentiality of the spheres to generate neurons, astrocytes, and
oligodendrocytes in vitro was routinely monitored after growth factor
removal and adhesion onto fibronectin-coated coverslips.
Cell sorting was performed on dissociated SVZ cells. After rinsing in
DMEM containing 10% fetal calf serum (FCS), the SVZ cell suspension
was incubated with the anti-PSA antibody (ascites diluted 1:100; our
laboratory), then with an anti-mouse IgM antibody conjugated to microbeads (Miltenyi Biotec, Paris, France). Magnetic-activated cell sorting
(MACS) was performed according to the manufacturer’s recommendations
by passing the cells over a cell separation column (MS type; Miltenyi
Biotec, Paris, France) twice. Purity of the PSA-positive fraction was
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
757
estimated by plating an aliquot of the purified fraction on a glass coverslip
in DMEM containing 10% FCS. Six hours after plating, an immunostaining
was performed using an anti-PSA antibody. Direct counting indicated that
98% of the cells were PSA-positive. PSA-positive cells were still identified
in the ‘‘negative’’ fraction corresponding to the flow-through containing
cells not retained on the column.
Axiovision4 software by measuring the distance separating the injection site
from the most distant GFP-positive cells along the rostro-caudal axis. The
migration along the corpus callosum (CC) was either directly measured on
frontal brain sections or estimated by counting the number of serial sagittal
sections on which GFP-positive cells could be seen in the CC, multiplied by
the thickness of the section. These two methods provided equivalent results.
Transplantation
Statistical analysis
At 6 – 8 weeks of age, mice were anesthetized and injected each with
either three GFP-SVZ explants (100 Am diameter), 1 Al of freshly
dissociated SVZ cells in DMEM (40,000 cells/Al or 2000 cells/Al for
neonatal and adult donor mice, respectively), or 2 – 3 neurospheres in 0.6
Al of DMEM. As a control experiment, 1 Al of killed (frozen) dissociated
SVZ cells was injected. Cells were stereotaxically implanted into the
cingulum (Ci) in the right hemisphere (1 mm anterior to Bregma, 1 mm
lateral, and 2 mm deep from cortex surface). Animals were anesthetized and
perfused with 4% paraformaldehyde (PFA) at four various postinjection
times (4 h, 7 days or 22 days or 11 weeks). Sagittal or coronal serial sections
were cut with either a Leica cryostat (12-Am sections) or a Leica vibratome
(50-Am sections) and immunostained as described below.
Data from the various experimental groups were submitted to
nonparametric tests appropriate for small populations or for non normally
distributed populations. We used either the Mann – Whitney test for twogroup comparison or a one-way ANOVA analysis followed by a Fisher test
for multiple group comparison.
Immunolabeling on brain sections
Immunofluorescent labeling was performed on brain sections as
previously described (Chazal et al., 2000). The following antibodies were
used: anti-MBP (mouse IgG1, 1/1000; Euromedex, Souffelweyersheim,
France), Tuj1 recognizing neuron-specific betaIII tubulin (mouse IgG2a, 1/
500; CRP, Denver USA), anti-PSA (mouse IgM, MenB clone, supernatant 1/
2, our laboratory), anti-Nestin (mouse IgG1, 1/1000; Developmental Studies
Hybridoma Bank), anti-GFAP (mouse IgG 1/1000; Sigma, Saint Quentin
Fallavier, France), anti-NG2 (mouse IgG, 1/100 Euromedex), anti-Olig2
(gift from D. Rowitch, Dana Farber Cancer Institute, Boston). Fluorochrome-conjugated secondary antibodies (1/200) were from Jackson
Immunoresearch Laboratories (West Grove, PA). Images were taken on a
Carl Zeiss Axioplan II microscope (Zeiss, Rueil Malmaison, France).
Confocal microscopy on sections was performed using the Carl Zeiss
ApoTome Imaging System. Images were assembled with the Adobe
Photoshop software.
Cell proliferation and cell apoptosis assay
Grafted cell proliferation was examined at 7 and 22 days postgrafting.
BrdU, a marker of DNA synthesis, was injected (100 mg/kg, intraperitoneally) twice a day during the 5 days preceding sacrifice, which was
performed 2 h after the last injection. BrdU was revealed by immunohistochemistry (IgG mouse antibody 1/100; DAKO, Glostrup, Denmark) after
a 30-min DNA denaturation with 2N HCl in PBS at 37-C.
Apoptotic cells were identified on sections using an anti-cleaved
caspase-3 antibody (Cell signaling technology, Beverly, USA).
GFP/Brdu-positive and GFP/cleaved caspase-3-positive cells were
counted on at least 6 serial sections, and the results are expressed as a
percentage of GFP-positive cells.
Phenotypic analysis of grafted cells
Cell bodies of GFP-positive cells were counted on 3 sections per animal
(i.e., a total of 137 to 239 counted cells/mouse). Double labeling for NG2,
Olig2, GFAP, or Tuj-1 was identified using the Zeiss ApoTome System.
Results are expressed as a percentage of GFP-positive cells.
Quantification of cell migration distance in vivo
GFP-immunoreactive cells were analyzed on every four serial brain
sections from at least 3 to 5 recipient mice per condition. In vivo mapping
of grafted cells was based on the Paxinos and Franklin (2001) atlas. The
migration along the Ci was estimated on sagittal sections using the
Acknowledgments
We thank the French Multiple Sclerosis Society (ARSEP) and
the INSERM Stem Cell Network for their support. Dr. D. Rowitch
kindly provided the anti-Olig2 antibody. We are very thankful to
Gilberte Monti for the excellent technical assistance as well as to
Monique Dubois-Dalcq, Geneviève Rougon, Harold Cremer and
all the members of our team for discussion of the data and critical
reading of the manuscript. M. B. and A. B. were supported by the
European Community (QLG3-CT-2000-00911).
References
Aguirre, A., Gallo, V., 2004. Postnatal neurogenesis and gliogenesis in the
olfactory bulb from NG2-expressing progenitors of the subventricular
zone. J. Neurosci. 24, 10530 – 10541.
Aguirre, A.A., Chittajallu, R., Belachew, S., Gallo, V., 2004. NG2expressing cells in the subventricular zone are type C-like cells and
contribute to interneuron generation in the postnatal hippocampus. J.
Cell Biol. 165, 575 – 589.
Blakemore, W.F., Franklin, R.J., 2000. Transplantation options for
therapeutic central nervous system remyelination. Cell Transplant 9,
289 – 294.
Chazal, G., Durbec, P., Jankovski, A., Rougon, G., Cremer, H., 2000.
Consequences of neural cell adhesion molecule deficiency on cell
migration in the rostral migratory stream of the mouse. J. Neurosci. 20,
1446 – 1457.
Chiasson, B.J., Tropepe, V., Morshead, C.M., van der Kooy, D., 1999.
Adult mammalian forebrain ependymal and subependymal cells
demonstrate proliferative potential, but only subependymal cells have
neural stem cell characteristics. J. Neurosci. 19, 4462 – 4471.
Doetsch, F., Garcia-Verdugo, J.M., Alvarez-Buylla, A., 1997. Cellular
composition and three-dimensional organization of the subventricular germinal zone in the adult mammalian brain. J. Neurosci. 17,
5046 – 5061.
Doetsch, F., Caille, I., Lim, D.A., Garcia-Verdugo, J.M., Alvarez-Buylla,
A., 1999. Subventricular zone astrocytes are neural stem cells in the
adult mammalian brain. Cell 97, 703 – 716.
Durbec, P., Rougon, G., 2001. Transplantation of mammalian olfactory
progenitors into chick hosts reveals migration and differentiation
potentials dependent on cell commitment. Mol. Cell. Neurosci. 17,
561 – 576.
Greenwood, K., Butt, A.M., 2003. Evidence that perinatal and adult NG2glia are not conventional oligodendrocyte progenitors and do not
depend on axons for their survival. Mol. Cell. Neurosci. 23, 544 – 558.
Hack, M.A., Sugimori, M., Lundberg, C., Nakafuku, M., Gotz, M., 2004.
Regionalization and fate specification in neurospheres: the role of Olig2
and Pax6. Mol. Cell. Neurosci. 25, 664 – 678.
758
M. Cayre et al. / Mol. Cell. Neurosci. 31 (2006) 748 – 758
Hack, M.A., Saghatelyan, A., de Chevigny, A., Pfeifer, A., Ashery-Padan,
R., Lledo, P.M., Gotz, M., 2005. Neuronal fate determinants of adult
olfactory bulb neurogenesis. Nat. Neurosci. 8, 865 – 872.
Hadjantonakis, A.K., Gertsenstein, M., Ikawa, M., Okabe, M., Nagy, A.,
1998. Generating green fluorescent mice by germline transmission of
green fluorescent ES cells. Mech. Dev. 76, 79 – 90.
Herrera, D.G., Garcia-Verdugo, J.M., Alvarez-Buylla, A., 1999. Adultderived neural precursors transplanted into multiple regions in the adult
brain. Ann. Neurol. 46, 867 – 877.
Kakita, A., Goldman, J.E., 1999. Patterns and dynamics of SVZ cell
migration in the postnatal forebrain: monitoring living progenitors in
slice preparations. Neuron 23, 461 – 472.
Kakita, A., Zerlin, M., Takahashi, H., Goldman, J.E., 2003. Some glial
progenitors in the neonatal subventricular zone migrate through the
corpus callosum to the contralateral cerebral hemisphere. J. Comp.
Neurol. 458, 381 – 388.
Lachapelle, F., Avellana-Adalid, V., Nait-Oumesmar, B., Baron-Van
Evercooren, A., 2002. Fibroblast growth factor-2 (FGF-2) and
platelet-derived growth factor AB (PDGF AB) promote adult
SVZ-derived oligodendrogenesis in vivo. Mol. Cell. Neurosci. 20,
390 – 403.
Levison, S.W., Goldman, J.E., 1997. Multipotential and lineage restricted
precursors coexist in the mammalian perinatal subventricular zone.
J. Neurosci. Res. 48, 83 – 94.
Lim, D.A., Fishell, G.J., Alvarez-Buylla, A., 1997. Postnatal mouse
subventricular zone neuronal precursors can migrate and differentiate
within multiple levels of the developing neuraxis. Proc. Natl. Acad. Sci.
U. S. A. 94, 14832 – 14836.
Lim, D.A., Flames, N., Collado, L., Herrera, D.G., 2002. Investigating the
use of primary adult subventricular zone neural precursor cells for
neuronal replacement therapies. Brain Res. Bull. 57, 759 – 764.
Lois, C., Alvarez-Buylla, A., 1994. Long-distance neuronal migration in the
adult mammalian brain. Science 264, 1145 – 1148.
Marshall, C.A., Suzuki, S.O., Goldman, J.E., 2003. Gliogenic and
neurogenic progenitors of the subventricular zone: who are they, where
did they come from, and where are they going? Glia 43, 52 – 61.
Nait-Oumesmar, B., Decker, L., Lachapelle, F., Avellana-Adalid, V.,
Bachelin, C., Van Evercooren, A.B., 1999. Progenitor cells of the
adult mouse subventricular zone proliferate, migrate and differentiate into oligodendrocytes after demyelination. Eur. J. Neurosci. 11,
4357 – 4366.
Nishiyama, A., Watanabe, M., Yang, Z., Bu, J., 2002. Identity, distribution,
and development of polydendrocytes: NG2-expressing glial cells.
J. Neurocytol. 31, 437 – 455.
Paxinos, G., Franklin, K.B.J., 2001. The Mouse Brain in Stereotaxic
Coordinates, second edR Academic Press.
Peters, A., 2004. A fourth type of neuroglial cell in the adult central nervous
system. J. Neurocytol. 33, 345 – 357.
Picard-Riera, N., Decker, L., Delarasse, C., Goude, K., Nait-Oumesmar, B.,
Liblau, R., Pham-Dinh, D., Evercooren, A.B., 2002. Experimental
autoimmune encephalomyelitis mobilizes neural progenitors from the
subventricular zone to undergo oligodendrogenesis in adult mice. Proc.
Natl. Acad. Sci. U. S. A. 99 (20), 13211 – 13216.
Pluchino, S., Quattrini, A., Brambilla, E., Gritti, A., Salani, G., Dina, G.,
Galli, R., Del Carro, U., Amadio, S., Bergami, A., Furlan, R., Comi, G.,
Vescovi, A.L., Martino, G., 2003. Injection of adult neurospheres
induces recovery in a chronic model of multiple sclerosis. Nature 422,
688 – 694.
Suzuki, S.O., Goldman, J.E., 2003. Multiple cell populations in the early
postnatal subventricular zone take distinct migratory pathways: a
dynamic study of glial and neuronal progenitor migration. J. Neurosci.
23, 4240 – 4250.
Temple, S., 2001. Stem cell plasticity: building the brain of our dreams.
Nat. Rev., Neurosci. 2, 513 – 520.
Torregrossa, P., Buhl, L., Bancila, M., Durbec, P., Schafer, C., Schachner,
M., Rougon, G., 2004. Selection of poly-alpha 2,8-sialic acid
mimotopes from a random phage peptide library and analysis of their
bioactivity. J. Biol. Chem. 279, 30707 – 30714.
Warrington, A.E., Barbarese, E., Pfeiffer, S.E., 1993. Differential myelinogenic capacity of specific developmental stages of the oligodendrocyte
lineage upon transplantation into hypomyelinating hosts. J. Neurosci.
Res. 34, 1 – 13.
Wichterle, H., Garcia-Verdugo, J.M., Alvarez-Buylla, A., 1997. Direct
evidence for homotypic, glia-independent neuronal migration. Neuron
18, 779 – 791.
Windrem, M.S., Roy, N.S., Wang, J., Nunes, M., Benraiss, A., Goodman,
R., McKhann II, G.M., Goldman, S.A., 2002. Progenitor cells derived
from the adult human subcortical white matter disperse and differentiate
as oligodendrocytes within demyelinated lesions of the rat brain.
J. Neurosci. Res. 69, 966 – 975.
Windrem, M.S., Nunes, M.C., Rashbaum, W.K., Schwartz, T.H., Goodman,
R.A., McKhann, G. II, Roy, N.S., Goldman, S.A., 2004. Fetal and adult
human oligodendrocyte progenitor cell isolates myelinate the congenitally dysmyelinated brain. Nat. Med. 10, 93 – 97.
B. Utilisation de marqueurs gliaux dans l’étude des gliomes
humains
I. Introduction
1. Définition des gliomes
Les gliomes sont des tumeurs primitives du SNC constituées de cellules présentant des
caractéristiques histologiques de cellules gliales. Leur importance épidémiologique est
majeure : ils représentent 90% des tumeurs malignes primitives cérébrales.
2. Classification des gliomes selon l’OMS
Le système de classification des gliomes le plus utilisé est celui de l’Organisation
Mondiale de la Santé (OMS) (Kleihues & Cavenee 2000b). Il est basé sur l’observation
histologique des tumeurs, qui permet de déterminer le type de cellules prédominant et le
grade, d’après les signes d’anaplasie : plus une tumeur est maligne, plus ses cellules semblent
indifférenciées. Le tableau 5 présente les différents types de gliomes selon cette
classification.
Tableau 5 : Classification des gliomes selon l’OMS
Tumeurs astrocytaires
Tumeurs
Gliomes mixtes
oligodendrogliales
Grade I
Astrocytomes
-
-
pilocytiques
Grade II
Astrocytomes diffus
Oligodendrogliomes
Oligoastrocytomes
Grade III
Astrocytomes
Oligodendrogliomes
Oligoastrocytomes
anaplasiques
anaplasiques
anaplasiques
Glioblastomes
-
-
Grade IV
Tiré de Kleihus & Cavenee, 2000
3. Classification de l’hôpital Sainte-Anne
Cette classification de l’OMS présente cependant un important défaut de
reproductibilité : d’une part, différents neuropathologistes ne font très souvent pas le même
diagnostic d’une tumeur donnée, ne s’accordant par exemple que sur 65% des astrocytomes
89
de bas grades, et, d’autre part, un même observateur peut changer son diagnostic lorsqu’il
observe deux fois l’histologie d’une seule tumeur à quelques semaines d’intervalle (Mittler et
al. 1996; Coons et al. 1997). C’est à cause de ce problème qu’une équipe de l’hôpital SainteAnne, à Paris, a proposé une nouvelle classification, fondée non seulement sur
l’histopathologie mais aussi sur les données cliniques et l’imagerie cérébrale (Daumas-Duport
et al. 1987).
4. Approche moléculaire
Malgré tout, ces classifications des gliomes restent imparfaites. Plus récemment, des
recherches ont mis en évidence des modifications génétiques et chromosomiques dans les
cellules tumorales qui pourraient permettre d’affiner leur classification. Par exemple, cette
approche moléculaire a montré qu’une délétion totale des régions chromosomiques 1p et 19q
est caractéristique des oligodendrogliomes (Idbaih et al. 2005). Ces progrès dans le typage
des gliomes visent bien entendu à optimiser leur traitement (pour une revue, voir Boudreau et
al. 2005). A titre d’illustration, mentionnons que des études ont montré une amplification de
la signalisation par le récepteur de l’EGF dans certains glioblastomes (Shinojima et al. 2003)
et que des essais cliniques ciblés ont déjà été entrepris avec des molécules inhibitrices de cette
voie de signalisation (Halatsch et al. 2006).
5. Utilisation de marqueurs gliaux dans la classification des gliomes
Pour améliorer encore davantage la classification des gliomes, de nombreux groupes
proposent d’identifier les cellules tumorales à partir de leur expression de combinaisons
particulières de gènes. C’est dans cette optique que nous avons établi une collaboration avec
l’équipe du Dr Figarella-Branger, de l’hôpital de la Timone : nous avons pu mettre à profit
nos connaissances fondamentales sur les lignages gliaux dans deux études de caractérisation
des gliomes. Nous avons ainsi étudié l’expression dans différents gliomes d’un éventail de
marqueurs gliaux déjà utilisés avec succès lors de nos études sur les précurseurs
d’oligodendrocytes chez les rongeurs.
90
II. Résultats
1. Article 5 : Expression des gènes olig commune aux gliomes et aux
précurseurs d’oligodendrocytes (Bouvier et al. 2003)
Dans la première étude présentée ci-après, nous avons analysé l’expression des
marqueurs olig (Oligodendrocyte LIneage Gene) dans plusieurs types de gliomes humains.
Les astrocytomes (astrocytomes pilocytiques et glioblastomes) et les oligodendrogliomes sont
classiquement considérés comme des tumeurs dérivant respectivement de la transformation
d’un astrocyte ou d’un oligodendrocyte. Alors que l’expression de la protéine GFAP dans les
astrocytomes, par exemple, est compatible avec cette hypothèse, certains marqueurs des
oligodendrocytes matures ne sont pas trouvés dans les oligodendrogliomes. Une hypothèse
alternative est que ces tumeurs pourraient dériver de cellules plus immatures, cellules souches
ou progéniteurs engagés dans la voie de différenciation gliale (Singh et al. 2003). Nous avons
donc voulu examiner leur expression de marqueurs précoces du lignage oligodendrocytaire.
Nous nous sommes intéressés plus particulièrement aux gènes olig1 et olig2, deux facteurs de
transcription qui caractérisent tout le lignage oligodendrocytaire. Nous avons établi que ces
gènes sont exprimés par les oligodendrogliomes mais aussi dans toutes les tumeurs gliales
étudiées. L’ensemble de ces données suggère que les marqueurs olig1 et olig2 pourraient êtres
présents dans tous les gliomes et ne suffiraient donc pas à un poser un diagnostic.
2. Article 6 : Pertinence des profils d’expression de filaments intermédiaires
et de facteurs de transcription pour comprendre l’histogenèse des gliomes
(Colin et al., soumis)
Dans cette seconde étude (soumise pour publication à Neuropathology & Applied
Neurobiology), nous avons voulu définir des marqueurs spécifiques de trois types de gliomes :
les astrocytomes pilocytiques, les glioblastomes et les oligodendrogliomes. Notons que, pour
limiter les erreurs dues à un mauvais diagnostic, nous n’avons utilisé que des tumeurs dont la
classification ne laissait aucun doute. Comme nous avions démontré précédemment que
l’expression des marqueurs olig1 et olig2 n’est pas spécifique d’un type de gliomes, nous
avons considéré qu’il était nécessaire d’analyser l’expression d’une combinaison de plusieurs
marqueurs pour en déduire un profil spécifique. Nous avons par conséquent choisi d’étudier
par immunomarquage et hybridation in situ l’expression des protéines des filaments
intermédiaires GFAP, vimentine et nestine, des facteurs de transcription Olig2, Nkx2.2 et
Sox10 et des transcrits plp/dm20 du protéolipide PLP. Dans le SNC normal, GFAP et
91
vimentine sont généralement considérés comme des marqueurs astrocytaires, tandis qu’Olig2,
Nkx2.2, Sox10 et plp/dm20 marquent plutôt des cellules du lignage oligodendrocytaire. Pour
sa part, nestine est exprimée dans les cellules souches et des progéniteurs neuraux (Lendahl et
al. 1990) peu différenciés, de même que dans la glie réactionnelle (Clarke et al. 1994). Nos
résultats indiquent que les trois sous-types de gliomes étudiés présentent des profils
d’expression distinctifs pour ces marqueurs. En effet, les astrocytomes pilocytiques expriment
fortement GFAP, vimentine, Olig2, Nkx2.2 et Sox10, mais pas nestine. Par contre, les
glioblastomes expriment de forts niveaux de GFAP, vimentine et nestine, mais ont des
patrons d’expression hétérogènes pour les facteurs de transcription analysés. Enfin, en ce qui
concerne les oligodendrogliomes, on n’y détecte généralement pas de protéines des filaments
intermédiaires mais Olig2 est présent dans une majorité de cellules tumorales, et seule une
sous-population cellulaire exprime Nkx2.2 et Sox10. L’expression de plp/dm20 est quant à
elle assez rare dans les gliomes étudiés.
III. Discussion
1. Importance diagnostique de profils d’expression de marqueurs gliaux
Tout d’abord, ces résultats devraient contribuer à améliorer le diagnostic des gliomes.
En effet, nous avons identifié des gènes pouvant servir de marqueurs distinctifs et d’autres ne
semblant pas spécifiques. Ainsi, nos résultats sont venus contredire des études affirmant que
l’expression des gènes olig était spécifique des oligodendrogliomes (Lu et al. 2001; Marie et
al. 2001). D’autres groupes ont depuis confirmé nos conclusions (Ohnishi et al. 2003; Ligon
et al. 2004; Riemenschneider et al. 2004). Cependant, Ohnishi et ses collaborateurs ont tout
de même suggéré que la proportion de cellules Olig2+ dans les gliomes pouvaient servir à
distinguer les oligodendrogliomes (fortement Olig2+) des glioblastomes (plus faiblement
Olig2+). Nos résultats ne vont pas dans ce sens : bien que les oligodendrogliomes que nous
avons analysés soient constitués d’une forte proportion de cellules Olig2+, l’hétérogénéité
d’expression d’Olig2 dans les glioblastomes étudiés ne permet pas d’utiliser Olig2 comme
outil diagnostique. Ces divergences de résultats soulignent l’importance d’approfondir ces
études par une analyse sur un plus grand nombre de tumeurs.
Nous proposons plutôt d’utiliser la combinaison des marqueurs GFAP, nestine, Olig2 et
Sox10. En effet, les astocytomes pilocytiques sont généralement GFAP+/nestine/Olig2+/Sox10+, les glioblastomes sont GFAP+/nestine+ mais présentent des profils
d’expression hétérogènes pour Olig2 et Sox10, et les oligodendrogliomes sont GFAP92
/nestine-/Olig2+ et hétérogènes pour Sox10+. Bien entendu, nos travaux sont loin d’être les
premiers à montrer l’expression de certains gènes des lignages gliaux normaux dans des
gliomes (par exemple, voir Bonnin & Rubinstein 1984). Cependant, à notre connaissance,
personne n’avait étudié cette combinaison de gènes dans une même série de tumeurs. De plus,
les travaux précédents se basaient souvent sur d’autres méthodes, notamment le Western blot,
le dot blot, la RT-PCR et, plus récemment, l’analyse de puce à ADN. Or, il n’est pas
impossible que du tissu sain soit aussi présent dans l’échantillon étudié et contamine ainsi les
préparations de protéines ou d’ARN. Il est donc préférable de confirmer ce type d’analyses
par des marquages in situ, tels que les nôtres : ils ont l’avantage de permettre la distinction des
cellules tumorales des cellules saines voisines ainsi que le comptage des cellules positives
pour un marqueur donné. Evidemment, nos données sont à valider sur un plus grand nombre
de tumeurs afin de vérifier si les combinatoires établies ont une valeur diagnostique réelle.
2. Cellules souches neurales et cellules progénitrices dans les gliomes :
présence et rôle présumé dans l’oncogenèse
Par ailleurs, nos études apportent des éléments nouveaux en vue d’élucider l’origine
des tumeurs cérébrales. En effet, une question intrigue les chercheurs : les gliomes
contiennent-ils des cellules immatures (cellules souches neurales ou progéniteurs gliaux) dont
pourraient dériver les cellules tumorales (pour une revue récente, voir Sanai et al. 2005) ?
D’après nos analyses in situ, les tumeurs gliales présentent une hétérogénéité cellulaire
importante. Elles sont faites de cellules variées, qui pourraient correspondre à des étapes plus
ou moins avancées dans le processus de différenciation (ou de dé-différenciation). Par
exemple, les oligodendrogliomes sont composés de cellules GFAP-/nestine-/Olig2+ et seule
une sous-population de cellules tumorales y expriment aussi Nkx2.2 et Sox10. Ces dernières
pourraient être des cellules plus avancées dans le lignage oligodendrocytaire, si tant est que la
chronologie d’apparition des marqueurs de différenciation est la même dans les tumeurs et au
cours du développement normal.
Nos résultats considérés isolément ne permettent pas de répondre à la question sur la
présence et le rôle des cellules souches ou progénitrices dans les tumeurs. Ils sont à mettre en
parallèle avec d’autres travaux qui ont notamment été menés dans l’équipe du Dr FigarellaBranger : des tumeurs ont été cultivées in vitro (sous forme d’explants ou de cellules isolées)
afin de déterminer les potentiels de migration, de prolifération et de différenciation des
cellules tumorales. Il en ressort que les astrocytomes pilocytiques, les glioblastomes et les
oligodendrogliomes sont constitués de mélanges de types cellulaires, comportant notamment
93
des précurseurs indifférenciés et leur descendance (Colin et al. 2006). En particulier, tous ces
types de gliomes contiennent des cellules A2B5+ ressemblant soit à des OPC en division lente
dans les astrocytomes pilocytiques, soit à des Glial Restricted Precursors (GRP) en division
rapide dans les glioblastomes et les oligodendrogliomes. De même, Singh et ses
collaborateurs ont identifié des cellules CD133+ qui présentent des propriétés de cellules
souches neurales, en particulier en ce qui concerne la formation de neurosphères et l’autorenouvellement in vitro (Singh et al. 2003).
Ces cellules immatures seraient-elles les principales responsables de la croissance
tumorale ? Il est un peu prématuré de l’affirmer mais quelques indices le suggèrent. Par
exemple, en isolant par tri magnétique les cellules A2B5+ des glioblastomes et des
oligodendrogliomes, l’équipe du Dr Figarella-Branger a démontré que ces cellules présentent
les mêmes altérations génétiques que l’ensemble des cellules de la tumeur dont elles sont
issues. Ces cellules A2B5+ seraient donc des progéniteurs gliaux transformés qui pourraient
en proliférant contribuer à la progression de la tumeur. Malheureusement, pour l’instant, on
ne connaît pas de transformation génétique caractéristique des astrocytomes pilocytiques qui
pourrait servir de la même façon à déterminer si toutes les cellules d’un astrocytome
pilocytique donné présentent les mêmes mutations et dériveraient donc d’une cellule unique.
Par ailleurs, les tumeurs malignes contiendraient davantage de « cellules souches » CD133+
que celles qui sont bénignes (Singh et al. 2003), ce qui corroborerait aussi l’idée que les
cellules souches participent à la croissance des gliomes. Enfin, une autre indication dans ce
sens provient de travaux comme ceux de Holland, où la formation de glioblastomes peut être
induite chez des souris par la seule activation des voies Ras et Akt spécifiquement dans les
progéniteurs nestine+ (Holland et al. 2000).
Il est important de poursuivre ces études et notamment de développer de nouveaux
marqueurs des populations de cellules tumorales. Dans le cas de marqueurs de surface, cela
permettra d’isoler ces populations et d’étudier ensuite leurs propriétés en culture ou de
comparer leur potentiel tumorigène in vivo après transplantation. La découverte de marqueurs
spécifiques pourra également servir à transformer spécifiquement certaines sous-populations
cellulaires in vivo afin d’analyser l’induction subséquente de gliomes. L’objectif ultime de ces
expériences sera de découvrir des voies de signalisation importantes pour la prolifération et la
migration des cellules progénitrices tumorales, et donc de cibler ces voies pour s’attaquer à la
progression de la maladie (Singh et al. 2004a).
94
IV. Conclusion
En fin de compte, nous avons remarqué que les trois types de gliomes étudiés
(astrocytomes pilocytiques, glioblastomes et oligodendrogliomes) ne sont pas spécifiquement
caractérisables par l’expression des seuls gènes olig. Par contre, la combinatoire des
marqueurs neuraux GFAP, nestine, Olig2 et Sox10 peut permettre de les distinguer. Il serait
souhaitable de confirmer ces résultats sur un plus grand nombre de tumeurs et, à long terme,
d’étudier la corrélation entre des tumeurs avec un profil d’expression donné, leur réponse à la
thérapie et le pronostic vital.
Notre étude contribue également à montrer que les gliomes contiennent des cellules
qui, par leur expression de marqueurs et leurs propriétés en culture, rappellent des
progéniteurs gliaux. Leur analyse plus poussée devrait mener à une meilleure compréhension
du processus oncogénique et, espérons-le, dévoiler de nouvelles cibles thérapeutiques.
95
J Neurosurg 99:344–350, 2003
Shared oligodendrocyte lineage gene expression in gliomas
and oligodendrocyte progenitor cells
CORINNE BOUVIER, M.D., CATHERINE BARTOLI, PH.D., LUCINDA AGUIRRE-CRUZ, M.D.,
ISABELLE VIRARD, CAROLE COLIN, CARLA FERNANDEZ, JOANY GOUVERNET, M.D.,
AND DOMINIQUE FIGARELLA-BRANGER, M.D., PH.D.
Laboratoire des Interactions Neurone-Glie, Groupe Hospitalier Pitié-Salpétrière, Paris; Laboratoire de
Biopathologie Nerveuse et Musculaire, Faculté de Médecine; NMDA-Centre National de la Recherche
Scientifique UMR 6156, Institut de Biologie et du Développement, Parc Scientifique de Luminy; and
Service de l’Information Médicale, Hôpital de la Timone, Marseille, France
Object. Gliomas (astrocytic and oligodendroglial) are the most frequently occurring primary neoplasms in the central
nervous system (CNS). Histological classification, which can be performed to distinguish astrocytomas from oligodendrogliomas, is essentially based on pathological features and has great prognostic and therapeutic value but lacks reproducibility. Specific markers of cell lineage, especially those for oligodendrogliomas, are still lacking. The oligodendrocyte
lineage (OLIG) genes, transcriptional factors of the basic helix-loop-helix family, have been recently identified in oligodendrocyte progenitor cells (OPCs) in the CNS of developing and adult rodents. Data from a few studies have shown in a
small series of brain tumors that OLIG genes characterize oligodendrogliomas. To search for a differential expression of
the OLIG genes in subgroups of brain tumors, the authors investigated OLIG1 and OLIG2 gene expression.
Methods. Using semiquantitative reverse transcription–polymerase chain reaction (RT-PCR), the authors analyzed a series of 89 tumors (71 astrocytic and oligodendroglial tumors, eight ependymomas, three medulloblastomas, four meningiomas, and three schwannomas) and normal human brain tissue samples. It was demonstrated that OLIG gene expression
was largely limited to glial tumors, that is, astrocytomas and oligodendrogliomas. A very low level was detected in ependymomas, whereas other tumors lacked OLIG gene expression altogether. Surprisingly, OLIG1 and OLIG2 expression was
not limited to oligodendroglial tumors, but was observed in astrocytic lesions as well, independent of tumor grade. Interestingly, these genes were expressed at the highest level in pilocytic astrocytomas according to semiquantitative RT-PCR
results, which were confirmed on dot blot analysis. In situ hybridization showed that the OLIG2 gene was expressed by
tumor cells in pilocytic astrocytomas as well as those in oligodendrogliomas.
Conclusions. The OLIG genes are additional markers shared by all gliomas and OPCs. These markers may help to classify gliomas, to improve understanding of their histogenesis, and to identify new therapeutic targets.
KEY WORDS • glioma • oligodendroglioma • oligodendrocyte lineage gene •
oligodendrocyte progenitor cell • pilocytic astrocytoma
genetic study methods have dramatically
progressed during the last 20 years, histological
classification of glial neoplasms is still based on the
morphological similarities between tumor cells and nonneoplastic cells.8 Accurate classification is of the utmost importance, however, because the response of gliomas to therapy shows a correlation with cell lineage.3,8,13
Diffuse astrocytomas, such as glioblastomas (the most
frequent and malignant variant), and oligodendrogliomas
are defined as being composed of astrocytes and oligodendrocytes that may derive from the neoplastic transformation
A
LTHOUGH
Abbreviations used in this paper: bHLH = basic helix-loop-helix;
cDNA = complementary DNA; CNS = central nervous system;
cRNA = complementary RNA; EDTA = ethylenediamine tetraacetic acid; GAPDH = glyceraldehyde-3-phosphate-dehydrogenase;
mRNA = messenger RNA; OLIG = oligodendrocyte lineage; OPC =
oligodendrocyte progenitor cell; PDGFR = platelet-derived growth
factor receptor–; RT = reverse transcription; RT-PCR = RT–polymerase chain reaction.
344
of mature glial cells. The strong glial fibrillary acidic protein expression in astrocytomas is compatible with that hypothesis; however, markers of mature oligodendrocytes are
not found in oligodendrogliomas.
An alternative hypothesis is that gliomas may arise from
dividing progenitor cells. In vitro O-2A rat progenitor cells
differentiate into oligodendrocytes in serum-free medium
and into Type II astrocytes in serum-containing medium.19
The O-2A progenitor cells expressed some antigenic epitopes such as the PDGFR,4,14 the NG2 chondroitin sulfate
proteoglycan, and the PEN5 epitope in a temporally regulated sequence.5,17 Data from two recent studies have shown
that some gliomas, especially oligodendrogliomas and pilocytic astrocytomas (a variant of circumscribed gliomas),
expressed these markers, thus providing evidence that glial
tumors may arise from oligodendrocyte O-2A progenitor
cells.5,17
Other interesting markers are the transcriptional factors
of the bHLH family. The bHLH proteins play a key role in
J. Neurosurg. / Volume 99 / August, 2003
OLIG gene expression in gliomas
cell-type determination in a variety of tissues and organs.6
Recently, the OLIG genes have been identified and belong
to the family of bHLH transcription factors. In fact, they
could be specific to the oligodendrocyte lineage.10,22 Results of Northern blot analysis showed that the OLIG1 and
OLIG2 transcripts were specific to the brain in the rat. Further, OLIG1 and OLIG2 gene expression was also found in
O-2A cells in dissociated primary cultures of P5 rat optic
nerve. In developing mouse embryos, OLIG1 and OLIG2
genes were expressed in OPCs in the ventral spinal cord.
Their expression preceded that of PDGFR and persisted in
the adult rat stage. Other authors have shown that OLIG2 is
expressed by a progenitor common to neurons and oligodendrocytes in the mouse.18 Very recently, OLIG genes in
humans have been reported to be reliable markers of oligodendrogliomas.9,11 In these studies the expression of OLIG
genes were analyzed using in situ hybridization in a limited
number of gliomas.
To characterize further the histogenesis of gliomas in the
human brain and to define specific markers for diagnosis,
we have used semiquantitative RT-PCR to search for the expression of human orthologs of OLIG genes in normal adult
and fetal brain tissues and in 89 CNS tumors. Particular attention was paid to the subgroup of pilocytic astrocytomas,
which shared with O-2A cells the expression of some molecules.5,17 In a few cases, dot blot and in situ hybridization
were also performed to confirm further the quantification
demonstrated in RT-PCR analysis and to see the cellular pattern of expression of the OLIG2 gene. We show that
OLIG1 and OLIG2 genes in humans are expressed in glial
tumors only and that the level of expression varies according to the pathological diagnosis.
Materials and Methods
Human Tissue Collection
The present study was undertaken after informed consent was obtained from each patient or the patient’s relatives.
Brain tumor samples were collected in the operating room. All tumors were classified by three pathologists according to the World
Health Organization CNS tumor classification.8 They included 10
pilocytic astrocytomas, four Grade II astrocytomas, three Grade III
anaplastic astrocytomas, 19 Grade IV glioblastomas, 15 Grade II oligodendrogliomas, and 20 Grade III anaplastic oligodendrogliomas.
In addition, eight ependymomas were studied. Control tumors included four meningiomas, three schwannomas, and three medulloblastomas.
Brain (frontal lobe) tissues were obtained during autopsies in two
adults who had died from nonneurological disorders and in two fetuses (14 and 20 weeks of gestation) that had spontaneously terminated. These tissues were obtained less than 12 hours after death.
Neuropathological examination was normal in all cases. Samples
were placed in liquid nitrogen and stored at 80˚C until the extraction of RNA.
For in situ hybridization, one additional specimen from two pilocytic astrocytomas and two oligodendrogliomas were fixed in 2%
paraformaldehyde for 4 hours, cryoprotected in phosphate-buffered
saline containing 20% sucrose overnight, and then frozen in melting
isopentane and stored at 80˚C.
Experimental Procedures
Extraction of RNA and RT. Total cellular RNA was extracted using the guanidinium thiocyanate method,2 followed by the addition
of deoxyribonuclease I (20 U/sample) and RNAsin (40 U/sample)
for 15 minutes at 37˚C. Reverse transcription was performed on ap-
J. Neurosurg. / Volume 99 / August, 2003
TABLE 1
Primers used for PCR amplifications*
Primers
Sequence
GAPDH D 5CCTCAAAGGCATCCTGGGCTACA3
Position
GenBank
GI
867-890
31644
GAPDH R 5CATGTGGGCCATGAGGTCCACCAC3 1053-1030
OLIG1 D
5CATTTCGAACCTTCCAGTCC3
2761-2780 4835658
OLIG1 R
5GCCTCCTTTGATAGGACCTG3
3192-3173
OLIG2 D
5TTCCCTGCGACGACTATCTTCCC3
4-26
OLIG2 R
5GCGGCTGTTGATCTTGAGACGC3
382-361
1199656
* GI = GenInfo Identifier sequence identification number.
proximately 1 g total RNA by using hexanucleotide random primers (Boehringer, Meylan, France) and reverse transcriptase (SuperScript; Life technologies, Cergy Pontoise, France), according to the
recommendations of the manufacturers.
Detection of the GAPDH Transcript in the Different Tissues. First,
relative RT-PCR amplification of the GAPDH transcripts was performed on a PCR express gradient cycler (Hybaid; Coger, Paris,
France) to confirm RNA integrity and to homogenize the amount of
cDNA to be used in each of the PCRs. A limited number of cycles
were used, and this allowed us to focus on the linear portion of the
amplification curve. Intensity analysis of the amplified bands was
performed with an imager (Appligene, Illkinch, France) and the
appropriate computer program (Imager, version 1.61; Natural Institutes of Health, Bethesda, MD). The volume of RT reactions (or
the amount of cDNA) was then adjusted to obtain equal amounts of
GAPDH amplification product for each case.1 The GAPDH primers
used are described in Table 1, and we adhered to the following program for 22 cycles: 1) denaturation at 95˚C for 10 seconds; 2) annealing at 65˚C for 15 seconds; and 3) DNA synthesis at 72˚C for 8
seconds.
Detection of OLIG1 and OLIG2 mRNAs in Different Tissues. In a
second step, amplification of the OLIG1 and OLIG2 mRNAs was
performed with an equal amount of cDNA, 200 ng of each specific
primer, 200 mM deoxynucleoside triphosphate and 2.5 U Taq DNA
polymerase in a solution of 10 mM Tris-HCl, 50 mM KCl, and 1.5
mM MgCl2 (pH 8.3) supplemented with Q solution (Qiagen, Courtaboeuf, France) at a final concentration 1. The primers used are
described in Table 1.
Polymerase chain reaction amplification was performed as follows: for OLIG1, 31 cycles of denaturation at 95˚C for 40 seconds,
annealing at 57˚C for 40 seconds, and DNA synthesis at 72˚C for 40
seconds; for OLIG2, 30 cycles of denaturation at 95˚C for 50 seconds, annealing at 60˚C for 40 seconds, and DNA synthesis at 72˚C
for 40 seconds. Controls included samples lacking cDNA as template, and RT reactions were performed without reverse transcriptase. The OLIG1 and OLIG2 PCR amplification products (379 and
432 bp, respectively) were purified (Geneclean; Bio 110, Illkirch,
France), subcloned into a pGEM-T vector (Promega, Lyon, France),
and sequenced to verify specific amplification.
Ten microliters of PCR products was subjected to electrophoresis
on a 2% agarose gel (Eurobio, les Ullis, France) in a 1 Tris base/
acetate/EDTA buffer. Intensity analysis of the amplified products
was performed as described earlier and expressed in arbitrary units.
This procedure was performed twice.
Quantitative Analysis of OLIG2 mRNA by Dot Blot Hybridization.
Sequential dilutions of total RNA from two pilocytic astrocytomas and two oligodendrogliomas (one Grade II and one Grade III)
and from fetal brain tissue were spotted onto nitrocellulose membranes by using a manifold apparatus (Minifold I; Schleicher &
Schuell, Inc., Ecquevilly, France). For hybridization with OLIG2 and
GAPDH probes the dilutions were 10:0.078 g for the samples test-
345
C. Bouvier, et al.
TABLE 2
Results of semiquantitative RT-PCR expression of OLIG genes
in normal brain tissue and in neuroepithelial tumor tissue*
Value (AU)
Tissue Type
normal brain
adult
OLIG1
OLIG2
fetal
OLIG1
OLIG2
pilocytic astrocytoma
OLIG1
OLIG2
astrocytoma
Grade II
OLIG1
OLIG2
Grade III
OLIG1
OLIG2
Grade IV
OLIG1
OLIG2
oligodendroglioma
Grade II
OLIG1
OLIG2
Grade III
OLIG1
OLIG2
ependymoma
OLIG1
OLIG2
No. of Samples
Min
Max
Mean Median
2
2
213
44
248
49
230
46
230
46
2
2
70
70
598
594
334
332
334
332
10
10
69
30
2319
1358
965
607
910
557
4
4
67
18
715
165
247
95
104
98
3
3
0
0
972
496
346
165
67
0
19
19
0
0
904
598
280
167
303
106
15
15
61
7
1215
930
480
210
453
108
20
20
0
0
1943
840
345
153
498
51
8
8
0
0
24
10
5
2
0
0
* AU = arbitrary unit.
FIG. 2. Graph demonstrating OLIG2 gene expression in normal
brain tissue and primary CNS tumors. Note that OLIG gene expression is restricted to glial neoplasms and that pilocytic astrocytomas
have the highest expression.
ed. After spotting, the filters were baked for 2 hours at 80˚C before
hybridization. Prehybridization was performed at 42˚C for 4 hours in
50% formamide, 5 standard sodium phosphate EDTA, and 5 Denhardt solution containing 250 g/ml denatured salmon sperm
DNA. Hybridization was conducted for 24 hours at 42˚C in the earlier-mentioned solution by using 1 , instead of 5 , Denhardt solution and supplied with an [-32P]deoxycytidine triphosphate probe.
Washes were performed twice with a 2 standard saline citrate–
0.1% sodium dodecyl sulfate solution for 5 minutes and twice with a
0.1 standard saline citrate–0.1% sodium dodecyl sulfate solution
for 30 minutes each time at 50˚C. Messenger RNA concentrations
were estimated from the slopes of the linear regression curves of
the dots after scanning the autoradiographs at 490 nm with the aid of
an optical densitometer (MR 5000; Dynatech Corp., Chantilly, VA).
Differences in total RNA loading were eliminated by normalization
with the quantification of the GAPDH mRNA. Results were calculated as the OLIG2/GAPDH ratio.
In Situ Hybridization Analysis of OLIG2 Expression. Only OLIG2
expression was investigated by performing in situ hybridization on
cryostat sections of 10 m with a digoxigenin-labeled cRNA antisense probe, according to the procedure previously reported.11 The
cRNA probe was detected with an alkaline phosphatase–conjugated
antibody against digoxigenin and visualized by incubation in 4-nitro
blue tetrazolium chloride/5-bromo, 4-chloro, 3-indolyl phosphate for
12 hours.
Statistical Analysis
Appropriate statistical tests (Kruskal–Wallis test or Mann–Whitney U-test) were performed to compare OLIG gene expression in the
different groups of tumors.
Results
Data regarding semiquantitative RT-PCR for OLIG
genes are provided in Table 2 and presented in graphic form
in Figs. 1 and 2.
FIG. 1. Graph demonstrating OLIG1 gene expression in normal
brain tissue and primary CNS. Astro = astrocytoma; medullo = medulloblastoma; oligo = oligodendroglioma; pilo = pilocytic astrocytoma.
346
Expression of OLIG1 and OLIG2 in Normal Brain and
Primary CNS Tumors
Expression of the OLIG genes was observed in all norJ. Neurosurg. / Volume 99 / August, 2003
OLIG gene expression in gliomas
TABLE 3
Results of statistical analysis of OLIG1 and OLIG2 gene
expression according to tumor subtype
p Value
Tumor Type
glioma/other tumor
pilocytic astrocytoma/diffuse glioma
pilocytic astrocytoma/diffuse astrocytoma/
oligodendroglioma†
pilocytic astrocytoma/diffuse astrocytoma
pilocytic astrocytoma/oligodendroglioma
pilocytic astrocytoma/glioblastoma
diffuse astrocytoma/oligodendroglioma
Grade II/Grades III and IV gliomas
OLIG1
OLIG2
0.001*
0.003*
0.008*
0.001*
0.001*
0.002*
0.002*
0.011*
0.002*
0.268
0.052
0.001*
0.001*
0.001*
0.860
0.21
* Probability values less than 0.05 were statistically significant.
† Statistical analysis was based on the Kruskal–Wallis test for this tumor
type combination. All other analyses were based on the Mann–Whitney U-test.
FIG. 3. Polymerase chain reaction gels of OLIG1 (A) and OLIG2
(B) products of pilocytic astrocytomas (Lanes 1–10), diffuse Grade
II (Lanes 11–14) and Grade III (Lanes 16–18) astrocytomas, and
negative template (Lane 19). The level of expression of OLIG1/2
genes is higher in pilocytic astrocytomas than in diffuse astrocytomas.
mal frontal lobe samples studied and was higher in the fetal
brain compared with that in the adult brain (Fig. 3).
Under defined PCR conditions OLIG1 and OLIG2 gene
expression was detected in most gliomas (Fig. 3). In contrast, however, one Grade III astrocytoma demonstrated
neither gene and another demonstrated only OLIG1. Five
glioblastomas and three Grade III oligodendrogliomas
demonstrated neither gene. Three other Grade III oligodendrogliomas demonstrated OLIG1 only. Ependymomas
showed a very low level of expression, whereas medulloblastomas, schwannomas, and meningiomas had no detectable value of OLIG gene expression. Therefore, OLIG gene
expression was significantly different between gliomas and
other primary CNS tumors (ependymomas and nonneuroepithelial tumors; p 0.001).
Expression of OLIG Genes Varied According to
Glioma Subtype
Expression of OLIG Genes Based on RT-PCR. Pilocytic
astrocytomas always expressed OLIG genes and usually exhibited the highest level of expression on RT-PCR, although
one patient had low OLIG1 and OLIG2 gene expression.
Although we have no definitive explanation for this result,
it is worth noting that this tumor was located in the brainJ. Neurosurg. / Volume 99 / August, 2003
stem of a 22-year-old woman. Other locations for pilocytic
astrocytomas included in our series were the posterior fossa
(six cases) and medulla (three cases). They tended to occur
in younger patients.
Because the differential diagnosis between pilocytic astrocytomas and diffuse gliomas is sometimes difficult, we
have compared OLIG gene expression in pilocytic astrocytomas with other gliomas by using appropriate statistical
tests (Table 3). The expression of the OLIG gene in pilocytic astrocytomas was significantly different from that
in diffuse gliomas (p = 0.003 for OLIG1, p 0.001 for
OLIG2). In addition, OLIG gene expression was also higher in pilocytic astrocytomas compared with that in diffuse
astrocytomas (p = 0.002 for OLIG1, p = 0.001 for OLIG2),
oligodendrogliomas (p = 0.011 for OLIG1, p = 0.001 for
OLIG2), or compared with glioblastomas (p = 0.002 for
OLIG1, p = 0.001 for OLIG2).
Among diffuse gliomas, OLIG gene expression was not
statistically different between astrocytomas and oligodendrogliomas and it did not vary according to grade. Results
of statistical analysis are provided in Table 3.
Dot Blot Analysis of OLIG2 Gene Expression. Quantitative
analysis of mRNA for OLIG2 by dot blot hybridization
showed an equal amount of OLIG2 mRNA when comparing mean values achieved for the two cases of pilocytic astrocytomas and the two cases of oligodendrogliomas. The
expression of OLIG2 was sixfold higher in tumors compared with fetal brain tissue (Fig. 4). It is worth noticing that
in this dot blot hybridization experiment, the total amount
of OLIG2 gene was almost identical in the two pilocytic
astrocytomas and oligodendrogliomas regardless of tumor
grade.
Cellular Pattern of OLIG2 Gene Expression. Results of in
situ hybridization showed that almost all tumor cells in a
pilocytic astrocytoma as well as those in the two oligodendrogliomas tested demonstrated cytoplasmic staining with
cRNA antisense OLIG2 probe (Fig. 5). Note, however, that
the total amount of OLIG2 gene expression was strong in
every tumor cell in pilocytic astrocytomas (Fig. 5A and B)
and Grade II oligodendrogliomas (Fig. 5C and D) and that
its expression was different from one tumor cell to another
in Grade III oligodendrogliomas (Fig. 5E and F).
347
C. Bouvier, et al.
Expression of the OLIG Gene Varies According to the
Glioma Subtype
FIG. 4. Quantitative analysis of OLIG2 mRNA by dot blot hybridization for two pilocytic astrocytomas (Lanes 1 and 2), two oligodendrogliomas (one Grade II, Lane 3; one Grade III, Lane 4), and
fetal brain tissue at 14 weeks gestation (Lane 5). In these cases, expression is almost identical in pilocytic astrocytomas and oligodendrogliomas, but stronger than in the fetal brain tissue.
Discussion
The recent discovery of OLIG genes in OPCs and mature
oligodendrocytes9,10,18,21,22 prompted us to study the expression of these genes in normal human brain tissue and primary CNS tumors to search for a selective marker of oligodendrogliomas. Our results confirm to some extent and in a
larger number of tumors the data from two recent studies,9,11
showing OLIG gene expression in normal human brain tissue and in gliomas. Furthermore, our data revealed (for the
first time) expression of OLIG genes in pilocytic astrocytomas.
Expression of OLIG Genes in Normal Human
Brain Tissue
Although both genes were expressed in fetal and adult
human frontal lobe tissue, their expression was higher in
fetal brain. The OLIG genes are expressed in the OPCs,
which are abundant in the developing brain and are still
present and located in specific areas of the adult CNS (for
example, corpus callosum and cerebellar white matter).
These areas were not included in the specimens examined
because our study was restricted to frontal lobe tissue. This
could explain the low level of OLIG genes in adult human
brain tissue previously reported by others.9
Expression of the OLIG Gene is Restricted to
Glial Neoplasms
The OLIG genes were expressed only in gliomas (pilocytic astrocytomas and diffuse gliomas) and at very low
levels in ependymomas. Because their normal counterparts
(meningothelial cells and Schwann cells) do not express
these genes, the absence of OLIG gene expression in meningiomas and schwannomas is not surprising. The OLIG
genes were not observed by Zhou, et al.,22 in meningeal
cells and developing Schwann cells or their precursors. In
addition, we did not observe OLIG gene expression in medulloblastomas, although the number of cases studied was
too low to offer any insight into the histogenesis of this tumor—which is still a matter of debate.15
348
In contrast to data from other recent studies,9,11 OLIG
gene expression was not restricted to oligodendrogliomas
but was recorded in all glial tumors we tested using semiquantitative RT-PCR. This might be explained in several
ways. 1) The number of cases studied was much lower than
the number of cases included in the present series, a possible indication of selection bias. For example, it is clear
that some glioblastomas might express OLIG genes: two of
eight lesions in the study by Lu, et al.,9 and 12 of 19 lesions
in our study. 2) The difference observed in the data can be
explained by the method used. Polymerase chain reaction
is a much more sensitive method and although we have
shown a good correlation between the level of OLIG2 gene
expression by semiquantitative RT-PCR and dot blot analysis in some cases, it is clear that quantitative RT-PCR cannot distinguish between the diffuse, low level of OLIG gene
expression by all tumor cells in a highly dense tumor (likely the case in most glioblastomas) and the strong expression
of the OLIG gene by scattered tumor cells.
Except for one case, OLIG gene expression was high in
pilocytic astrocytomas. Results of dot blot analysis further
confirm the high expression of OLIG2 in these gliomas, and
in situ hybridization showed that tumor cells did express the
OLIG2 gene. Such results corroborate recent findings that
pilocytic astrocytomas express some markers of OPCs such
as NG2 chondroitin sulfate proteoglycan, PDGFR, and
PEN5.5,17 Coexpression of PDGFR and NG2 characterize
OPCs. Moreover, by using different markers we have demonstrated that the PEN5 epitope (which is a sulfated polylactosamine carbohydrate epitope first described in a subpopulation of mature natural killer cells20) identifies OPCs
at the transient intermediate stage between the A2B5/
Galc and A2B5/Galc and marks the transition from
the proliferative to the postmitotic stage. Expression of
the OLIG gene in the developing spinal cord precedes
PDGFR and then is coexpressed with PDGFR in both
the spinal cord and all areas of presumptive migrating oligodendrocyte precursors.10,18 Taken together, these data
indicate that pilocytic astrocytomas share with OPCs the
same markers from the earliest OLIG genes to the presumed
latest, that is, PEN5. Results of other studies have shown
that antigens present during the oligodendrocyte lineage
in vitro, such as PDGFR and A2B5, are variably expressed in gliomas.7 Other authors also found both NG2 and
PDGFR expression17 in a subset of glioblastomas, although these tumors do not express PEN5.5 Altogether,
these results indicate that all glial tumors may arise from
OPCs. As previously suggested it is likely that OPCs,
which are present in the adult human brain,12,16 have the potential to produce to neoplasms with distinctive clinical and
pathological phenotypes, perhaps as a result of different environmental influences within the brain parenchyma or different genetic alterations.
Conclusions
In this study we have reported that OLIG genes are expressed in gliomas, with their highest expression in pilocytic astrocytomas. Results of statistical analysis showed that
OLIG gene expression by semiquantitative RT-PCR did not
J. Neurosurg. / Volume 99 / August, 2003
OLIG gene expression in gliomas
FIG. 5. Photomicrographs demonstrating cellular distribution of the OLIG2 gene by in situ hybridization with OLIG2
cRNA antisense probe: in one pilocytic astrocytoma (A and B), one Grade II oligodendroglioma (C and D), and one Grade
III oligodendroglioma (E and F). Strong expression is evident in all tumor cells in pilocytic astrocytoma and Grade II oligodendroglioma. (Note that the total amount of OLIG2 gene expression may vary from one tumor cell to another in Grade
II oligodendrogliomas.) Hematoxylin phloxin saffron, original magnification 200 (A and E); 300 (C); in situ hybridization 400 (B); 300 (D); 200 (F).
vary according to tumor grade in the subgroup of oligodendrogliomas. The OLIG genes represent new markers of gliomas and, when possible, immunohistochemical analysis of
formalin-fixed paraffin-embedded specimens would be the
most simple and accurate method of investigating OLIG
gene expression and assessing its putative prognosis value
in gliomas. It is likely that the study of various markers of
OPCs and relevant genetic information, such as 1p and 19q
status, may help to classify gliomas. Finally, a better understanding of factors controlling commitment, proliferation,
survival, and differentiation of OPCs will help the identification of new therapies in patients with gliomas.
Acknowledgments
We are grateful to E. Jehan and G. Tijeras for technical assistance,
M. Paul for the editing of English, and Drs. F. Grisoli, J. C. Peragut,
J. Neurosurg. / Volume 99 / August, 2003
and G. Lena for providing fresh tumor samples. Dr. C. D. Stiles is
gratefully acknowledged for providing the DNA sequence of the
OLIG1 gene.
References
1. Bartoli C, Baeza N, Figarella C, et al: Expression of peptide-23/
pancreatitis-associated protein and Reg genes in human pituitary
and adenomas: comparison with other fetal and adult human tissues. J Clin Endocrinol Metab 83:4041–4046, 1998
2. Chomczynski P, Sacchi N: Single-step method of RNA isolation
by acid guanidinium thiocyanata-phenol-chloroform extraction.
Anal Biochem 162:156–159, 1987
3. Daumas-Duport C, Varlet P, Tucker ML, et al: Oligodendrogliomas. Part I: patterns of growth, histological diagnosis, clinical and
imaging correlations: a study of 153 cases. J Neurooncol 34:
37–35, 1997
4. Ellison JA, De Vellis J: Platelet-derived growth factor receptor is
349
C. Bouvier, et al.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
expressed by cells in the early oligodendrocyte lineage. J Neurosci Res 37:116–128, 1994
Figarella-Branger D, Daniel L, André P, et al: The PEN5 epitope
identifies an oligodendrocyte precursor cell population and pilocytic astrocytomas. Am J Pathol 155:1261–1269, 1999
Garrell J, Campuzano S: The helix-loop-helix domain: a common
motif for bristles, muscles and sex. Bioessays 13:493–498, 1991
Guha A, Dashner K, Black PM, et al: Expression of PDGF
and PDGF receptors in human astrocytoma operation specimens
supports the existence of an autocrine loop. Int J Cancer 60:
168–173, 1995
Kleihues PK, Cavenee WK: Pathology and Genetics of Tumours of the Nervous System, ed 2. Lyon: IARC Press, 2000
Lu QR, Park JK, Noll E, et al: Oligodendrocyte lineage genes
(OLIG) as molecular markers for human glial brain tumors. Proc
Natl Acad Sci USA 98:10851–10856, 2001
Lu QR, Yuk D, Alberta JA, et al: Sonic hedgehog–regulated oligodendrocyte lineage genes encoding bHLH proteins in the mammalian central nervous system. Neuron 25:317–329, 2000
Marie Y, Sanson M, Mokhtari K, et al: OLIG2 as a specific marker of oligodendroglial tumour cells. Lancet 358:298–300, 2001
Nishiyama A, Chang A, Trapp BD: NG2 glial cells: a novel glial
cell population in the adult brain. J Neuropathol Exp Neurol 58:
1113–1124, 1999
Nutt CL, Noble M, Chambers AF, et al: Differential expression of
drug resistance genes and chemosensitivity in glial cell lineages
correlate with differential response of oligodendrogliomas and astrocytomas to chemotherapy. Cancer Res 60:4812–4818, 2000
Oumesmar BN, Vignais L, Braon-Van Evercooren A: Developmental expression of platelet-derived growth factor -receptor
in neurons and glial cells of the mouse CNS. J Neurosci 17:
125–139, 1997
Rorke LB: The cerebellar medulloblastoma and its relationship
to primitive neurectodermal tumors. J Neuropathol Exp Neurol
42:1–15, 1983
Scolding N, Franklin R, Stevens S, et al: Oligodendrocyte progenitors are present in the normal adult human CNS and in the lesions
of multiple sclerosis. Brain 121:2221–2228, 1998
350
17. Shoshan Y, Nishiyama A, Chang A, et al: Expression of oligodendrocyte progenitor cell antigens by gliomas: implications for
the histogenesis of brain tumors. Proc Natl Acad Sci USA 96:
10361–10366, 1999
18. Takebayashi H, Yoshida S, Sugimori M, et al: Dynamic expression of basic helix-loop-helix Olig family members: implication
of Olig2 in neuron and oligodendrocyte differentiation and identification of a new member, Olig3. Mech Dev 99:143–148, 2000
19. Temple S, Raff MC: Differentiation of a bipotential glial progenitor cell in a single cell microculture. Nature 313:223–225, 1985
20. Vivier E, Sorell JM, Ackerly M, et al: Developmental regulation
of a mucinlike glycoprotein selectively expressed on natural killer
cells. J Exp Med 178:2023–2033, 1993
21. Woodruff RH, Tekki-Kessaris N, Stiles CD, et al: Oligodendrocyte development in the spinal cord and telencephalon: common
themes and new perspectives. Int J Dev Neurosci 19:379–385,
2001
22. Zhou Q, Wang S, Anderson DJ: Identification of a novel family of
oligodendrocyte lineage-specific basic helix-loop-helix transcription factors. Neuron 25:331–343, 2000
Manuscript received March 1, 2002.
Accepted in final form April 21, 2003.
This work was supported by grants to Dr. Figarella-Branger from
the “Programme Hospitalier de Recherche Clinique,” the Gefluc
(“Groupement des Entreprises françaises dans la Lutte contre le Cancer”), and the ARC (Association de la Recherche contre le Cancer).
We also thank the Faculty of Medicine of Marseille for fellowship
support for Dr. Bouvier.
Address for Dr. Aguirre-Cruz: Instituto Nacional de Neurologia y
Neurocirugia de Mexico, Tlalpan, Mexico.
Address reprint requests to: Dominique Figarella-Branger, M.D.,
Laboratoire de Biopathologie Nerveuse et Musculaire, Faculté de
Médecine, 27, Boulevard Jean Moulin, 13005 Marseille, France.
email: [email protected].
J. Neurosurg. / Volume 99 / August, 2003
Relevance of combinatorial profiles of intermediate filaments and
transcription factors for glioma histogenesis
C. Colin1, I. Virard2, N. Baeza1, A. Tchoghandjian1, C. Fernandez3, C. Bouvier1,3, A. Calisti1,
S. Tong1, P. Durbec2, and D. Figarella-Branger1,3
1
Laboratoire de Biopathologie de l’Adhésion et de la Signalisation, EA3281, IPHM, Faculté
de Médecine Timone, 13005 ; 2Laboratoire de Neurogenèse et Morphogenèse dans le
Développement et chez l’Adulte, UMR 6156 CNRS, IBDM, Parc scientifique de Luminy,
Marseille, France ; 3Service d’Anatomie Pathologique et de Neuropathologie, Hôpital de la
Timone, APHM, 13005, Marseille, France.
Running title: Intermediate filament and transcription factors in gliomas
Correspondence: Prof. D. Figarella-Branger, Laboratoire de Biopathologie de l’Adhésion et
de la Signalisation, Faculté de Médecine Timone, 27, Bd Jean Moulin 13005 Marseille,
France.
Phone : 33 4 91 32 44 43
Fax : 33 4 91 25 42 32
e-mail : [email protected]
Abbreviations: WHO: World Health Organization; CNS: central nervous system; OPC:
oligodendrocyte progenitor cell; GRP: glial restricted precursor; O-2A: oligodendrocyte-type2-astrocyte; APC: astrocyte precursor cell; bHLH: basic-helix-loop-helix; HMG: high
mobility group; SVZ: subventricular zone; PA: pilocytic astrocytoma; GBM: glioblastoma
multiforme.
Key words: Human gliomas, Oligodendrogliomas, Glioblastoma multiforme, Pilocytic
astrocytomas, Gliomagenesis, Olig2, Sox10, Nkx2.2, plp/dm20, Nestin, Vimentin, GFAP
1
Abstract
In order to define specific markers for histogenesis of three well characterized subgroups of
human gliomas (pilocytic astrocytomas, glioblastoma multiforme and oligodendrogliomas),
we studied the expression of relevant markers that characterize gliomagenesis, by
immunohistochemistry and in situ hybridization. They include the intermediate filament
proteins GFAP, vimentin and nestin, the transcription factors Olig2, Nkx2.2 and Sox10, and
the proteolipid protein transcripts plp/dm20. We show that the three major categories of
human gliomas express a combinatorial profile of markers that gives new insights to their
histogenesis and may help diagnosis. Pilocytic astrocytomas strongly express GFAP, vimentin,
Olig2, Nkx2.2 and Sox10 but not nestin. In contrast, glioblastomas strongly express GFAP,
vimentin and nestin but these tumors are heterogeneous regarding the expression of the
transcription factors studied. Finally, in oligodendrogliomas, intermediate filament proteins
are generally not observed whereas Olig2 was found in almost all tumor cells nuclei while
only a subpopulation of tumor cells expressed Nkx2.2 and Sox10.
2
Introduction
The World Health Organization (WHO) classification, revised in 2000, remains the standard
to classify human brain gliomas is still based on morphological similarities between tumor
cells and non neoplastic cells although some molecular profiles have been associated with
specific histologic and prognostic subgroups, contributing to improving the classification of
gliomas [1]. However, the cell-of-origin of the majority of human gliomas is largely unknown
and two main hypotheses are still a matter of debate. First, gliomas may represent the
dedifferentiated state of a terminally differentiated cell and studies from genetically
manipulated mice and cell culture models have shown that some pathway alterations can
promote the formation of gliomas with a dedifferentiated phenotype from fully differentiated
glial cells [2]. Second, gliomas may derive from a progenitor-like-cell after genetic
transformations and therefore retain progenitor characteristics [for review, see 3; 4, 5]. In
keeping with the last hypothesis, recent studies have reported evidences for cancer stem cells
in glioblastomas [6, 7]. Other studies have reported the expression of antigenic epitopes that
characterize oligodendrocyte progenitor cells (OPCs) such as PDGFRα, NG2 or PEN5 in
some gliomas, including oligodendrogliomas and pilocytic astrocytomas, suggesting that
these tumors might derive from OPCs [8, 9].
OPCs or oligodendrocyte-type-2-astrocyte (O-2A) progenitors, astrocyte precursor cells
(APCs), and glial restricted precursors (GRPs) are different types of glial precursor cells [for
review see 10]. These cells are characterized by the expression of a set of intermediate
filament proteins and cell surface markers including the A2B5 ganglioside [10, 11]. Besides,
it has been reported that during vertebrate CNS development, selective expression of a critical
combination of transcription factors creates a code that allows the specification of neural
progenitor cells into specialized neuronal or glial progeny [reviewed in 12]. Two structurally
3
distinct types of transcription factors are the principal components of this code in the spinal
cord: Nkx2.2, which belongs to the homeodomain transcription factor class [13], and olig
genes, which contain a basic-helix-loop-helix (bHLH) domain [14, 15]. In the chick ventral
neural tube, coexpression of Olig2 with Nkx2.2 inhibits V3 interneuron development and
generates cells expressing Sox10, a marker of oligodendroglial precursors [16]. In
oligodendrocytes, myelin basic protein (MBP) and proteolipid protein (PLP) are under the
direct transcriptional control of Sox10, which therefore plays a critical role in the terminal
differentiation of oligodendroglia [17]. Olig2 expression has been reported in a large variety
of human gliomas including pilocytic astrocytomas [18-22]. More recently, Nkx2.2 and
Sox10 expression was shown to be ubiquitous in human gliomas [23, 24]. To further
characterize the histogenesis of three subclasses of gliomas (oligodendrogliomas,
glioblastomas and pilocytic astrocytomas), we have studied by immunohistochemistry and in
situ hybridization the expression of relevant markers that characterize gliomagenesis,
including the intermediate filament proteins nestin, vimentin, glial fibrillary acidic protein
(GFAP), the transcription factors involved in oligodendrogenesis Olig2, Nkx2.2, and Sox10,
and the proteolipid protein transcripts (plp/dm20). We show that each type of glioma
expresses a characteristic combination of these markers, which gives new insights into their
histogenesis and may help to better classify them.
Materials and methods
Patients and human tissues
The present study was undertaken after informed consent from each patient or their relatives.
Brain tumor samples were classified according to WHO CNS tumor classification [1] and
4
their main clinical features are reported in Table 1. They included 8 pilocytic astrocytomas
(PAs, grade I), 8 glioblastomas (GBs, grade IV), 4 grade II oligodendrogliomas, and 4 grade
III anaplastic oligodendrogliomas. Oligodendrogliomas were analyzed by FISH as previously
described [25], and all exhibited combined loss of 1p19q. Moreover, according to Zlatescu
and colleagues [26], 6 out of 8 cases located preferentially in frontal and parietal lobes.
Control samples included autopsic brain tissues obtained from 3 fetuses (18, 20 and 21 weeks
of gestation), as well as 6 adult cerebral cortices resected for intractable epilepsy. Autopsic
brain tissues were obtained less than 12 hours after death and neuropathological examination
was normal in these cases. Samples were fixed in 10% formalin for routine histology and
immunohistochemistry and fixed in 4% paraformaldehyde overnight, cryoprotected in 20%
sucrose, then frozen in melting isopentane and stored at - 80°C for in situ hybridization
analysis.
In addition, we used 57 formalin-fixed paraffin-embedded GBs samples. An Alphelys manual
tissue-arrayer (MTA-1) was used to generate tissue-microarrays (TMA) from these last
samples. A minimum of three cores (diameter = 0.6 mm) were included for each case.
According to the WHO classification [1], all GBs (n = 65) included in this study showed
typical features of glioblastoma multiforme (GBMs): some areas showed giant cells, other
were highly cellular and often monotonous. They were all primary glioblastomas. Giant cell
GBs as described by the WHO classification, small cell GBs, GBs with an oligodendroglial
component (GBMO) [27] and secondary GBs were excluded from this study.
In situ hybridization
plp/dm20 and sox10 expression was investigated by nonradioactive in situ hybridization as
previously described [28]. Ten micrometer cryostat sections were hybridized with 500 ng/mL
digoxigenin-labeled antisense riboprobes for plp/dm-20 [29] and sox10 [30]. The cRNA
probes were detected with an alkaline-phosphatase-conjugated antibody against digoxigenin
5
(Roche) and visualized by incubation for 15 to 20 hours in NBT-BCIP (4-nitro blue
tetrazolium chloride / 5-bromo, 4-chloro, 3-indolyl phosphate; Promega, France). To improve
final colour development, 10% polyvinyl alcohol was added to the development solution.
Slides were mounted with Mowiol.
Immunohistochemistry
For all gliomas (Table 1) and control samples, 5 µm sections of formalin-fixed paraffinembedded tissue were analyzed for the presence of Olig2, Nkx2.2, Sox10, GFAP, vimentin
and nestin. The three transcription factors, Olig2, Nkx2.2 and Sox10, were also studied in the
57 GBMs included in TMA. The following antibodies were used: a monoclonal antibody
against the bHLH-oligodendrocyte-transcription-factor 2 (Olig2, 257224 clone, 1:200, R&D
systems, France), a monoclonal antibody against the homeodomain-transcription-factor
Nkx2.2 (1:800, Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA,
USA), a monoclonal antibody against the HMG-transcription-factor Sox10 (1:25, gift from Dr
D. Anderson, California, USA), a polyclonal antibody against the Glial Fibrillary Acidic
Protein (1:2000, Dako, France), a monoclonal antibody against vimentin (V9 clone, 1:150,
Dako, France) and a polyclonal anti-nestin antibody (clone #130, 1:20 dilution, [31]). Before
incubation with the primary antibodies against Olig2, Nkx2.2 and Sox10, the tissue sections
were permeabilized with phosphate-buffered saline (PBS) / 0.35M HCl / 0.5% Triton for 30
min at 37°C. Then the acid solution was neutralized with a 0.1M sodium tetraborate solution
(pH 8.5). An avidin-biotin enzyme complex kit (Elite, Vectastain) was used for the final
detection of these antibodies. GFAP, vimentin and nestin detection was done using a Ventana
automate (Nexes, Ventana Medical Systems S.A, Illkirch, France). In all cases, steam-heatinduced antigen retrieval was performed.
6
Staining quantification
In situ hybridization and immunostaining were independently scored by two pathologists
(DFB and CF) with respect to the overall percentage of labeled cells, as follows: 0 = no
positive cell; 1 = 1% to 10 % of positive cells; 2 = 11% to 25%; 3 = 26% to 50%; 4 = 51% to
90% and 5 = 91% to 100%.
7
Results
Expression of intermediate filament in gliomas and controls (Table 1 and Figure 1)
All PAs strongly expressed GFAP in 26% to 50% of cells (score 3). GFAP labeling was more
intense in fibrillary areas than in pseudo-oligodendroglial ones (Figure 1A). Except in one
case of PA located in the cerebellum and showing pseudo-oligodendroglial features only
(PA3), vimentin was observed in all cases (in 11% to 50% of tumor cells and in blood vessels)
(Figure 1B). Nestin expression was weak in PAs, observed in less than 10% of tumor cells
(Figure 1C).
All GBMs strongly expressed GFAP, vimentin and nestin in at least 50% of tumor cells
(Figure 1D, E, F).
In 7 out of 8 oligodendrogliomas (3 grade II and 4 grade III), GFAP expression was observed
in less than 10% of tumor cells and in reactive astrocytes (Figure 1G). Vimentin was not
observed (Figure 1H) and nestin expression in tumor cells was mostly absent or observed in
less than 10% of the cells (Figure 1I) and. Two cases were different: one grade III
oligodendroglioma strongly expressed nestin and vimentin but not GFAP in more than 50%
of tumor cells (case O6) and one grade II oligodendroglioma expressed GFAP in 26 to 50% of
tumor cells (minigemistocytes) but lacked vimentin and nestin expression (case O4).
In the adult cortices resected for intractable epilepsy, GFAP and vimentin were detected in
astrocytes (normal and reactive) whereas nestin expression was restricted to endothelial cells
(data not shown). In fetuses, nestin expression was observed in the subventricular zone
whereas vimentin and to a lesser extent GFAP labeled radial glia (data not shown).
It was worth noticing that, in all gliomas and controls, endothelial cells expressed nestin.
8
Immunohistochemical detection of Olig2, Nkx2.2 and Sox10 in gliomas and
controls (Table 1 and Figure 2)
Almost all PAs expressed Olig2, Nkx2.2 and Sox10 in 26% to 50% of tumor cell nuclei.
Labeling was more intense and/or restricted to pseudo-oligodendroglial areas (Figure 2A, B,
C).
GBMs (n = 8) were heterogeneous regarding the expression of the studied transcription
factors, with no relationship with the cellular composition nor regional heterogeneity. Three
patterns were observed, and were substantially confirmed in the 57 TMA-included samples: 1)
expression of all transcription factors in the same number of tumor cell nuclei ranging from
26% to 50% (3 cases: GBM4, GBM5, GBM6, and 13/57 TMA cases); 2) lack of expression
of all the studied transcription factors (2 cases: GBM7 and GBM8 plus 12/57 TMA cases);
and 3) dissociated expression of the transcription factors with a predominant expression of
Sox10 (3 cases: GBM1, GBM2, GBM3, and 32/57 TMA cases) (Figure 2E, F, G). In ten
cases, Olig2 expression was observed in both nuclei and cytoplasm (data not shown). It is
worth noticing that none of this pattern of expression was related to tumor location.
All oligodendrogliomas strongly expressed Olig2 in almost all tumor cell nuclei whereas only
a subpopulation of tumor cell nuclei expressed Nkx2.2 and Sox10 (Figure 2I, J, K). In one
grade II oligodendroglioma, however, all tumor cell nuclei expressed the three transcription
factors (O8).
In control samples, Olig2, Nkx2.2 and Sox10 immunolabelings were mainly observed in adult
cortices and restricted to oligodendrocyte nuclei (data not shown).
sox10 and plp/dm20 expression studied by in situ hybridization in gliomas and
controls (Table 1 and Figure 2)
9
sox10 mRNA expression revealed by in situ hybridization was closely correlated to Sox10
protein expression. Almost all PAs and GBMs expressed sox10 mRNA in at least 25% of
tumor cells (scores 2 to 4) (data not shown). Surprisingly, one PA (PA4) and two GBMs
(GBM7 and GBM8) showed only 10% or less of labeled tumor cells. These three samples
showed also low Sox10 protein expression. In oligodendrogliomas, sox10 labeling was always
observed in only few tumor cells (score 1) (data not shown).
plp/dm20 mRNA expression was globally weak in all glioma subtypes studied (score 1), even
absent in most GBMs (Figure 2H). However, 2 PAs (Figure 2D and Table 1, cases PA4 and
PA6) and one oligodendroglioma (Figure 2L and Table 1, case O7) strongly expressed it
(scores 3 and 4).
In control samples, sox10 and plp/dm20 mRNA expression levels were rather heterogeneous
but they were on average higher in adult cortices than in fetus brain samples (data not shown).
10
Discussion
In this study, we have analyzed in a same series of human gliomas the expression of a large
number of factors involved in gliomagenesis including some intermediate filaments,
transcription factors that play a role in neural progenitor specification and differentiation as
well as of the proteolipid protein transcripts plp/dm20. Because gliomas and especially mixed
gliomas are subject to considerable interobserver misinterpretation [32], we have focused our
study on three well characterized subgroups of gliomas: pilocytic astrocytomas (PAs),
glioblastoma multiforme (GBMs) and 1p19q loss oligodendrogliomas.
We found that the two astrocytic markers vimentin and GFAP were expressed in all PAs and
GBMs whereas oligodendrogliomas, that did not contain minigemistocytic nor gliofibrillary
oligodendrocytes, did not express them, according to previous reports [1, 33]. With the
immunohistochemical procedure that we used, strong nestin expression was mainly restricted
to GBMs. This is in keeping with earlier reports which showed that among gliomas, GBMs
express the highest level of nestin [31, 34, 35].
In agreement with previous reports, we observed that all types of gliomas express Olig2 [18,
20, 22]. However, the patterns of expression vary from one glioma to the next. PAs always
express Olig2 in half of tumor cells. In GBMs, it can be absent, expressed in few cells or
diffusely and, in some cases, encountered in the cytoplasm of tumor cells. Finally, Olig2
expression is recorded in all oligodendroglioma tumor nuclei. These findings might be of
diagnostic value. Moreover, these results are in agreement with data concerning expression of
Olig2 during glial lineage maturation. Indeed, Olig genes are essential regulators of ventral
neuroectodermal progenitor cell fate and oligodendrocyte development in the murine and
11
avian CNS [36-38]. However, recent studies have shown that Olig2 is also specifically
expressed in gliogenic progenitors in the postnatal subventricular zone (SVZ) and by all glial
cells derived from this structure [39]. Nonetheless, in contrast to oligodendrocytes, which
consistently express Olig2 from early developmental to adult stages, its expression is downregulated in mature astrocytes. Moreover, the translocation of Olig2 from the nucleus to
cytoplasm – a feature encountered in GBMs is essential for astrocyte differentiation [40].
In keeping with earlier reports [23, 24], we observed that the different subtypes of gliomas we
studied expressed Nkx2.2 and/or Sox10. This expression is different depending on the glioma
subtype. In both oligodendrogliomas and PAs, a subgroup of tumor cells expressing Olig2
also expressed Nkx2.2 and Sox10, similar to oligodendrocyte lineage cells. This was not
obvious in GBMs : some strongly expressed Sox10 but not Olig2. As reported previously,
plp/dm20-expressing cells were observed in both PAs and oligodendrogliomas but in very few
GBMs [41, 42]. During development, Olig2 alone is not sufficient to generate
oligodendrocyte specification and in the rodent spinal cord, forced expression of either Olig1
or Olig2 failed to generate oligodendrocyte precursor cells (OPCs) [reviewed in 37]. Olig2
must form a complex with Nkx2.2 to generate Sox10-positive OPCs and give rise to
differentiated oligodendrocytes. Then, Sox10 controls the expression of several myelin genes
including those encoding the myelin basic protein (MBP) and PLP [reviewed in 43] after the
cells have exited the cell cycle. The same might occur in both PAs and oligodendrogliomas.
In contrast, Sox10 expression in GBMs does not follow the same regulation.
This study corroborates our recent work [5] showing that human gliomas contain a mixture of
glial progenitor cells and more differentiated cells in specific combinations. This might point
to some extent the cell of origin of each glioma subtype. Both the tumor location and cell
composition of PAs emphasized by this study suggest that these tumors may derive from an
oligodendrocyte precursor cell, likely a perinatal OPC (or O-2A progenitor) [10]. In
12
agreement with that hypothesis, OPCs were initially isolated from the postnatal rat optic nerve
and subsequently from the postnatal cerebellum, cortex, brain stem and spinal cord
(localizations which are specific of PAs). Moreover, the OPCs observed in PAs expressing the
ganglioside A2B5 still respond to environmental cues and are able to differentiate towards the
oligodendrocyte lineage [5].
In contrast, most oligodendrogliomas are made of genetically transformed (1p19q loss) glial
progenitors that all express Olig2. The genetic transformation favors proliferation and only a
fraction of tumor cells that exit the cell cycle is able to differentiate and express Nkx2.2
together with Sox10.
Finally, previous reports have suggested that GBMs contain cancer neural stem cells [6, 7] or
transformed glial restricted precursor (GRP) cells (Colin et al., 2006). Whether the initial
transforming event occurs within the neural stem cells, which therefore gives rise to a
transformed progeny or rather affect more mature cells which can de-differentiate into a more
progenitor-like state remains unknown at present [44]. In this last hypothesis, genetic
alterations may induce unstable differentiation states of brain tumor cells, at various stages of
the lineage, in such a way that it may be impossible to characterize tumor cells. The
heterogeneous cell composition of GBMs, their strong nestin and GFAP expression, the
diffuse Sox10 expression in some cells as well as the anarchic expression of transcription
factors involved in oligodendrogenesis are in keeping with this hypothesis.
As a conclusion, the pattern of expression of intermediate filaments and transcription factors
gives some insights into glioma histogenesis and may be to some extent of diagnostic
relevance although it further emphasizes the major heterogeneity of glioblastoma cells.
Nevertheless, we were not able to correlate these expression patterns with tumor location.
From a practical point of view, we would favour to use for diagnosis the restricted
combination of Olig2, Sox10, nestin and GFAP markers which are the most discriminant.
13
Further studies however are required to assess the putative prognostic value of these markers
in oligodendrogliomas and GBMs.
14
Acknowledgments
This work was funded by the ARC, by the GEFLUC to DFB, by the INCA (“Cancéropôle
PACA” and grants n° R019) and by institutional grants from EA 3281. I.V. was supported by
a fellowship from the Fondation Recherche Médicale (FRM).
We are grateful to the neurosurgeons Profs. H. Dufour, F. Grisoli, J.C. Peragut, Drs G. Lena,
D. Scavarda, P. Metellus, B. Fuentes, and P. Roche for providing tumor samples, to Dr O.
Chinot and C Boucard for providing clinical informations regarding the patients and to E.
Cassotte, C. Cazeaux and P. Morando for technical assistance.
15
References
1
Kleihues, P., Cavanee, W. K. World Health Organization classification of tumors of
the nervous system 2000. Lyon: IARC/WHO
2
Dai, C., Celestino, J. C., Okada, Y., Louis, D. N., Fuller, G. N. and Holland, E. C.
PDGF autocrine stimulation dedifferentiates cultured astrocytes and induces
oligodendrogliomas and oligoastrocytomas from neural progenitors and astrocytes in
vivo. Genes Dev 2001; 15: 1913-25
3
Shih, A. H. and Holland, E. C. Developmental neurobiology and the origin of brain
tumors. J Neurooncol 2004; 70: 125-36
4
Sanai, N., Alvarez-Buylla, A. and Berger, M. S. Neural stem cells and the origin of
gliomas. N Engl J Med 2005; 353: 811-22
5
Colin, C., Baeza, N., Tong, S., Bouvier, C., Quilichini, B., Durbec, P. and FigarellaBranger, D. In vitro identification and functional characterization of glial precursor
cells in human gliomas. Neuropathol Appl Neurobiol 2006; 32: 189-202
6
Galli, R., Binda, E., Orfanelli, U., Cipelletti, B., Gritti, A., De Vitis, S., Fiocco, R.,
Foroni, C., Dimeco, F. and Vescovi, A. Isolation and characterization of tumorigenic,
stem-like neural precursors from human glioblastoma. Cancer Res 2004; 64: 7011-21
7
Singh, S. K., Hawkins, C., Clarke, I. D., Squire, J. A., Bayani, J., Hide, T., Henkelman,
R. M., Cusimano, M. D. and Dirks, P. B. Identification of human brain tumour
initiating cells. Nature 2004; 432: 396-401
8
Figarella-Branger, D., Daniel, L., Andre, P., Guia, S., Renaud, W., Monti, G., Vivier,
E. and Rougon, G. The PEN5 epitope identifies an oligodendrocyte precursor cell
population and pilocytic astrocytomas. Am J Pathol 1999; 155: 1261-9
16
9
Shoshan, Y., Nishiyama, A., Chang, A., Mork, S., Barnett, G. H., Cowell, J. K., Trapp,
B. D. and Staugaitis, S. M. Expression of oligodendrocyte progenitor cell antigens by
gliomas: implications for the histogenesis of brain tumors. Proc Natl Acad Sci U S A
1999; 96: 10361-6
10
Lee, J. C., Mayer-Proschel, M. and Rao, M. S. Gliogenesis in the central nervous
system. Glia 2000; 30: 105-21
11
Noble, M., Proschel, C. and Mayer-Proschel, M. Getting a GR(i)P on oligodendrocyte
development. Dev Biol 2004; 265: 33-52
12
Jessell, T. M. Neuronal specification in the spinal cord: inductive signals and
transcriptional codes. Nat Rev Genet 2000; 1: 20-9
13
Qi, Y., Cai, J., Wu, Y., Wu, R., Lee, J., Fu, H., Rao, M., Sussel, L., Rubenstein, J. and
Qiu, M. Control of oligodendrocyte differentiation by the Nkx2.2 homeodomain
transcription factor. Development 2001; 128: 2723-33
14
Lu, Q. R., Yuk, D., Alberta, J. A., Zhu, Z., Pawlitzky, I., Chan, J., McMahon, A. P.,
Stiles, C. D. and Rowitch, D. H. Sonic hedgehog--regulated oligodendrocyte lineage
genes encoding bHLH proteins in the mammalian central nervous system. Neuron
2000; 25: 317-29
15
Zhou, Q., Wang, S. and Anderson, D. J. Identification of a novel family of
oligodendrocyte lineage-specific basic helix-loop-helix transcription factors. Neuron
2000; 25: 331-43
16
Sun, T., Echelard, Y., Lu, R., Yuk, D. I., Kaing, S., Stiles, C. D. and Rowitch, D. H.
Olig bHLH proteins interact with homeodomain proteins to regulate cell fate
acquisition in progenitors of the ventral neural tube. Curr Biol 2001; 11: 1413-20
17
Stolt, C. C., Rehberg, S., Ader, M., Lommes, P., Riethmacher, D., Schachner, M.,
Bartsch,
U.
and
Wegner,
M.
Terminal
17
differentiation
of
myelin-forming
oligodendrocytes depends on the transcription factor Sox10. Genes Dev 2002; 16: 16570
18
Bouvier, C., Bartoli, C., Aguirre-Cruz, L., Virard, I., Colin, C., Fernandez, C.,
Gouvernet, J. and Figarella-Branger, D. Shared oligodendrocyte lineage gene
expression in gliomas and oligodendrocyte progenitor cells. J Neurosurg 2003; 99:
344-50
19
Lu, Q. R., Park, J. K., Noll, E., Chan, J. A., Alberta, J., Yuk, D., Alzamora, M. G.,
Louis, D. N., Stiles, C. D., Rowitch, D. H. and Black, P. M. Oligodendrocyte lineage
genes (OLIG) as molecular markers for human glial brain tumors. Proc Natl Acad Sci
U S A 2001; 98: 10851-6
20
Ligon, K. L., Alberta, J. A., Kho, A. T., Weiss, J., Kwaan, M. R., Nutt, C. L., Louis, D.
N., Stiles, C. D. and Rowitch, D. H. The oligodendroglial lineage marker OLIG2 is
universally expressed in diffuse gliomas. J Neuropathol Exp Neurol 2004; 63: 499-509.
21
Marie, Y., Sanson, M., Mokhtari, K., Leuraud, P., Kujas, M., Delattre, J. Y., Poirier, J.,
Zalc, B. and Hoang-Xuan, K. OLIG2 as a specific marker of oligodendroglial tumour
cells. Lancet 2001; 358: 298-300
22
Ohnishi, A., Sawa, H., Tsuda, M., Sawamura, Y., Itoh, T., Iwasaki, Y. and Nagashima,
K. Expression of the oligodendroglial lineage-associated markers Olig1 and Olig2 in
different types of human gliomas. J Neuropathol Exp Neurol 2003; 62: 1052-9
23
Bannykh, S. I., Stolt, C. C., Kim, J., Perry, A. and Wegner, M. Oligodendroglialspecific Transcriptional Factor SOX10 is Ubiquitously Expressed in Human Gliomas.
J Neurooncol 2006; 76: 115-127
24
Riemenschneider, M. J., Koy, T. H. and Reifenberger, G. Expression of
oligodendrocyte lineage genes in oligodendroglial and astrocytic gliomas. Acta
Neuropathol (Berl) 2004; 107: 277-82
18
25
Bouvier, C., Roll, P., Quilichini, B., Metellus, P., Calisti, A., Gilles, S., Chinot, O.,
Fina, F., Martin, P. M. and Figarella-Branger, D. Deletions of chromosomes 1p and
19q are detectable on frozen smears of gliomas by FISH: usefulness for stereotactic
biopsies. J Neurooncol 2004; 68: 141-9
26
Zlatescu, M. C., TehraniYazdi, A., Sasaki, H., Megyesi, J. F., Betensky, R. A., Louis,
D. N. and Cairncross, J. G. Tumor location and growth pattern correlate with genetic
signature in oligodendroglial neoplasms. Cancer Res 2001; 61: 6713-5
27
He, J., Mokhtari, K., Sanson, M., Marie, Y., Kujas, M., Huguet, S., Leuraud, P.,
Capelle, L., Delattre, J. Y., Poirier, J. and Hoang-Xuan, K. Glioblastomas with an
oligodendroglial component: a pathological and molecular study. J Neuropathol Exp
Neurol 2001; 60: 863-71
28
Tiveron, M. C., Hirsch, M. R. and Brunet, J. F. The expression pattern of the
transcription factor Phox2 delineates synaptic pathways of the autonomic nervous
system. J Neurosci 1996; 16: 7649-60
29
Peyron, F., Timsit, S., Thomas, J. L., Kagawa, T., Ikenaka, K. and Zalc, B. In situ
expression of PLP/DM-20, MBP, and CNP during embryonic and postnatal
development of the jimpy mutant and of transgenic mice overexpressing PLP. J
Neurosci Res 1997; 50: 190-201
30
Kuhlbrodt, K., Herbarth, B., Sock, E., Hermans-Borgmeyer, I. and Wegner, M. Sox10,
a novel transcriptional modulator in glial cells. J Neurosci 1998; 18: 237-50
31
Tohyama, T., Lee, V. M., Rorke, L. B., Marvin, M., McKay, R. D. and Trojanowski, J.
Q. Nestin expression in embryonic human neuroepithelium and in human
neuroepithelial tumor cells. Lab Invest 1992; 66: 303-13
19
32
Coons, S. W., Johnson, P. C., Scheithauer, B. W., Yates, A. J. and Pearl, D. K.
Improving diagnostic accuracy and interobserver concordance in the classification and
grading of primary gliomas. Cancer 1997; 79: 1381-93
33
Herpers, M. J. and Budka, H. Glial fibrillary acidic protein (GFAP) in oligodendroglial
tumors: gliofibrillary oligodendroglioma and transitional oligoastrocytoma as subtypes
of oligodendroglioma. Acta Neuropathol (Berl) 1984; 64: 265-72
34
Almqvist, P. M., Mah, R., Lendahl, U., Jacobsson, B. and Hendson, G.
Immunohistochemical detection of nestin in pediatric brain tumors. J Histochem
Cytochem. J Histochem Cytochem 2002; 50: 147-58
35
Dahlstrand, J., Collins, V. P. and Lendahl, U. Expression of the class VI intermediate
filament nestin in human central nervous system tumors. Cancer Res 1992; 52: 533441
36
Lu, Q. R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C. D. and Rowitch, D. H.
Common developmental requirement for Olig function indicates a motor
neuron/oligodendrocyte connection. Cell 2002; 109: 75-86
37
Rowitch, D. H., Lu, Q. R., Kessaris, N. and Richardson, W. D. An 'oligarchy' rules
neural development. Trends Neurosci 2002; 25: 417-22
38
Zhou, Q. and Anderson, D. J. The bHLH transcription factors OLIG2 and OLIG1
couple neuronal and glial subtype specification. Cell 2002; 109: 61-73
39
Marshall, C. A., Novitch, B. G. and Goldman, J. E. Olig2 directs astrocyte and
oligodendrocyte formation in postnatal subventricular zone cells. J Neurosci 2005; 25:
7289-98
40
Setoguchi, T. and Kondo, T. Nuclear export of OLIG2 in neural stem cells is essential
for ciliary neurotrophic factor-induced astrocyte differentiation. J Cell Biol 2004; 166:
963-8
20
41
Popko, B., Pearl, D. K., Walker, D. M., Comas, T. C., Baerwald, K. D., Burger, P. C.,
Scheithauer, B. W. and Yates, A. J. Molecular markers that identify human
astrocytomas and oligodendrogliomas. J Neuropathol Exp Neurol 2002; 61: 329-38
42
Wong, K. K., Chang, Y. M., Tsang, Y. T., Perlaky, L., Su, J., Adesina, A., Armstrong,
D. L., Bhattacharjee, M., Dauser, R., Blaney, S. M., Chintagumpala, M. and Lau, C. C.
Expression analysis of juvenile pilocytic astrocytomas by oligonucleotide microarray
reveals two potential subgroups. Cancer Res 2005; 65: 76-84
43
Wegner, M. and Stolt, C. C. From stem cells to neurons and glia: a Soxist's view of
neural development. Trends Neurosci 2005; 28: 583-8
44
Fomchenko, E. I. and Holland, E. C. Stem cells and brain cancer. Exp Cell Res 2005;
306: 323-9
21
Figure legends
Figure 1. Immunohistochemical detection of intermediate filaments GFAP, vimentin and
nestin in gliomas. Pilocytic astrocytomas strongly express GFAP (A), and vimentin (B) but
nestin expression is not detectable (C). Glioblastomas strongly express GFAP (D), vimentin
(E) and nestin (F). In oligodendroglioma samples, GFAP labels reactive astrocytes and few
tumor cells (G), vimentin is not observed (H) and nestin expression is mostly absent except in
endothelial cells (I). A to E and G to I: 100X; F: 50X.
Figure 2. Immunohistochemical detection of Olig2, Nkx2.2 and Sox10 and plp/dm20
expression studied by in situ hybridization in gliomas. Pilocytic astrocytomas express Olig2
(A), Nkx2.2 (B) and Sox10 (C) in 26% to 50% of tumor cell and the proportion of plp/dm20
labeled tumor cells can reach 70% in some PAs (D). Glioblastomas are heterogeneous and can
show a dissociated expression of Olig2 (E) and Nkx2.2 (F) with a predominant expression of
Sox10 (G) but plp/dm20 mRNA expression is absent (H). Oligodendrogliomas strongly
express Olig2 in almost all tumor cells (I) whereas only a subpopulation of tumor cell nuclei
expresses Nkx2.2 (J), Sox10 (K) and plp/dm20 (L). A-C, E-G, I-K: 200X; D,H,L: 100X.
Table 1. Glioma clinical data, in situ hybridization (HIS) and immunhistochemistry (IHC)
results. Brain tumor samples were classified according to WHO CNS tumor classification:
pilocytic astrocytomas (PA1 to PA8), glioblastomas (GBM1 to GBM8), grade II
oligodendrogliomas (O1 to O4) and grade III anaplastic oligodendrogliomas (O5 to O8).
Topography of the tumor and age of the patient are reported. HIS (for sox10 and plp/dm20)
and IHC (for Sox10, Nkx2.2, Olig2, GFAP, nestin and vimentin) were scored with respect to
the overall percentage of labeled cells, as follows: 0 = no positive cell; 1 = 1% to 10 % of
22
positive cells; 2 = 11% to 25%; 3 = 26% to 50%; 4 = 51% to 90% and 5 = 91% to 100%. NI:
not informative for technical reasons.
23
In situ
hybridization
Tumoral subtype
Topography
and grade (WHO)
Pilocytic astrocytomas (n = 8)
Exophytic brainstem
PA 1 (I)
Third ventricule
PA 2 (I)
Cerebellum
PA 3 (I)
Cerebellum
PA 4 (I)
Optic chiasm
PA 5 (I)
Third ventricule
PA 6 (I)
Optical nerve
PA 7 (I)
Cerebral hemisphere
PA 8 (I)
Glioblastomas (n = 8)
Fronto-temporal
GBM 1 (IV)
Temporal
GBM 2 (IV)
Parietal
GBM 3 (IV)
Frontal
GBM 4 (IV)
Frontal
GBM 5 (IV)
Frontal
GBM 6 (IV)
Corpus callosum
GBM 7 (IV)
Frontal
GBM 8 (IV)
Oligodendrogliomas (n = 8)
Fronto-temporal
O 1 (II)
Parietal
O 2 (II)
Frontal
O 3 (II)
Frontal
O 4 (II)
Temporal
O 5 (III)
Frontal
O 6 (III)
Frontal
O 7 (III)
Invasive diffuse glioma
O 8 (III)
Immunohistochemistry
Age
(years)
sox10
plp/dm20
Sox10
Nkx2.2
Olig2
GFAP
Nestin
Vimentin
4
12
12
7
8
3
2
4
2
3
2
1
2
4
3
3
1
1
1
3
0
4
1
1
3
3
3
1
3
3
4
3
3
3
1
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
3
1
1
0
0
0
1
1
0
3
2
0
2
2
2
3
3
63
71
49
79
74
55
57
74
2
3
3
3
NI
2
0
1
0
0
1
1
0
0
0
0
5
2
5
4
3
3
0
0
2
0
1
4
3
3
0
0
1
1
5
4
3
3
0
0
4
4
4
3
3
4
4
4
4
4
4
4
3
3
4
4
4
4
4
4
3
4
4
4
34
53
55
62
39
41
51
72
1
1
1
1
1
1
1
NI
1
1
1
1
1
0
3
1
2
2
2
2
1
2
2
5
2
2
1
3
0
2
3
5
2
5
5
3
5
5
5
5
1
1
3
1
1
1
1
1
1
0
0
1
0
4
0
0
0
0
0
0
0
4
0
0
BIBLIOGRAPHIE
Abbott NJ. 2002. Astrocyte-endothelial interactions and blood-brain barrier permeability. J
Anat 200(6):629-638.
Aguirre A, Gallo V. 2004. Postnatal Neurogenesis and Gliogenesis in the Olfactory Bulb from
NG2-Expressing Progenitors of the Subventricular Zone. J Neurosci 24(46):1053010541.
Aguirre AA, Chittajallu R, Belachew S, Gallo V. 2004. NG2-expressing cells in the
subventricular zone are type C-like cells and contribute to interneuron generation in
the postnatal hippocampus. J Cell Biol 165(4):575-589.
Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. 2002. Molecular Biology of the
Cell: Garland Science.
Almqvist PM, Mah R, Lendahl U, Jacobsson B, Hendson G. 2002. Immunohistochemical
detection of nestin in pediatric brain tumors. J Histochem Cytochem 50(2):147-158.
Alonso G. 2005. NG2 proteoglycan-expressing cells of the adult rat brain: possible
involvement in the formation of glial scar astrocytes following stab wound. Glia
49(3):318-338.
Altman J. 1969. Autoradiographic and histological studies of postnatal neurogenesis. IV. Cell
proliferation and migration in the anterior forebrain, with special reference to
persisting neurogenesis in the olfactory bulb. J Comp Neurol 137(4):433-457.
Altman J, Das GD. 1965a. Autoradiographic and histological evidence of postnatal
hippocampal neurogenesis in rats. J Comp Neurol 124(3):319-335.
Altman J, Das GD. 1965b. Post-natal origin of microneurones in the rat brain. Nature
207:953-956.
Altmann CR, Brivanlou AH. 2001. Neural patterning in the vertebrate embryo. Int Rev Cytol
203:447-482.
Alvarez-Buylla A, Garcia-Verdugo JM. 2002. Neurogenesis in adult subventricular zone. J
Neurosci 22(3):629-634.
Alvarez-Buylla A, Garcia-Verdugo JM, Tramontin AD. 2001. A unified hypothesis on the
lineage of neural stem cells. Nat Rev Neurosci 2(4):287-293.
Alvarez-Buylla A, Lim DA. 2004. For the long run: maintaining germinal niches in the adult
brain. Neuron 41(5):683-686.
Andersson C, Tytell M, Brunso-Bechtold J. 1993. Transplantation of cultured type 1 astrocyte
cell suspensions into young, adult and aged rat cortex: cell migration and survival. Int
J Dev Neurosci 11(5):555-568.
Araque A, Parpura V, Sanzgiri RP, Haydon PG. 1999. Tripartite synapses: glia, the
unacknowledged partner. Trends Neurosci 22(5):208-215.
96
Araque A, Perea G. 2004. Glial modulation of synaptic transmission in culture. Glia
47(3):241-248.
Armstrong RC, Harvath L, Dubois-Dalcq ME. 1990. Type 1 astrocytes and oligodendrocytetype 2 astrocyte glial progenitors migrate toward distinct molecules. J Neurosci Res
27(3):400-407.
Arvidsson A, Collin T, Kirik D, Kokaia Z, Lindvall O. 2002. Neuronal replacement from
endogenous precursors in the adult brain after stroke. Nat Med 8(9):963-970.
Ayer-Le Lievre C, Lapointe F, Leibovici M. 1995. Avian olfactory neurogenesis. Biol
Cell(84):25-34.
Azizi SA, Stokes D, Augelli BJ, DiGirolamo C, Prockop DJ. 1998. Engraftment and
migration of human bone marrow stromal cells implanted in the brains of albino rats-similarities to astrocyte grafts. Proc Natl Acad Sci U S A 95(7):3908-3913.
Bacchi CE, Gown AM. 1993. Detection of cell proliferation in tissue sections. Braz J Med
Biol Res 26(7):677-687.
Bannykh SI, Stolt CC, Kim J, Perry A, Wegner M. 2006. Oligodendroglial-specific
transcriptional factor SOX10 is ubiquitously expressed in human gliomas. J
Neurooncol 76(2):115-127.
Barnard RO, Triggs M. 1974. Corpus callosum in multiple sclerosis. J Neurol Neurosurg
Psychiatry 37(11):1259-1264.
Barres BA, Raff MC, Gaese F, Bartke I, Dechant G, Barde YA. 1994. A crucial role for
neurotrophin-3 in oligodendrocyte development. Nature 367(6461):371-375.
Barres BA, Schmid R, Sendnter M, Raff MC. 1993. Multiple extracellular signals are required
for long-term oligodendrocyte survival. Development 118(1):283-295.
Bartlett WP, Knapp PE, Skoff RP. 1988. Glial conditioned medium enables jimpy
oligodendrocytes to express properties of normal oligodendrocytes: production of
myelin antigens and membranes. Glia 1(4):253-259.
Bartoli C, Baeza N, Figarella C, Pellegrini I, Figarella-Branger D. 1998. Expression of
peptide-23/pancreatitis-associated protein and Reg genes in human pituitary and
adenomas: comparison with other fetal and adult human tissues. J Clin Endocrinol
Metab 83(11):4041-4046.
Bauer S, Hay M, Amilhon B, Jean A, Moyse E. 2005. In vivo neurogenesis in the dorsal vagal
complex of the adult rat brainstem. Neuroscience 130(1):75-90.
Baumgarten HG, Bjorklund A, Holstein AF, Nobin A. 1972. Organization and ultrastructural
identification of the catecholamine nerve terminals in the neural lobe and pars
intermedia of the rat pituitary. Z Zellforsch Mikrosk Anat 126(4):483-517.
Bedard A, Parent A. 2004. Evidence of newly generated neurons in the human olfactory bulb.
Brain Res Dev Brain Res 151(1-2):159-168.
97
Beglopoulos V, Shen J. 2004. Gene-targeting technologies for the study of neurological
disorders. Neuromolecular Med 6(1):13-30.
Belachew S, Chittajallu R, Aguirre AA, Yuan X, Kirby M, Anderson S, Gallo V. 2003.
Postnatal NG2 proteoglycan-expressing progenitor cells are intrinsically multipotent
and generate functional neurons. J Cell Biol 161(1):169-186.
Belachew S, Gallo V. 2004. Synaptic and extrasynaptic neurotransmitter receptors in glial
precursors' quest for identity. Glia 48(3):185-196.
Ben-Hur T, Rogister B, Murray K, Rougon G, Dubois-Dalcq M. 1998. Growth and fate of
PSA-NCAM+ precursors of the postnatal brain. J Neurosci 18(15):5777-5788.
Bergles DE, Roberts JD, Somogyi P, Jahr CE. 2000. Glutamatergic synapses on
oligodendrocyte precursor cells in the hippocampus. Nature 405(6783):187-191.
Berry M, Hubbard P, Butt AM. 2002. Cytology and lineage of NG2-positive glia. J
Neurocytol 31(6-7):457-467.
Bezard E, Dovero S, Belin D, Duconger S, Jackson-Lewis V, Przedborski S, Piazza PV,
Gross CE, Jaber M. 2003. Enriched environment confers resistance to 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine and cocaine: involvement of dopamine transporter
and trophic factors. J Neurosci 23(35):10999-11007.
Bhattacharjee J, Sanyal S. 1975. Developmental origin and early differentiation of retinal
Muller cells in mice. J Anat 120(Pt 2):367-372.
Bhattacharya S, Jackson JD, Das AV, Thoreson WB, Kuszynski C, James J, Joshi S, Ahmad
I. 2003. Direct identification and enrichment of retinal stem cells/progenitors by
Hoechst dye efflux assay. Invest Ophthalmol Vis Sci 44(6):2764-2773.
Biebl M, Cooper CM, Winkler J, Kuhn HG. 2000. Analysis of neurogenesis and programmed
cell death reveals a self-renewing capacity in the adult rat brain. Neurosci Lett
291(1):17-20.
Biernaskie J, Corbett D. 2001. Enriched rehabilitative training promotes improved forelimb
motor function and enhanced dendritic growth after focal ischemic injury. J Neurosci
21(14):5272-5280.
Bignami A. 1984. Glial fibrillary acidic (GFA) protein in Muller glia. Immunofluorescence
study of the goldfish retina. Brain Res 300(1):175-178.
Bignami A, Eng LF, Dahl D, Uyeda CT. 1972. Localization of the glial fibrillary acidic
protein in astrocytes by immunofluorescence. Brain Res 43(2):429-435.
Bignami A, Raju T, Dahl D. 1982. Localization of vimentin, the nonspecific intermediate
filament protein, in embryonal glia and in early differentiating neurons. In vivo and in
vitro immunofluorescence study of the rat embryo with vimentin and neurofilament
antisera. Dev Biol 91(2):286-295.
Bjorklund A, Lindvall O. 2000. Cell replacement therapies for central nervous system
disorders. Nat Neurosci 3(6):537-544.
98
Blakemore WF, Franklin RJ. 2000. Transplantation options for therapeutic central nervous
system remyelination. Cell Transplant 9(2):289-294.
Boersma CJ, Van Leeuwen FW. 1994. Neuron-glia interactions in the release of oxytocin and
vasopressin from the rat neural lobe: the role of opioids, other neuropeptides and their
receptors. Neuroscience 62(4):1003-1020.
Bogler O, Wren D, Barnett SC, Land H, Noble M. 1990. Cooperation between two growth
factors promotes extended self-renewal and inhibits differentiation of
oligodendrocyte-type-2 astrocyte (O-2A) progenitor cells. Proc Natl Acad Sci U S A
87(16):6368-6372.
Bolteus AJ, Bordey A. 2004. GABA release and uptake regulate neuronal precursor migration
in the postnatal subventricular zone. J Neurosci 24(35):7623-7631.
Bongarzone ER. 2002. Induction of oligodendrocyte fate during the formation of the
vertebrate neural tube. Neurochem Res 27(11):1361-1369.
Bonni A, Sun Y, Nadal-Vicens M, Bhatt A, Frank DA, Rozovsky I, Stahl N, Yancopoulos
GD, Greenberg ME. 1997. Regulation of gliogenesis in the central nervous system by
the JAK-STAT signaling pathway. Science 278(5337):477-483.
Bonnin JM, Rubinstein LJ. 1984. Immunohistochemistry of central nervous system tumors.
Its contributions to neurosurgical diagnosis. J Neurosurg 60(6):1121-1133.
Boudreau CR, Yang I, Liau LM. 2005. Gliomas: advances in molecular analysis and
characterization. Surg Neurol 64(4):286-294.
Bouissac J. 2005. Rôle de la voie Notch dans la spécification des cellules souches neurales et
dans la différenciation des précurseurs neuraux. Utilisation du système modèle des
neurosphères. Thèse de neurosciences, Université Louis-Pasteur, Strasbourg.
Bouvier C, Bartoli C, Aguirre-Cruz L, Virard I, Colin C, Fernandez C, Gouvernet J, FigarellaBranger D. 2003. Shared oligodendrocyte lineage gene expression in gliomas and
oligodendrocyte progenitor cells. J Neurosurg 99(2):344-350.
Bouvier C, Roll P, Quilichini B, Metellus P, Calisti A, Gilles S, Chinot O, Fina F, Martin PM,
Figarella-Branger D. 2004. Deletions of chromosomes 1p and 19q are detectable on
frozen smears of gliomas by FISH: usefulness for stereotactic biopsies. J Neurooncol
68(2):141-149.
Bouvier-Labit C, Liprandi A, Monti G, Pellissier JF, Figarella-Branger D. 2002. CD44H is
expressed by cells of the oligodendrocyte lineage and by oligodendrogliomas in
humans. J Neurooncol 60(2):127-134.
Bouzioukh F, Tell F, Jean A, Rougon G. 2001. NMDA receptor and nitric oxide synthase
activation regulate polysialylated neural cell adhesion molecule expression in adult
brainstem synapses. J Neurosci 21(13):4721-4730.
Bozzali M, Wrabetz L. 2004. Axonal signals and oligodendrocyte differentiation. Neurochem
Res 29(5):979-988.
99
Britsch S, Goerich DE, Riethmacher D, Peirano RI, Rossner M, Nave KA, Birchmeier C,
Wegner M. 2001. The transcription factor Sox10 is a key regulator of peripheral glial
development. Genes Dev 15(1):66-78.
Broe M, Kril J, Halliday GM. 2004. Astrocytic degeneration relates to the severity of disease
in frontotemporal dementia. Brain 127(Pt 10):2214-2220.
Bruni JE. 1998. Ependymal development, proliferation, and functions: a review. Microsc Res
Tech 41(1):2-13.
Bucy P. 1932. The hypophysis cerebri. In: Penfield W, éditeur. Cytology and cellular
Pathology of the nervous system. New York. Paul B. Horber Inc. p 707-738.
Bushong EA, Martone ME, Jones YZ, Ellisman MH. 2002. Protoplasmic astrocytes in CA1
stratum radiatum occupy separate anatomical domains. J Neurosci 22(1):183-192.
Butt AM, Duncan A, Hornby MF, Kirvell SL, Hunter A, Levine JM, Berry M. 1999. Cells
expressing the NG2 antigen contact nodes of Ranvier in adult CNS white matter. Glia
26(1):84-91.
Butt AM, Hamilton N, Hubbard P, Pugh M, Ibrahim M. 2005. Synantocytes: the fifth
element. J Anat 207(6):695-706.
Butt AM, Kiff J, Hubbard P, Berry M. 2002. Synantocytes: new functions for novel NG2
expressing glia. J Neurocytol 31(6-7):551-565.
Cai J, Qi Y, Hu X, Tan M, Liu Z, Zhang J, Li Q, Sander M, Qiu M. 2005. Generation of
oligodendrocyte precursor cells from mouse dorsal spinal cord independent of Nkx6
regulation and Shh signaling. Neuron 45(1):41-53.
Cai J, Wu Y, Mirua T, Pierce JL, Lucero MT, Albertine KH, Spangrude GJ, Rao MS. 2002.
Properties of a fetal multipotent neural stem cell (NEP cell). Dev Biol 251(2):221-240.
Cameron HA, Woolley CS, McEwen BS, Gould E. 1993. Differentiation of newly born
neurons and glia in the dentate gyrus of the adult rat. Neuroscience 56(2):337-344.
Cameron RS, Rakic P. 1991. Glial cell lineage in the cerebral cortex: a review and synthesis.
Glia 4(2):124-137.
Campbell K, Gotz M. 2002. Radial glia: multi-purpose cells for vertebrate brain development.
Trends Neurosci 25(5):235-238.
Cao Q, Benton RL, Whittemore SR. 2002. Stem cell repair of central nervous system injury. J
Neurosci Res 68(5):501-510.
Capela A, Temple S. 2002. LeX/ssea-1 is expressed by adult mouse CNS stem cells,
identifying them as nonependymal. Neuron 35(5):865-875.
Carro E, Trejo JL, Busiguina S, Torres-Aleman I. 2001. Circulating insulin-like growth factor
I mediates the protective effects of physical exercise against brain insults of different
etiology and anatomy. J Neurosci 21(15):5678-5684.
100
Cathcart RS, 3rd, Worthington WC, Jr. 1964. Ciliary Movement in the Rat Cerebral
Ventricles: Clearing Action and Directions of Currents. J Neuropathol Exp Neurol
23:609-618.
Cayre M, Bancila M, Virard I, Borges A, Durbec P. 2006. Migrating and myelinating
potential of subventricular zone neural progenitor cells in white matter tracts of the
adult rodent brain. Mol Cell Neurosci.
Celis JE, Madsen P, Nielsen S, Celis A. 1986. Nuclear patterns of cyclin (PCNA) antigen
distribution subdivide S-phase in cultured cells--some applications of PCNA
antibodies. Leuk Res 10(3):237-249.
Charrier C, Coronas V, Fombonne J, Roger M, Jean A, Krantic S, Moyse E. 2006.
Characterization of neural stem cells in the dorsal vagal complex of adult rat by in
vivo proliferation labeling and in vitro neurosphere assay. Neuroscience 138(1):5-16.
Chazal G, Durbec P, Jankovski A, Rougon G, Cremer H. 2000. Consequences of neural cell
adhesion molecule deficiency on cell migration in the rostral migratory stream of the
mouse. J Neurosci 20(4):1446-1457.
Chen ZJ, Negra M, Levine A, Ughrin Y, Levine JM. 2002. Oligodendrocyte precursor cells:
reactive cells that inhibit axon growth and regeneration. J Neurocytol 31(6-7):481495.
Chiasson BJ, Tropepe V, Morshead CM, van der Kooy D. 1999. Adult mammalian forebrain
ependymal and subependymal cells demonstrate proliferative potential, but only
subependymal cells have neural stem cell characteristics. J Neurosci 19(11):44624471.
Choi BH, Kim RC. 1985. Expression of glial fibrillary acidic protein by immature
oligodendroglia and its implications. J Neuroimmunol 8(4-6):215-235.
Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal Biochem 162(1):156-159.
Clarke SR, Shetty AK, Bradley JL, Turner DA. 1994. Reactive astrocytes express the
embryonic intermediate neurofilament nestin. Neuroreport 5(15):1885-1888.
Cocchia D, Miani N. 1980. Immunocytochemical localization of the brain-specific S-100
protein in the pituitary gland of adult rat. J Neurocytol 9(6):771-782.
Colin C, Baeza N, Tong S, Bouvier C, Quilichini B, Durbec P, Figarella-Branger D. 2006. In
vitro identification and functional characterization of glial precursor cells in human
gliomas. Neuropathol Appl Neurobiol 32(2):189-202.
Comte I. 2003. Etude expérimentale de la néo-neurogenese et des cellules souches neurales au
sein du système olfactif aviaire. Thèse de biologie, sciences, santé, Université de
Limoges.
Coons SW, Johnson PC, Scheithauer BW, Yates AJ, Pearl DK. 1997. Improving diagnostic
accuracy and interobserver concordance in the classification and grading of primary
gliomas. Cancer 79(7):1381-1393.
101
Coquillat D. 2001. Les groupements poysialiques : cibles d'un vaccin contre le méningocoque
B et déterminants de la plasticité neuronale. Thèse de biologie cellulaire, biologie
structurale et microbiologie, Université de la Méditerranée, Marseille.
Corotto FS, Henegar JA, Maruniak JA. 1993. Neurogenesis persists in the subependymal
layer of the adult mouse brain. Neurosci Lett 149(2):111-114.
Coskun V, Venkatraman G, Yang H, Rao MS, Luskin MB. 2001. Retroviral manipulation of
the expression of bone morphogenetic protein receptor Ia by SVZa progenitor cells
leads to changes in their p19(INK4d) expression but not in their neuronal
commitment. Int J Dev Neurosci 19(2):219-227.
Dahl D, Rueger DC, Bignami A, Weber K, Osborn M. 1981. Vimentin, the 57 000 molecular
weight protein of fibroblast filaments, is the major cytoskeletal component in
immature glia. Eur J Cell Biol 24(2):191-196.
Dahlstrand J, Collins VP, Lendahl U. 1992. Expression of the class VI intermediate filament
nestin in human central nervous system tumors. Cancer Res 52(19):5334-5341.
Dai C, Celestino JC, Okada Y, Louis DN, Fuller GN, Holland EC. 2001. PDGF autocrine
stimulation dedifferentiates cultured astrocytes and induces oligodendrogliomas and
oligoastrocytomas from neural progenitors and astrocytes in vivo. Genes Dev
15(15):1913-1925.
D'Amour KA, Gage FH. 2003. Genetic and functional differences between multipotent neural
and pluripotent embryonic stem cells. Proc Natl Acad Sci U S A 100 Suppl 1:1186611872.
Dasen JS, Rosenfeld MG. 1999. Combinatorial codes in signaling and synergy: lessons from
pituitary development. Curr Opin Genet Dev 9(5):566-574.
Daumas-Duport C, Monsaigneon V, Blond S, Munari C, Musolino A, Chodkiewicz JP, Missir
O. 1987. Serial stereotactic biopsies and CT scan in gliomas: correlative study in 100
astrocytomas, oligo-astrocytomas and oligodendrocytomas. J Neurooncol 4(4):317328.
Daumas-Duport C, Varlet P, Tucker ML, Beuvon F, Cervera P, Chodkiewicz JP. 1997.
Oligodendrogliomas. Part I: Patterns of growth, histological diagnosis, clinical and
imaging correlations: a study of 153 cases. J Neurooncol 34(1):37-59.
Davis AA, Temple S. 1994. A self-renewing multipotential stem cell in embryonic rat
cerebral cortex. Nature 372(6503):263-266.
Dawson MR, Levine JM, Reynolds R. 2000. NG2-expressing cells in the central nervous
system: are they oligodendroglial progenitors? J Neurosci Res 61(5):471-479.
Dawson MR, Polito A, Levine JM, Reynolds R. 2003. NG2-expressing glial progenitor cells:
an abundant and widespread population of cycling cells in the adult rat CNS. Mol Cell
Neurosci 24(2):476-488.
de Castro F, Bribian A. 2005. The molecular orchestra of the migration of oligodendrocyte
precursors during development. Brain Res Brain Res Rev 49(2):227-241.
102
De Ceuninck F, Gaufillier S, Bonnaud A, Sabatini M, Lesur C, Pastoureau P. 2001. YKL-40
(cartilage gp-39) induces proliferative events in cultured chondrocytes and
synoviocytes and increases glycosaminoglycan synthesis in chondrocytes. Biochem
Biophys Res Commun 285(4):926-931.
Decker L, Picard-Riera N, Lachapelle F, Baron-Van Evercooren A. 2002. Growth factor
treatment promotes mobilization of young but not aged adult subventricular zone
precursors in response to demyelination. J Neurosci Res 69(6):763-771.
Deitmer JW. 2001. Strategies for metabolic exchange between glial cells and neurons. Respir
Physiol 129(1-2):71-81.
Del Bigio MR. 1995. The ependyma: a protective barrier between brain and cerebrospinal
fluid. Glia 14(1):1-13.
Dellmann HD, Castel M, Linner JG. 1978. Ultrastructure of peptidergic neurosecretory axons
in the developing neural lobe of the rat. Gen Comp Endocrinol 36(4):477-486.
Dellmann HD, Owsley PA. 1969. Investigations on the hypothalamo-neurohypophysial
neurosecretory system of the grass frog (Rana pipiens) after transection of the
proximal neurohypophysis. II. Light- and electron microscopic findings in the
disconnected distal neurohypophysis with special emphasis on the pituicytes. Z
Zellforsch Mikrosk Anat 94(3):325-336.
Dellmann HD, Stoeckel ME, Porte A, Stutinsky F. 1974. Ultrastructure of the
neurohypophysial glial cells following stalk transection in the rat. Experientia
30(10):1220-1222.
Deloulme JC, Raponi E, Gentil BJ, Bertacchi N, Marks A, Labourdette G, Baudier J. 2004.
Nuclear expression of S100B in oligodendrocyte progenitor cells correlates with
differentiation toward the oligodendroglial lineage and modulates oligodendrocytes
maturation. Mol Cell Neurosci 27(4):453-465.
Dermietzel R, Spray DC. 1998. From neuro-glue ('Nervenkitt') to glia: a prologue. Glia
24(1):1-7.
Derouiche A, Rauen T. 1995. Coincidence of L-glutamate/L-aspartate transporter (GLAST)
and glutamine synthetase (GS) immunoreactions in retinal glia: evidence for coupling
of GLAST and GS in transmitter clearance. J Neurosci Res 42(1):131-143.
Di Bello IC, Dawson MR, Levine JM, Reynolds R. 1999. Generation of oligodendroglial
progenitors in acute inflammatory demyelinating lesions of the rat brain stem is
associated with demyelination rather than inflammation. J Neurocytol 28(4-5):365381.
Dienel GA, Hertz L. 2005. Astrocytic contributions to bioenergetics of cerebral ischemia.
Glia 50(4):362-388.
Dietrich J, Noble M, Mayer-Proschel M. 2002. Characterization of A2B5+ glial precursor
cells from cryopreserved human fetal brain progenitor cells. Glia 40(1):65-77.
103
Doerflinger NH, Macklin WB, Popko B. 2003. Inducible site-specific recombination in
myelinating cells. Genesis 35(1):63-72.
Doetsch F, Alvarez-Buylla A. 1996. Network of tangential pathways for neuronal migration
in adult mammalian brain. Proc Natl Acad Sci U S A 93(25):14895-14900.
Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A. 1999. Subventricular
zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97(6):703716.
Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A. 1997. Cellular composition and threedimensional organization of the subventricular germinal zone in the adult mammalian
brain. J Neurosci 17(13):5046-5061.
Dore-Duffy P, Katychev A, Wang X, Van Buren E. 2006. CNS microvascular pericytes
exhibit multipotential stem cell activity. J Cereb Blood Flow Metab 26(5):613-624.
Dreifuss JJ, Sandri C, Akert K, Moor H. 1975. Ultrastructural evidence for sinusoid spaces
and coupling between pituicytes in the rat. Cell Tissue Res 161(1):33-45.
Dubois PM, el Amraoui A, Heritier AG. 1997. Development and differentiation of pituitary
cells. Microsc Res Tech 39(2):98-113.
Dubois-Dalcq M, Murray K. 2000. Why are growth factors important in oligodendrocyte
physiology? Pathol Biol (Paris) 48(1):80-86.
Durand B, Raff M. 2000. A cell-intrinsic timer that operates during oligodendrocyte
development. Bioessays 22(1):64-71.
Durbec P, Rougon G. 2001. Transplantation of mammalian olfactory progenitors into chick
hosts reveals migration and differentiation potentials dependent on cell commitment.
Mol Cell Neurosci 17(3):561-576.
Echigo N, Moriyama Y. 2004. Vesicular inhibitory amino acid transporter is expressed in
gamma-aminobutyric acid (GABA)-containing astrocytes in rat pineal glands.
Neurosci Lett 367(1):79-84.
Edwards MA, Yamamoto M, Caviness VS, Jr. 1990. Organization of radial glia and related
cells in the developing murine CNS. An analysis based upon a new monoclonal
antibody marker. Neuroscience 36(1):121-144.
Ehninger D, Kempermann G. 2003. Regional effects of wheel running and environmental
enrichment on cell genesis and microglia proliferation in the adult murine neocortex.
Cereb Cortex 13(8):845-851.
Ellison JA, de Vellis J. 1994. Platelet-derived growth factor receptor is expressed by cells in
the early oligodendrocyte lineage. J Neurosci Res 37(1):116-128.
Emsley JG, Mitchell BD, Kempermann G, Macklis JD. 2005. Adult neurogenesis and repair
of the adult CNS with neural progenitors, precursors, and stem cells. Prog Neurobiol
75(5):321-341.
104
Eng LF, Ghirnikar RS, Lee YL. 2000. Glial fibrillary acidic protein: GFAP-thirty-one years
(1969-2000). Neurochem Res 25(9-10):1439-1451.
Engstrom CM, Demers D, Dooner M, McAuliffe C, Benoit BO, Stencel K, Joly M, Hulspas
R, Reilly JL, Savarese T, Recht LD, Ross AH, Quesenberry PJ. 2002. A method for
clonal analysis of epidermal growth factor-responsive neural progenitors. J Neurosci
Methods 117(2):111-121.
Episkopou V. 2005. SOX2 functions in adult neural stem cells. Trends Neurosci 28(5):219221.
Espinosa de los Monteros A, Zhang M, De Vellis J. 1993. O2A progenitor cells transplanted
into the neonatal rat brain develop into oligodendrocytes but not astrocytes. Proc Natl
Acad Sci U S A 90(1):50-54.
Faherty CJ, Raviie Shepherd K, Herasimtschuk A, Smeyne RJ. 2005. Environmental
enrichment in adulthood eliminates neuronal death in experimental Parkinsonism.
Brain Res Mol Brain Res 134(1):170-179.
Fahim S, Riordan JR. 1986. Lipophilin (PLP) gene in X-linked myelin disorders. J Neurosci
Res 16(1):303-310.
Fallon J, Reid S, Kinyamu R, Opole I, Opole R, Baratta J, Korc M, Endo TL, Duong A,
Nguyen G, Karkehabadhi M, Twardzik D, Patel S, Loughlin S. 2000. In vivo
induction of massive proliferation, directed migration, and differentiation of neural
cells in the adult mammalian brain. Proc Natl Acad Sci U S A 97(26):14686-14691.
Fanarraga ML, Dickinson PJ, Sommer I, Montague P, Kyriakides E, Griffiths IR. 1996.
Evidence that some oligodendrocyte progenitors in the developing optic pathway
express the plp gene. Glia 18(4):282-292.
Farrer RG, Quarles RH. 1999. GT3 and its O-acetylated derivative are the principal A2B5reactive gangliosides in cultured O2A lineage cells and are down-regulated along with
O-acetyl GD3 during differentiation to oligodendrocytes. J Neurosci Res 57(3):371380.
Fellin T, Carmignoto G. 2004. Neurone-to-astrocyte signalling in the brain represents a
distinct multifunctional unit. J Physiol 559(Pt 1):3-15.
Ferri AL, Cavallaro M, Braida D, Di Cristofano A, Canta A, Vezzani A, Ottolenghi S,
Pandolfi PP, Sala M, DeBiasi S, Nicolis SK. 2004. Sox2 deficiency causes
neurodegeneration and impaired neurogenesis in the adult mouse brain. Development
131(15):3805-3819.
ffrench-Constant C, Raff MC. 1986. Proliferating bipotential glial progenitor cells in adult rat
optic nerve. Nature 319(6053):499-502.
Figarella-Branger D, Daniel L, Andre P, Guia S, Renaud W, Monti G, Vivier E, Rougon G.
1999. The PEN5 epitope identifies an oligodendrocyte precursor cell population and
pilocytic astrocytomas. Am J Pathol 155(4):1261-1269.
105
Fischer AJ, Reh TA. 2001. Muller glia are a potential source of neural regeneration in the
postnatal chicken retina. Nat Neurosci 4(3):247-252.
Flament-Durand J, Brion JP. 1985. Tanycytes: morphology and functions: a review. Int Rev
Cytol 96:121-155.
Fogarty M, Richardson WD, Kessaris N. 2005. A subset of oligodendrocytes generated from
radial glia in the dorsal spinal cord. Development 132(8):1951-1959.
Fok-Seang J, Miller RH. 1992. Astrocyte precursors in neonatal rat spinal cord cultures. J
Neurosci 12(7):2751-2764.
Fomchenko EI, Holland EC. 2005. Stem cells and brain cancer. Exp Cell Res 306(2):323-329.
Franklin RJ. 2002. Remyelination of the demyelinated CNS: the case for and against
transplantation of central, peripheral and olfactory glia. Brain Res Bull 57(6):827-832.
Franklin RJ, Blakemore WF. 1995. Glial-cell transplantation and plasticity in the O-2A
lineage--implications for CNS repair. Trends Neurosci 18(3):151-156.
Fulton BP, Burne JF, Raff MC. 1991. Glial cells in the rat optic nerve. The search for the
type-2 astrocyte. Ann N Y Acad Sci 633:27-34.
Fulton BP, Burne JF, Raff MC. 1992. Visualization of O-2A progenitor cells in developing
and adult rat optic nerve by quisqualate-stimulated cobalt uptake. J Neurosci
12(12):4816-4833.
Gabay L, Lowell S, Rubin LL, Anderson DJ. 2003. Deregulation of dorsoventral patterning
by FGF confers trilineage differentiation capacity on CNS stem cells in vitro. Neuron
40(3):485-499.
Gage FH. 2000. Mammalian neural stem cells. Science 287(5457):1433-1438.
Gage FH, Coates PW, Palmer TD, Kuhn HG, Fisher LJ, Suhonen JO, Peterson DA, Suhr ST,
Ray J. 1995. Survival and differentiation of adult neuronal progenitor cells
transplanted to the adult brain. Proc Natl Acad Sci U S A 92(25):11879-11883.
Galabov P, Schiebler TH. 1978. The ultrastructure of the developing neural lobe. Cell Tissue
Res 189(2):313-329.
Galli R, Binda E, Orfanelli U, Cipelletti B, Gritti A, De Vitis S, Fiocco R, Foroni C, Dimeco
F, Vescovi A. 2004. Isolation and characterization of tumorigenic, stem-like neural
precursors from human glioblastoma. Cancer Res 64(19):7011-7021.
Ganong WF. 1977. Ch. 32. Circulations régionales particulières. In: Boeck D, éditeur.
Physiologie médicale.
Gao L, Macklin W, Gerson J, Miller RH. 2006. Intrinsic and extrinsic inhibition of
oligodendrocyte development by rat retina. Dev Biol 290(2):277-286.
Garrell J, Campuzano S. 1991. The helix-loop-helix domain: a common motif for bristles,
muscles and sex. Bioessays 13(10):493-498.
106
Gean-Marton AD, Vezina LG, Marton KI, Stimac GK, Peyster RG, Taveras JM, Davis KR.
1991. Abnormal corpus callosum: a sensitive and specific indicator of multiple
sclerosis. Radiology 180(1):215-221.
Gensert JM, Goldman JE. 1996. In vivo characterization of endogenous proliferating cells in
adult rat subcortical white matter. Glia 17(1):39-51.
Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U, Stein H. 1984. Cell cycle analysis of a
cell proliferation-associated human nuclear antigen defined by the monoclonal
antibody Ki-67. J Immunol 133(4):1710-1715.
Gilbert SF. 2000. Developmental Biology: Sinauer Associates, Inc.
Go Y, Chintala SK, Oka K, Gokaslan Z, Sawaya R, Rao JS. 1996. Invasive pattern of lac-Ztransfected human glioblastoma cells in nude mice brain. Cancer Lett 110(1-2):225231.
Godfraind C, Friedrich VL, Holmes KV, Dubois-Dalcq M. 1989. In vivo analysis of glial cell
phenotypes during a viral demyelinating disease in mice. J Cell Biol 109(5):24052416.
Goldman JE. 2004. Ch. 12. Astrocyte Lineage. In: Lazzarini RA, éditeur. Myelin Biology and
Disorders: Elsevier Academic Press.
Goldman S. 2005. Stem and progenitor cell-based therapy of the human central nervous
system. Nat Biotechnol 23(7):862-871.
Goldman SA, Luskin MB. 1998. Strategies utilized by migrating neurons of the postnatal
vertebrate forebrain. Trends Neurosci 21(3):107-114.
Gotts JE, Chesselet MF. 2005. Mechanisms of subventricular zone expansion after focal
cortical ischemic injury. J Comp Neurol 488(2):201-214.
Graeber MB, Tetzlaff W, Streit WJ, Kreutzberg GW. 1988. Microglial cells but not astrocytes
undergo mitosis following rat facial nerve axotomy. Neurosci Lett 85(3):317-321.
Gravel M, DeAngelis D, Braun PE. 1994. Molecular cloning and characterization of rat brain
2',3'-cyclic nucleotide 3'-phosphodiesterase isoform 2. J Neurosci Res 38(3):243-247.
Green BN, Jones SB, Streck RD, Wood TL, Rotwein P, Pintar JE. 1994. Distinct expression
patterns of insulin-like growth factor binding proteins 2 and 5 during fetal and
postnatal development. Endocrinology 134(2):954-962.
Greenwood K, Butt AM. 2003. Evidence that perinatal and adult NG2-glia are not
conventional oligodendrocyte progenitors and do not depend on axons for their
survival. Mol Cell Neurosci 23(4):544-558.
Gregori N, Proschel C, Noble M, Mayer-Proschel M. 2002. The tripotential glial-restricted
precursor (GRP) cell and glial development in the spinal cord: generation of
bipotential oligodendrocyte-type-2 astrocyte progenitor cells and dorsal-ventral
differences in GRP cell function. J Neurosci 22(1):248-256.
107
Grinspan JB, Lieb M, Stern J, Rupnick M, Williams S, Pleasure D. 1987. Rat brain
microvessel extracellular matrix modulates the phenotype of cultured rat type 1
astroglia. Brain Res 430(2):291-295.
Gudino-Cabrera G, Nieto-Sampedro M. 1999. Estrogen receptor immunoreactivity in
Schwann-like brain macroglia. J Neurobiol 40(4):458-470.
Gudino-Cabrera G, Nieto-Sampedro M. 2000. Schwann-like macroglia in adult rat brain. Glia
30(1):49-63.
Guha A, Dashner K, Black PM, Wagner JA, Stiles CD. 1995. Expression of PDGF and PDGF
receptors in human astrocytoma operation specimens supports the existence of an
autocrine loop. Int J Cancer 60(2):168-173.
Guillemin GJ, Brew BJ. 2004. Microglia, macrophages, perivascular macrophages, and
pericytes: a review of function and identification. J Leukoc Biol 75(3):388-397.
Hachem S, Aguirre A, Vives V, Marks A, Gallo V, Legraverend C. 2005. Spatial and
temporal expression of S100B in cells of oligodendrocyte lineage. Glia 51(2):81-97.
Hack I, Bancila M, Loulier K, Carroll P, Cremer H. 2002. Reelin is a detachment signal in
tangential chain-migration during postnatal neurogenesis. Nat Neurosci 5(10):939945.
Hack MA, Saghatelyan A, de Chevigny A, Pfeifer A, Ashery-Padan R, Lledo PM, Gotz M.
2005. Neuronal fate determinants of adult olfactory bulb neurogenesis. Nat Neurosci
8(7):865-872.
Hack MA, Sugimori M, Lundberg C, Nakafuku M, Gotz M. 2004. Regionalization and fate
specification in neurospheres: the role of Olig2 and Pax6. Mol Cell Neurosci
25(4):664-678.
Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A. 1998. Generating green
fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev
76(1-2):79-90.
Hagg T. 2005. Molecular regulation of adult CNS neurogenesis: an integrated view. Trends
Neurosci 28(11):589-595.
Halatsch ME, Schmidt U, Behnke-Mursch J, Unterberg A, Wirtz CR. 2006. Epidermal growth
factor receptor inhibition for the treatment of glioblastoma multiforme and other
malignant brain tumours. Cancer Treat Rev 32(2):74-89.
Hall A, Giese NA, Richardson WD. 1996. Spinal cord oligodendrocytes develop from
ventrally derived progenitor cells that express PDGF alpha-receptors. Development
122(12):4085-4094.
Hall AK, Miller RH. 2004. Emerging roles for bone morphogenetic proteins in central
nervous system glial biology. J Neurosci Res 76(1):1-8.
Hanoune J. 1996. Ch. 8. Glandes endocrines. In: Pradel, éditeur. Physiologie humaine. 2e éd.
108
Hatton GI. 1990. Emerging concepts of structure-function dynamics in adult brain: the
hypothalamo-neurohypophysial system. Prog Neurobiol 34(6):437-504.
Hatton GI. 1997. Function-related plasticity in hypothalamus. Annu Rev Neurosci 20:375397.
Haydon PG. 2001. GLIA: listening and talking to the synapse. Nat Rev Neurosci 2(3):185193.
He J, Mokhtari K, Sanson M, Marie Y, Kujas M, Huguet S, Leuraud P, Capelle L, Delattre
JY, Poirier J, Hoang-Xuan K. 2001. Glioblastomas with an oligodendroglial
component: a pathological and molecular study. J Neuropathol Exp Neurol 60(9):863871.
Hellmann MA, Panet H, Barhum Y, Melamed E, Offen D. 2006. Increased survival and
migration of engrafted mesenchymal bone marrow stem cells in 6-hydroxydopaminelesioned rodents. Neurosci Lett 395(2):124-128.
Herpers MJ, Budka H. 1984. Glial fibrillary acidic protein (GFAP) in oligodendroglial
tumors: gliofibrillary oligodendroglioma and transitional oligoastrocytoma as subtypes
of oligodendroglioma. Acta Neuropathol (Berl) 64(4):265-272.
Herrera DG, Garcia-Verdugo JM, Alvarez-Buylla A. 1999. Adult-derived neural precursors
transplanted into multiple regions in the adult brain. Ann Neurol 46(6):867-877.
Herrera J, Yang H, Zhang SC, Proschel C, Tresco P, Duncan ID, Luskin M, Mayer-Proschel
M. 2001. Embryonic-derived glial-restricted precursor cells (GRP cells) can
differentiate into astrocytes and oligodendrocytes in vivo. Exp Neurol 171(1):11-21.
Hetts SW. 1998. To die or not to die: an overview of apoptosis and its role in disease. Jama
279(4):300-307.
Hindmarch C, Yao S, Beighton G, Paton J, Murphy D. 2006. A comprehensive description of
the transcriptome of the hypothalamoneurohypophyseal system in euhydrated and
dehydrated rats. Proc Natl Acad Sci U S A 103(5):1609-1614.
Hirano M, Goldman JE. 1988. Gliogenesis in rat spinal cord: evidence for origin of astrocytes
and oligodendrocytes from radial precursors. J Neurosci Res 21(2-4):155-167.
Hirrlinger J, Hulsmann S, Kirchhoff F. 2004. Astroglial processes show spontaneous motility
at active synaptic terminals in situ. Eur J Neurosci 20(8):2235-2239.
Hitoshi S, Tropepe V, Ekker M, van der Kooy D. 2002. Neural stem cell lineages are
regionally specified, but not committed, within distinct compartments of the developing brain.
Development. 129(1):233-44.
Hoehn M, Kustermann E, Blunk J, Wiedermann D, Trapp T, Wecker S, Focking M, Arnold
H, Hescheler J, Fleischmann BK, Schwindt W, Buhrle C. 2002. Monitoring of
implanted stem cell migration in vivo: a highly resolved in vivo magnetic resonance
imaging investigation of experimental stroke in rat. Proc Natl Acad Sci U S A
99(25):16267-16272.
109
Hoglinger GU, Rizk P, Muriel MP, Duyckaerts C, Oertel WH, Caille I, Hirsch EC. 2004.
Dopamine depletion impairs precursor cell proliferation in Parkinson disease. Nat
Neurosci 7(7):726-735.
Holland EC, Celestino J, Dai C, Schaefer L, Sawaya RE, Fuller GN. 2000. Combined
activation of Ras and Akt in neural progenitors induces glioblastoma formation in
mice. Nat Genet 25(1):55-57.
Hommes OR, Leblond CP. 1967. Mitotic division of neuroglia in the normal adult rat. J
Comp Neurol 129(3):269-278.
Horner PJ, Power AE, Kempermann G, Kuhn HG, Palmer TD, Winkler J, Thal LJ, Gage FH.
2000. Proliferation and differentiation of progenitor cells throughout the intact adult
rat spinal cord. J Neurosci 20(6):2218-2228.
Horner PJ, Thallmair M, Gage FH. 2002. Defining the NG2-expressing cell of the adult CNS.
J Neurocytol 31(6-7):469-480.
Hulspas R, Quesenberry PJ. 2000. Characterization of neurosphere cell phenotypes by flow
cytometry. Cytometry 40(3):245-250.
Ickes BR, Pham TM, Sanders LA, Albeck DS, Mohammed AH, Granholm AC. 2000. Longterm environmental enrichment leads to regional increases in neurotrophin levels in rat
brain. Exp Neurol 164(1):45-52.
Idbaih A, Marie Y, Pierron G, Brennetot C, Hoang-Xuan K, Kujas M, Mokhtari K, Sanson M,
Lejeune J, Aurias A, Delattre O, Delattre JY. 2005. Two types of chromosome 1p
losses with opposite significance in gliomas. Ann Neurol 58(3):483-487.
Ingraham CA, Rising LJ, Morihisa JM. 1999. Development of O4+/O1- immunopanned prooligodendroglia in vitro. Brain Res Dev Brain Res 112(1):79-87.
Jacobson KA, Hoffmann C, Cattabeni F, Abbracchio MP. 1999. Adenosine-induced cell
death: evidence for receptor-mediated signalling. Apoptosis 4(3):197-211.
Jarvis CR, Andrew RD. 1988. Correlated electrophysiology and morphology of the ependyma
in rat hypothalamus. J Neurosci 8(10):3691-3702.
Jessell TM. 2000. Neuronal specification in the spinal cord: inductive signals and
transcriptional codes. Nat Rev Genet 1(1):20-29.
Jin K, Sun Y, Xie L, Peel A, Mao XO, Batteur S, Greenberg DA. 2003. Directed migration of
neuronal precursors into the ischemic cerebral cortex and striatum. Mol Cell Neurosci
24(1):171-189.
Johansson CB, Momma S, Clarke DL, Risling M, Lendahl U, Frisen J. 1999. Identification of
a neural stem cell in the adult mammalian central nervous system. Cell 96(1):25-34.
Johe KK, Hazel TG, Muller T, Dugich-Djordjevic MM, McKay RD. 1996. Single factors
direct the differentiation of stem cells from the fetal and adult central nervous system.
Genes Dev 10(24):3129-3140.
110
Jow F, Chiu D, Lim HK, Novak T, Lin S. 2004. Production of GABA by cultured
hippocampal glial cells. Neurochem Int 45(2-3):273-283.
Kakita A, Goldman JE. 1999. Patterns and dynamics of SVZ cell migration in the postnatal
forebrain: monitoring living progenitors in slice preparations. Neuron 23(3):461-472.
Kakita A, Zerlin M, Takahashi H, Goldman JE. 2003. Some glial progenitors in the neonatal
subventricular zone migrate through the corpus callosum to the contralateral cerebral
hemisphere. J Comp Neurol 458(4):381-388.
Kalyani A, Hobson K, Rao MS. 1997. Neuroepithelial stem cells from the embryonic spinal
cord: isolation, characterization, and clonal analysis. Dev Biol 186(2):202-223.
Kalyani AJ, Piper D, Mujtaba T, Lucero MT, Rao MS. 1998. Spinal cord neuronal precursors
generate multiple neuronal phenotypes in culture. J Neurosci 18(19):7856-7868.
Kamba T, Tam BY, Hashizume H, Haskell A, Sennino B, Mancuso MR, Norberg SM,
O'Brien SM, Davis RB, Gowen LC, Anderson KD, Thurston G, Joho S, Springer ML,
Kuo CJ, McDonald DM. 2006. VEGF-dependent plasticity of fenestrated capillaries in
the normal adult microvasculature. Am J Physiol Heart Circ Physiol 290(2):H560-576.
Kandel ER, Schwartz JH. 1985. Principles of Neural Sciences. New York: Elsevier Science
Publishing.
Kaneko Y, Sakakibara S, Imai T, Suzuki A, Nakamura Y, Sawamoto K, Ogawa Y, Toyama
Y, Miyata T, Okano H. 2000. Musashi1: an evolutionally conserved marker for CNS
progenitor cells including neural stem cells. Dev Neurosci 22(1-2):139-153.
Kang J, Jiang L, Goldman SA, Nedergaard M. 1998. Astrocyte-mediated potentiation of
inhibitory synaptic transmission. Nat Neurosci 1(8):683-692.
Kaplan MS, Hinds JW. 1980. Gliogenesis of astrocytes and oligodendrocytes in the
neocortical grey and white matter of the adult rat: electron microscopic analysis of
light radioautographs. J Comp Neurol 193(3):711-727.
Kaufman MH. 2001. The Atlas of Mouse Development. Academic Press.
Kawamoto K, Kawashima S. 1984. Ultrastructural changes and proliferation of pituicytes in
mouse posterior lobe during water deprivation and rehydration. Acta Anat (Basel)
119(3):136-141.
Keirstead HS, Ben-Hur T, Rogister B, O'Leary MT, Dubois-Dalcq M, Blakemore WF. 1999.
Polysialylated neural cell adhesion molecule-positive CNS precursors generate both
oligodendrocytes and Schwann cells to remyelinate the CNS after transplantation. J
Neurosci 19(17):7529-7536.
Keirstead HS, Levine JM, Blakemore WF. 1998. Response of the oligodendrocyte progenitor
cell population (defined by NG2 labelling) to demyelination of the adult spinal cord.
Glia 22(2):161-170.
111
Kempermann G, Brandon EP, Gage FH. 1998. Environmental stimulation of 129/SvJ mice
causes increased cell proliferation and neurogenesis in the adult dentate gyrus. Curr
Biol 8(16):939-942.
Kempermann G, Kuhn HG, Gage FH. 1997. More hippocampal neurons in adult mice living
in an enriched environment. Nature 386(6624):493-495.
Kim M, Morshead CM. 2003. Distinct populations of forebrain neural stem and progenitor
cells can be isolated using side-population analysis. J Neurosci 23(33):10703-10709.
Kimelberg HK. 2004. The problem of astrocyte identity. Neurochem Int 45(2-3):191-202.
Kirschenbaum B, Nedergaard M, Preuss A, Barami K, Fraser RA, Goldman SA. 1994. In
vitro neuronal production and differentiation by precursor cells derived from the adult
human forebrain. Cereb Cortex 4(6):576-589.
Kitada M, Rowitch DH. 2006. Transcription factor co-expression patterns indicate
heterogeneity of oligodendroglial subpopulations in adult spinal cord. Glia 54(1):3546.
Kleihues P, Cavenee W. 2000a. Pathology and Genetics of Tumours of the Nervous System.
Lyon: IARC Press.
Kleihues P, Cavenee W. 2000b. World Health Organization classification of tumors of the
nervous system. Lyon: IARC/WHO 2000.
Koehler RC, Gebremedhin D, Harder DR. 2006. Role of astrocytes in cerebrovascular
regulation. J Appl Physiol 100(1):307-317.
Kofler B, Bulleyment A, Humphries A, Carter DA. 2002. Id-1 expression defines a subset of
vimentin/S-100beta-positive, GFAP-negative astrocytes in the adult rat pineal gland.
Histochem J 34(3-4):167-171.
Kohwi M, Osumi N, Rubenstein JL, Alvarez-Buylla A. 2005. Pax6 is required for making
specific subpopulations of granule and periglomerular neurons in the olfactory bulb. J
Neurosci 25(30):6997-7003.
Kondo T, Raff M. 2000. Oligodendrocyte precursor cells reprogrammed to become
multipotential CNS stem cells. Science 289(5485):1754-1757.
Kondo T, Raff MC. 2004. A role for Noggin in the development of oligodendrocyte precursor
cells. Dev Biol 267(1):242-251.
Korn J, Christ B, Kurz H. 2002. Neuroectodermal origin of brain pericytes and vascular
smooth muscle cells. J Comp Neurol 442(1):78-88.
Korr H, Schultze B, Maurer W. 1973. Autoradiographic investigations of glial proliferation in
the brain of adult mice. I. The DNA synthesis phase of neuroglia and endothelial cells.
J Comp Neurol 150(2):169-175.
Kosaka K, Aika Y, Toida K, Heizmann CW, Hunziker W, Jacobowitz DM, Nagatsu I, Streit
P, Visser TJ, Kosaka T. 1995. Chemically defined neuron groups and their
112
subpopulations in the glomerular layer of the rat main olfactory bulb. Neurosci Res
23(1):73-88.
Kreutzberg GW. 1996. Microglia: a sensor for pathological events in the CNS. Trends
Neurosci 19(8):312-318.
Krsulovic J, Bruckner G. 1969. Morphological characteristics of pituicytes in different
functional stages. Light- and electronmicroscopy of the neurohypophysis of the albino
rat. Z Zellforsch Mikrosk Anat 99(2):210-220.
Krylyshkina O, Chen J, Mebis L, Denef C, Vankelecom H. 2005. Nestin-immunoreactive
cells in rat pituitary are neither hormonal nor typical folliculo-stellate cells.
Endocrinology 146(5):2376-2387.
Kuhlbrodt K, Herbarth B, Sock E, Hermans-Borgmeyer I, Wegner M. 1998. Sox10, a novel
transcriptional modulator in glial cells. J Neurosci 18(1):237-250.
Kuhn HG, Dickinson-Anson H, Gage FH. 1996. Neurogenesis in the dentate gyrus of the
adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci
16(6):2027-2033.
Kuhn HG, Winkler J, Kempermann G, Thal LJ, Gage FH. 1997. Epidermal growth factor and
fibroblast growth factor-2 have different effects on neural progenitors in the adult rat
brain. J Neurosci 17(15):5820-5829.
Lachapelle F, Avellana-Adalid V, Nait-Oumesmar B, Baron-Van Evercooren A. 2002.
Fibroblast growth factor-2 (FGF-2) and platelet-derived growth factor AB (PDGF AB)
promote adult SVZ-derived oligodendrogenesis in vivo. Mol Cell Neurosci 20(3):390403.
Lachapelle F, Gumpel M, Baulac M, Jacque C, Duc P, Baumann N. 1983. Transplantation of
CNS fragments into the brain of shiverer mutant mice: extensive myelination by
implanted oligodendrocytes. I. Immunohistochemical studies. Dev Neurosci 6(6):325334.
Lachapelle F, Gumpel M, Baumann N. 1994. Contribution of transplantations to the
understanding of the role of the PLP gene. Neurochem Res 19(8):1083-1090.
Lachapelle F, Lapie P, Campagnoni AT, Gumpel M. 1991. Oligodendrocytes of the jimpy
phenotype can be partially restored by environmental factors in vivo. J Neurosci Res
29(2):235-243.
Lachapelle F, Lapie P, Gumpel M. 1992. Oligodendrocytes from jimpy and normal mature
tissue can be 'activated' when transplanted in a newborn environment. Dev Neurosci
14(2):105-113.
Lagumdzija A, Bucht E, Stark A, Hulting AL, Petersson M. 2004. Arg-vasopressin increases
proliferation of human osteoblast-like cells and decreases production of interleukin-6
and macrophage colony-stimulating factor. Regul Pept. 121(1-3):41-8.
Laitinen L. 1987. Griffonia simplicifolia lectins bind specifically to endothelial cells and
some epithelial cells in mouse tissues. Histochem J 19(4):225-234.
113
Landry CF, Ivy GO, Dunn RJ, Marks A, Brown IR. 1989. Expression of the gene encoding
the beta-subunit of S-100 protein in the developing rat brain analyzed by in situ
hybridization. Brain Res Mol Brain Res 6(4):251-262.
Lazarov O, Robinson J, Tang YP, Hairston IS, Korade-Mirnics Z, Lee VM, Hersh LB,
Sapolsky RM, Mirnics K, Sisodia SS. 2005. Environmental enrichment reduces Abeta
levels and amyloid deposition in transgenic mice. Cell 120(5):701-713.
Lazzarini RA. 2004. Myelin Biology and Disorders: Elsevier Academic Press.
Le Bras B, Barallobre MJ, Homman-Ludiye J, Ny A, Wyns S, Tammela T, Haiko P,
Karkkainen MJ, Yuan L, Muriel MP, Chatzopoulou E, Breant C, Zalc B, Carmeliet P,
Alitalo K, Eichmann A, Thomas JL. 2006. VEGF-C is a trophic factor for neural
progenitors in the vertebrate embryonic brain. Nat Neurosci 9(3):340-348.
Le Bras B, Chatzopoulou E, Heydon K, Martinez S, Ikenaka K, Prestoz L, Spassky N, Zalc B,
Thomas JL. 2005. Oligodendrocyte development in the embryonic brain: the
contribution of the plp lineage. Int J Dev Biol 49(2-3):209-220.
Lee JC, Mayer-Proschel M, Rao MS. 2000. Gliogenesis in the central nervous system. Glia
30(2):105-121.
Lendahl U, Zimmerman LB, McKay RD. 1990. CNS stem cells express a new class of
intermediate filament protein. Cell 60(4):585-595.
Leng G, Shibuki K. 1987. Extracellular potassium changes in the rat neurohypophysis during
activation of the magnocellular neurosecretory system. J Physiol 392:97-111.
Levine JM. 1994. Increased expression of the NG2 chondroitin-sulfate proteoglycan after
brain injury. J Neurosci 14(8):4716-4730.
Levine JM, Card JP. 1987. Light and electron microscopic localization of a cell surface
antigen (NG2) in the rat cerebellum: association with smooth protoplasmic astrocytes.
J Neurosci 7(9):2711-2720.
Levine JM, Reynolds R. 1999. Activation and proliferation of endogenous oligodendrocyte
precursor cells during ethidium bromide-induced demyelination. Exp Neurol
160(2):333-347.
Levine JM, Reynolds R, Fawcett JW. 2001. The oligodendrocyte precursor cell in health and
disease. Trends Neurosci 24(1):39-47.
Levine JM, Stincone F, Lee YS. 1993. Development and differentiation of glial precursor
cells in the rat cerebellum. Glia 7(4):307-321.
Levison SW, Chuang C, Abramson BJ, Goldman JE. 1993. The migrational patterns and
developmental fates of glial precursors in the rat subventricular zone are temporally
regulated. Development 119(3):611-622.
Levison SW, Goldman JE. 1993. Both oligodendrocytes and astrocytes develop from
progenitors in the subventricular zone of postnatal rat forebrain. Neuron 10(2):201212.
114
Levison SW, Goldman JE. 1997. Multipotential and lineage restricted precursors coexist in
the mammalian perinatal subventricular zone. J Neurosci Res 48(2):83-94.
Levison SW, Young GM, Goldman JE. 1999. Cycling cells in the adult rat neocortex
preferentially generate oligodendroglia. J Neurosci Res 57(4):435-446.
Levitt P, Rakic P. 1980. Immunoperoxidase localization of glial fibrillary acidic protein in
radial glial cells and astrocytes of the developing rhesus monkey brain. J Comp Neurol
193(3):815-840.
Lie DC, Dziewczapolski G, Willhoite AR, Kaspar BK, Shults CW, Gage FH. 2002. The adult
substantia nigra contains progenitor cells with neurogenic potential. J Neurosci
22(15):6639-6649.
Lie DC, Song H, Colamarino SA, Ming GL, Gage FH. 2004. Neurogenesis in the adult brain:
new strategies for central nervous system diseases. Annu Rev Pharmacol Toxicol
44:399-421.
Ligon KL, Alberta JA, Kho AT, Weiss J, Kwaan MR, Nutt CL, Louis DN, Stiles CD,
Rowitch DH. 2004. The oligodendroglial lineage marker OLIG2 is universally
expressed in diffuse gliomas. J Neuropathol Exp Neurol 63(5):499-509.
Ligon KL, Kesari S, Kitada M, Sun T, Arnett HA, Alberta JA, Anderson DJ, Stiles CD,
Rowitch DH. 2006. Development of NG2 neural progenitor cells requires Olig gene
function. Proc Natl Acad Sci U S A 103(20):7853-7858.
Lillien LE, Raff MC. 1990. Analysis of the cell-cell interactions that control type-2 astrocyte
development in vitro. Neuron 4(4):525-534.
Lim DA, Fishell GJ, Alvarez-Buylla A. 1997. Postnatal mouse subventricular zone neuronal
precursors can migrate and differentiate within multiple levels of the developing
neuraxis. Proc Natl Acad Sci U S A 94(26):14832-14836.
Lim DA, Flames N, Collado L, Herrera DG. 2002. Investigating the use of primary adult
subventricular zone neural precursor cells for neuronal replacement therapies. Brain
Res Bull 57(6):759-764.
Lin RC, Polsky K, Matesic DF. 1993. Expression of gamma-aminobutyric acid
immunoreactivity in reactive astrocytes after ischemia-induced injury in the adult
forebrain. Brain Res 600(1):1-8.
Lin SC, Bergles DE. 2002. Physiological characteristics of NG2-expressing glial cells. J
Neurocytol 31(6-7):537-549.
Lin SC, Bergles DE. 2004. Synaptic signaling between GABAergic interneurons and
oligodendrocyte precursor cells in the hippocampus. Nat Neurosci 7(1):24-32.
Lin SC, Huck JH, Roberts JD, Macklin WB, Somogyi P, Bergles DE. 2005. Climbing fiber
innervation of NG2-expressing glia in the mammalian cerebellum. Neuron 46(5):773785.
115
Lindvall O, Kokaia Z. 2006. Stem cells for the treatment of neurological disorders. Nature
441(7097):1094-1096.
Lindvall O, Kokaia Z, Martinez-Serrano A. 2004. Stem cell therapy for human
neurodegenerative disorders-how to make it work. Nat Med 10 Suppl:S42-50.
Ling EA, Kaur LC, Yick TY, Wong WC. 1990. Immunocytochemical localization of CR3
complement receptors with OX-42 in amoeboid microglia in postnatal rats. Anat
Embryol (Berl) 182(5):481-486.
Liu Y, Han SS, Wu Y, Tuohy TM, Xue H, Cai J, Back SA, Sherman LS, Fischer I, Rao MS.
2004. CD44 expression identifies astrocyte-restricted precursor cells. Dev Biol
276(1):31-46.
Liu Y, Rao MS. 2004. Glial progenitors in the CNS and possible lineage relationships among
them. Biol Cell 96(4):279-290.
Liu Y, Wu Y, Lee JC, Xue H, Pevny LH, Kaprielian Z, Rao MS. 2002. Oligodendrocyte and
astrocyte development in rodents: an in situ and immunohistological analysis during
embryonic development. Glia 40(1):25-43.
Liu Z, Martin LJ. 2003. Olfactory bulb core is a rich source of neural progenitor and stem
cells in adult rodent and human. J Comp Neurol 459(4):368-391.
Livingston A. 1976. Pituicytes in normal and jimpy mice. Cell Tissue Res 167(1):111-116.
Lledo PM, Alonso M, Grubb MS. 2006. Adult neurogenesis and functional plasticity in
neuronal circuits. Nat Rev Neurosci 7(3):179-193.
Lois C, Alvarez-Buylla A. 1993. Proliferating subventricular zone cells in the adult
mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci U S
A 90(5):2074-2077.
Lois C, Alvarez-Buylla A. 1994. Long-distance neuronal migration in the adult mammalian
brain. Science 264(5162):1145-1148.
Lu QR, Park JK, Noll E, Chan JA, Alberta J, Yuk D, Alzamora MG, Louis DN, Stiles CD,
Rowitch DH, Black PM. 2001. Oligodendrocyte lineage genes (OLIG) as molecular
markers for human glial brain tumors. Proc Natl Acad Sci U S A 98(19):10851-10856.
Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH. 2002. Common
developmental
requirement
for
Olig
function
indicates
a
motor
neuron/oligodendrocyte connection. Cell 109(1):75-86.
Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP, Stiles CD, Rowitch
DH. 2000. Sonic hedgehog--regulated oligodendrocyte lineage genes encoding bHLH
proteins in the mammalian central nervous system. Neuron 25(2):317-329.
Lubetzki C, Goujet-Zalc C, Gansmuller A, Monge M, Brillat A, Zalc B. 1991. Morphological,
biochemical, and functional characterization of bulk isolated glial progenitor cells. J
Neurochem. 56(2):671-80.
116
Luskin MB. 1993. Restricted proliferation and migration of postnatally generated neurons
derived from the forebrain subventricular zone. Neuron 11(1):173-189.
Ma DK, Ming GL, Song H. 2005. Glial influences on neural stem cell development: cellular
niches for adult neurogenesis. Curr Opin Neurobiol 15(5):514-520.
Mabie PC, Mehler MF, Marmur R, Papavasiliou A, Song Q, Kessler JA. 1997. Bone
morphogenetic proteins induce astroglial differentiation of oligodendroglial-astroglial
progenitor cells. J Neurosci 17(11):4112-4120.
Malatesta P, Hartfuss E, Gotz M. 2000. Isolation of radial glial cells by fluorescent-activated
cell sorting reveals a neuronal lineage. Development 127(24):5253-5263.
Mallon BS, Shick HE, Kidd GJ, Macklin WB. 2002. Proteolipid promoter activity
distinguishes two populations of NG2-positive cells throughout neonatal cortical
development. J Neurosci 22(3):876-885.
Mander TH, Morris JF. 1994. Perivascular microglia in the rat neural lobe engulf
magnocellular secretory terminals during osmotic stimulation. Neurosci Lett
180(2):235-238.
Mander TH, Morris JF. 1996. Development of microglia and macrophages in the postnatal rat
pituitary. Cell Tissue Res 286(3):347-355.
Mao L, Wang JQ. 2001. Gliogenesis in the striatum of the adult rat: alteration in neural
progenitor population after psychostimulant exposure. Brain Res Dev Brain Res
130(1):41-51.
Mao X, Fujiwara Y, Chapdelaine A, Yang H, Orkin SH. 2001. Activation of EGFP
expression by Cre-mediated excision in a new ROSA26 reporter mouse strain. Blood
97(1):324-326.
Marie Y, Sanson M, Mokhtari K, Leuraud P, Kujas M, Delattre JY, Poirier J, Zalc B, HoangXuan K. 2001. OLIG2 as a specific marker of oligodendroglial tumour cells. Lancet
358(9278):298-300.
Marin F, Boya J, Lopez-Carbonell A. 1989. Immunocytochemical localization of vimentin in
the posterior lobe of the cat, rabbit and rat pituitary glands. Acta Anat 134(3):184-190.
Marshall CA, Novitch BG, Goldman JE. 2005. Olig2 directs astrocyte and oligodendrocyte
formation in postnatal subventricular zone cells. J Neurosci 25(32):7289-7298.
Marshall CA, Suzuki SO, Goldman JE. 2003. Gliogenic and neurogenic progenitors of the
subventricular zone: who are they, where did they come from, and where are they
going? Glia 43(1):52-61.
Martinez-Serrano A, Lundberg C, Horellou P, Fischer W, Bentlage C, Campbell K, McKay
RD, Mallet J, Bjorklund A. 1995. CNS-derived neural progenitor cells for gene
transfer of nerve growth factor to the adult rat brain: complete rescue of axotomized
cholinergic neurons after transplantation into the septum. J Neurosci 15(8):5668-5680.
117
Masahira N, Takebayashi H, Ono K, Watanabe K, Ding L, Furusho M, Ogawa Y, Nabeshima
Y, Alvarez-Buylla A, Shimizu K, Ikenaka K. 2006. Olig2-positive progenitors in the
embryonic spinal cord give rise not only to motoneurons and oligodendrocytes, but
also to a subset of astrocytes and ependymal cells. Dev Biol 293(2):358-369.
Matsunaga W, Miyata S, Kiyohara T. 1999. Redistribution of MAP2 immunoreactivity in the
neurohypophysial astrocytes of adult rats during dehydration. Brain Res 829(1-2):717.
Mayer-Proschel M, Kalyani AJ, Mujtaba T, Rao MS. 1997. Isolation of lineage-restricted
neuronal precursors from multipotent neuroepithelial stem cells. Neuron 19(4):773785.
McKinnon RD, Matsui T, Dubois-Dalcq M, Aaronson SA. 1990. FGF modulates the PDGFdriven pathway of oligodendrocyte development. Neuron 5(5):603-614.
McLean IW, Nakane PK. 1974. Periodate-lysine-paraformaldehyde fixative. A new fixation
for immunoelectron microscopy. J Histochem Cytochem 22(12):1077-1083.
Meissner KK, Kirkham DL, Doering LC. 2005. Transplants of neurosphere cell suspensions
from aged mice are functional in the mouse model of Parkinson's. Brain Res 1057(12):105-112.
Merkle FT, Tramontin AD, Garcia-Verdugo JM, Alvarez-Buylla A. 2004. Radial glia give
rise to adult neural stem cells in the subventricular zone. Proc Natl Acad Sci U S A
101(50):17528-17532.
Mi H, Barres BA. 1999. Purification and characterization of astrocyte precursor cells in the
developing rat optic nerve. J Neurosci 19(3):1049-1061.
Mi H, Haeberle H, Barres BA. 2001. Induction of astrocyte differentiation by endothelial
cells. J Neurosci 21(5):1538-1547.
Miller RH. 2002. Regulation of oligodendrocyte development in the vertebrate CNS. Prog
Neurobiol 67(6):451-467.
Miller RH, Dinsio K, Wang R, Geertman R, Maier CE, Hall AK. 2004. Patterning of spinal
cord oligodendrocyte development by dorsally derived BMP4. J Neurosci Res
76(1):9-19.
Ming GL, Song H. 2005. Adult neurogenesis in the mammalian central nervous system. Annu
Rev Neurosci 28:223-250.
Mishra SK, Braun N, Shukla V, Fullgrabe M, Schomerus C, Korf HW, Gachet C, Ikehara Y,
Sevigny J, Robson SC, Zimmermann H. 2006. Extracellular nucleotide signaling in
adult neural stem cells: synergism with growth factor-mediated cellular proliferation.
Development 133(4):675-684.
Misson JP, Edwards MA, Yamamoto M, Caviness VS, Jr. 1988. Identification of radial glial
cells within the developing murine central nervous system: studies based upon a new
immunohistochemical marker. Brain Res Dev Brain Res 44(1):95-108.
118
Mittler MA, Walters BC, Stopa EG. 1996. Observer reliability in histological grading of
astrocytoma stereotactic biopsies. J Neurosurg 85(6):1091-1094.
Miyachi K, Fritzler MJ, Tan EM. 1978. Autoantibody to a nuclear antigen in proliferating
cells. J Immunol 121(6):2228-2234.
Miyata S, Hatton GI. 2002. Activity-related, dynamic neuron-glial interactions in the
hypothalamo-neurohypophysial system. Microsc Res Tech 56(2):143-157.
Miyata T, Kawaguchi A, Okano H, Ogawa M. 2001. Asymmetric inheritance of radial glial
fibers by cortical neurons. Neuron 31(5):727-741.
Monroe BG, Scott DE. 1966. Ultrastructural changes in the neural lobe of the hypophysis of
the rat during lactation and suckling. J Ultrastruct Res 14(5):497-517.
Morcos Y, Chan-Ling T. 1997. Identification of oligodendrocyte precursors in the myelinated
streak of the adult rabbit retina in vivo. Glia. 21(2):163-82.
Morshead CM, Reynolds BA, Craig CG, McBurney MW, Staines WA, Morassutti D, Weiss
S, van der Kooy D. 1994. Neural stem cells in the adult mammalian forebrain: a
relatively quiescent subpopulation of subependymal cells. Neuron 13(5):1071-1082.
Mudhar HS, Pollock RA, Wang C, Stiles CD, Richardson WD. 1993. PDGF and its receptors
in the developing rodent retina and optic nerve. Development 118(2):539-552.
Muller CM. 1992. Astrocytes in cat visual cortex studied by GFAP and S-100
immunocytochemistry during postnatal development. J Comp Neurol 317(3):309-323.
Muller T, Kettenmann H. 1995. Physiology of Bergmann glial cells. Int Rev Neurobiol
38:341-359.
Mundt-Petersen U, Petersen A, Emgard M, Dunnett SB, Brundin P. 2000. Caspase inhibition
increases embryonic striatal graft survival. Exp Neurol 164(1):112-120.
Muroyama Y, Fujiwara Y, Orkin SH, Rowitch DH. 2005. Specification of astrocytes by
bHLH protein SCL in a restricted region of the neural tube. Nature 438(7066):360363.
Murugaiyan P, Salm AK. 1995. Dehydration-induced proliferation of identified pituicytes in
fully adult rats. Glia 15(1):65-76.
Nacher J, Crespo C, McEwen BS. 2001. Doublecortin expression in the adult rat
telencephalon. Eur J Neurosci 14(4):629-644.
Nait-Oumesmar B, Decker L, Lachapelle F, Avellana-Adalid V, Bachelin C, Van Evercooren
AB. 1999. Progenitor cells of the adult mouse subventricular zone proliferate, migrate
and differentiate into oligodendrocytes after demyelination. Eur J Neurosci
11(12):4357-4366.
Nakakura T, Yoshida M, Dohra H, Suzuki M, Tanaka S. 2006. Gene expression of vascular
endothelial growth factor-A in the pituitary during formation of the vascular system in
the hypothalamic-pituitary axis of the rat. Cell Tissue Res 324(1):87-95.
119
Nakashima K, Yanagisawa M, Arakawa H, Taga T. 1999. Astrocyte differentiation mediated
by LIF in cooperation with BMP2. FEBS Lett 457(1):43-46.
Nakatomi H, Kuriu T, Okabe S, Yamamoto S, Hatano O, Kawahara N, Tamura A, Kirino T,
Nakafuku M. 2002. Regeneration of hippocampal pyramidal neurons after ischemic
brain injury by recruitment of endogenous neural progenitors. Cell 110(4):429-441.
Namba T, Mochizuki H, Onodera M, Mizuno Y, Namiki H, Seki T. 2005. The fate of neural
progenitor cells expressing astrocytic and radial glial markers in the postnatal rat
dentate gyrus. Eur J Neurosci 22(8):1928-1941.
Navone F, Di Gioia G, Jahn R, Browning M, Greengard P, De Camilli P. 1989. Microvesicles
of the neurohypophysis are biochemically related to small synaptic vesicles of
presynaptic nerve terminals. J Cell Biol 109(6 Pt 2):3425-3433.
Newman EA. 2004. Glial modulation of synaptic transmission in the retina. Glia 47(3):268274.
Nilius B, Reichenbach A. 1988. Efficient K+ buffering by mammalian retinal glial cells is due
to cooperation of specialized ion channels. Pflugers Arch 411(6):654-660.
Nishiyama A, Chang A, Trapp BD. 1999. NG2+ glial cells: a novel glial cell population in the
adult brain. J Neuropathol Exp Neurol 58(11):1113-1124.
Nishiyama A, Lin XH, Giese N, Heldin CH, Stallcup WB. 1996a. Co-localization of NG2
proteoglycan and PDGF alpha-receptor on O2A progenitor cells in the developing rat
brain. J Neurosci Res 43(3):299-314.
Nishiyama A, Lin XH, Giese N, Heldin CH, Stallcup WB. 1996b. Interaction between NG2
proteoglycan and PDGF alpha-receptor on O2A progenitor cells is required for
optimal response to PDGF. J Neurosci Res 43(3):315-330.
Nishiyama A, Watanabe M, Yang Z, Bu J. 2002. Identity, distribution, and development of
polydendrocytes: NG2-expressing glial cells. J Neurocytol 31(6-7):437-455.
Nishiyama A, Yu M, Drazba JA, Tuohy VK. 1997. Normal and reactive NG2+ glial cells are
distinct from resting and activated microglia. J Neurosci Res 48(4):299-312.
Noble M, Barnett SC, Bogler O, Land H, Wolswijk G, Wren D. 1990. Control of division and
differentiation in oligodendrocyte-type-2 astrocyte progenitor cells. Ciba Found Symp
150:227-243; discussion 244-229.
Noble M, Murray K, Stroobant P, Waterfield MD, Riddle P. 1988. Platelet-derived growth
factor promotes division and motility and inhibits premature differentiation of the
oligodendrocyte/type-2 astrocyte progenitor cell. Nature 333(6173):560-562.
Noble M, Proschel C, Mayer-Proschel M. 2004. Getting a GR(i)P on oligodendrocyte
development. Dev Biol 265(1):33-52.
Noble M, Wolswijk G. 1992. Development and regeneration in the O-2A lineage: studies in
vitro and in vivo. J Neuroimmunol 40(2-3):287-293.
120
Noctor SC, Flint AC, Weissman TA, Dammerman RS, Kriegstein AR. 2001. Neurons derived
from radial glial cells establish radial units in neocortex. Nature 409(6821):714-720.
Nordmann JJ. 1977. Ultrastructural morphometry of the rat neurohypophysis. J Anat 123(Pt
1):213-218.
Nussey SS, Whitehead SA. 2001. Endocrinology : An Integrated Approach. Taylor and
Francis.
Nutt CL, Noble M, Chambers AF, Cairncross JG. 2000. Differential expression of drug
resistance genes and chemosensitivity in glial cell lineages correlate with differential
response of oligodendrogliomas and astrocytomas to chemotherapy. Cancer Res
60(17):4812-4818.
Ochi S, Lim JY, Rand MN, During MJ, Sakatani K, Kocsis JD. 1993. Transient presence of
GABA in astrocytes of the developing optic nerve. Glia 9(3):188-198.
Ochoa AL, Mitchner NA, Paynter CD, Morris RE, Ben-Jonathan N. 2000. Vascular
endothelial growth factor in the rat pituitary: differential distribution and regulation by
estrogen. J Endocrinol 165(2):483-492.
Ohnishi A, Sawa H, Tsuda M, Sawamura Y, Itoh T, Iwasaki Y, Nagashima K. 2003.
Expression of the oligodendroglial lineage-associated markers Olig1 and Olig2 in
different types of human gliomas. J Neuropathol Exp Neurol 62(10):1052-1059.
Olivieri-Sangiacomo C. 1972. On the fine structure of the perivascular cells in the neural lobe
of rats. Z Zellforsch Mikrosk Anat 132(1):25-34.
Olivieri-Sangiacomo C. 1973. Ultrastructural features of pituicytes in the neural lobe of adult
rats. The peripheral processes. Experientia 29(12):1536-1537.
Ong WY, Levine JM. 1999. A light and electron microscopic study of NG2 chondroitin
sulfate proteoglycan-positive oligodendrocyte precursor cells in the normal and
kainate-lesioned rat hippocampus. Neuroscience 92(1):83-95.
Ono K, Yasui Y, Rutishauser U, Miller RH. 1997. Focal ventricular origin and migration of
oligodendrocyte precursors into the chick optic nerve. Neuron 19(2):283-292.
Orentas DM, Hayes JE, Dyer KL, Miller RH. 1999. Sonic hedgehog signaling is required
during the appearance of spinal cord oligodendrocyte precursors. Development
126(11):2419-2429.
Oumesmar BN, Vignais L, Baron-Van Evercooren A. 1997. Developmental expression of
platelet-derived growth factor alpha-receptor in neurons and glial cells of the mouse
CNS. J Neurosci 17(1):125-139.
Palmer TD, Markakis EA, Willhoite AR, Safar F, Gage FH. 1999. Fibroblast growth factor-2
activates a latent neurogenic program in neural stem cells from diverse regions of the
adult CNS. J Neurosci 19(19):8487-8497.
121
Palmer TD, Ray J, Gage FH. 1995. FGF-2-responsive neuronal progenitors reside in
proliferative and quiescent regions of the adult rodent brain. Mol Cell Neurosci
6(5):474-486.
Paterson JA, Leblond CP. 1977. Increased proliferation of neuroglia and endothelial cells in
the supraoptic nucleus and hypophysial neural lobe of young rats drinking hypertonic
sodium chloride solution. J Comp Neurol 175(4):373-390.
Paxinos G, Franklin KBJ. 2001. The mouse brain in stereotaxic coordinates. Academic press.
Pekny M, Nilsson M. 2005. Astrocyte activation and reactive gliosis. Glia 50(4):427-434.
Perez Villegas EM, Olivier C, Spassky N, Poncet C, Cochard P, Zalc B, Thomas JL, Martinez
S. 1999. Early specification of oligodendrocytes in the chick embryonic brain. Dev
Biol. 216(1):98-113.
Peters A. 2004. A fourth type of neuroglial cell in the adult central nervous system. J
Neurocytol 33(3):345-357.
Peterson RE, Fadool JM, McClintock J, Linser PJ. 2001. Muller cell differentiation in the
zebrafish neural retina: evidence of distinct early and late stages in cell maturation. J
Comp Neurol 429(4):530-540.
Petratos S, Gonzales MF, Azari MF, Marriott M, Minichiello RA, Shipham KA, Profyris C,
Nicolaou A, Boyle K, Cheema SS, Kilpatrick TJ. 2004. Expression of the low-affinity
neurotrophin receptor, p75(NTR), is upregulated by oligodendroglial progenitors
adjacent to the subventricular zone in response to demyelination. Glia 48(1):64-75.
Peyron F, Timsit S, Thomas JL, Kagawa T, Ikenaka K, Zalc B. 1997. In situ expression of
PLP/DM-20, MBP, and CNP during embryonic and postnatal development of the
jimpy mutant and of transgenic mice overexpressing PLP. J Neurosci Res 50(2):190201.
Pham TM, Ickes B, Albeck D, Soderstrom S, Granholm AC, Mohammed AH. 1999. Changes
in brain nerve growth factor levels and nerve growth factor receptors in rats exposed
to environmental enrichment for one year. Neuroscience 94(1):279-286.
Picard-Riera N, Decker L, Delarasse C, Goude K, Nait-Oumesmar B, Liblau R, Pham-Dinh
D, Evercooren AB. 2002. Experimental autoimmune encephalomyelitis mobilizes
neural progenitors from the subventricular zone to undergo oligodendrogenesis in
adult mice. Proc Natl Acad Sci U S A 99(20):13211-13216.
Pluchino S, Quattrini A, Brambilla E, Gritti A, Salani G, Dina G, Galli R, Del Carro U,
Amadio S, Bergami A, Furlan R, Comi G, Vescovi AL, Martino G. 2003. Injection of
adult neurospheres induces recovery in a chronic model of multiple sclerosis. Nature
422(6933):688-694.
Polito A, Reynolds R. 2005. NG2-expressing cells as oligodendrocyte progenitors in the
normal and demyelinated adult central nervous system. J Anat 207(6):707-716.
122
Popko B, Pearl DK, Walker DM, Comas TC, Baerwald KD, Burger PC, Scheithauer BW,
Yates AJ. 2002. Molecular markers that identify human astrocytomas and
oligodendrogliomas. J Neuropathol Exp Neurol 61(4):329-338.
Pow DV, Perry VH, Morris JF, Gordon S. 1989. Microglia in the neurohypophysis associate
with and endocytose terminal portions of neurosecretory neurons. Neuroscience
33(3):567-578.
Prat A, Biernacki K, Wosik K, Antel JP. 2001. Glial cell influence on the human blood-brain
barrier. Glia 36(2):145-155.
Pringle NP, Mudhar HS, Collarini EJ, Richardson WD. 1992. PDGF receptors in the rat CNS:
during late neurogenesis, PDGF alpha-receptor expression appears to be restricted to
glial cells of the oligodendrocyte lineage. Development 115(2):535-551.
Pringle NP, Richardson WD. 1993. A singularity of PDGF alpha-receptor expression in the
dorsoventral axis of the neural tube may define the origin of the oligodendrocyte
lineage. Development 117(2):525-533.
Pringle NP, Yu WP, Guthrie S, Roelink H, Lumsden A, Peterson AC, Richardson WD. 1996.
Determination of neuroepithelial cell fate: induction of the oligodendrocyte lineage by
ventral midline cells and sonic hedgehog. Dev Biol 177(1):30-42.
Pringle NP, Yu WP, Howell M, Colvin JS, Ornitz DM, Richardson WD. 2003. Fgfr3
expression by astrocytes and their precursors: evidence that astrocytes and
oligodendrocytes originate in distinct neuroepithelial domains. Development
130(1):93-102.
Qi Y, Cai J, Wu Y, Wu R, Lee J, Fu H, Rao M, Sussel L, Rubenstein J, Qiu M. 2001. Control
of oligodendrocyte differentiation by the Nkx2.2 homeodomain transcription factor.
Development 128(14):2723-2733.
Quinones-Hinojosa A, Sanai N, Soriano-Navarro M, Gonzalez-Perez O, Mirzadeh Z, GilPerotin S, Romero-Rodriguez R, Berger MS, Garcia-Verdugo JM, Alvarez-Buylla A.
2006. Cellular composition and cytoarchitecture of the adult human subventricular
zone: a niche of neural stem cells. J Comp Neurol 494(3):415-434.
Raff MC, Abney ER, Cohen J, Lindsay R, Noble M. 1983a. Two types of astrocytes in
cultures of developing rat white matter: differences in morphology, surface
gangliosides, and growth characteristics. J Neurosci 3(6):1289-1300.
Raff MC, Miller RH, Noble M. 1983b. A glial progenitor cell that develops in vitro into an
astrocyte or an oligodendrocyte depending on culture medium. Nature 303(5916):390396.
Raff MC, Williams BP, Miller RH. 1984. The in vitro differentiation of a bipotential glial
progenitor cell. Embo J 3(8):1857-1864.
Raine CS. 1999. Part One. Cellular Neurochemistry and Neural Membranes Ch. 1.
Neurocellular Anatomy. In: American Society for Neurochemistry, éditeur. Basic
Neurochemistry ; Molecular, Cellular and Medical Aspects. 6e édition. Lippincott
Williams and Wilkins.
123
Rakic P. 1972. Mode of cell migration to the superficial layers of fetal monkey neocortex. J
Comp Neurol 145(1):61-83.
Rakic P. 2002. Neurogenesis in adult primate neocortex: an evaluation of the evidence. Nat
Rev Neurosci 3(1):65-71.
Ranscht B, Clapshaw PA, Price J, Noble M, Seifert W. 1982. Development of
oligodendrocytes and Schwann cells studied with a monoclonal antibody against
galactocerebroside. Proc Natl Acad Sci U S A 79(8):2709-2713.
Rao M. 2004a. Ch. 9. Neural Cell Specification during Development. In: Lazzarini RA,
éditeur. Myelin Biology and Disorders. Elsevier Academic Press.
Rao M. 2004b. Stem and precursor cells in the nervous system. J Neurotrauma 21(4):415-427.
Rao MS, Mayer-Proschel M. 1997. Glial-restricted precursors are derived from multipotent
neuroepithelial stem cells. Dev Biol 188(1):48-63.
Rao MS, Noble M, Mayer-Proschel M. 1998. A tripotential glial precursor cell is present in
the developing spinal cord. Proc Natl Acad Sci U S A 95(7):3996-4001.
Recklies AD, White C, Ling H. 2002. The chitinase 3-like protein human cartilage
glycoprotein 39 (HC-gp39) stimulates proliferation of human connective-tissue cells
and activates both extracellular signal-regulated kinase- and protein kinase Bmediated signalling pathways. Biochem J 365(Pt 1):119-126.
Redwine JM, Armstrong RC. 1998. In vivo proliferation of oligodendrocyte progenitors
expressing PDGFalphaR during early remyelination. J Neurobiol 37(3):413-428.
Redwine JM, Blinder KL, Armstrong RC. 1997. In situ expression of fibroblast growth factor
receptors by oligodendrocyte progenitors and oligodendrocytes in adult mouse central
nervous system. J Neurosci Res 50(2):229-237.
Reynolds BA, Tetzlaff W, Weiss S. 1992. A multipotent EGF-responsive striatal embryonic
progenitor cell produces neurons and astrocytes. J Neurosci 12(11):4565-4574.
Reynolds BA, Weiss S. 1992. Generation of neurons and astrocytes from isolated cells of the
adult mammalian central nervous system. Science 255(5052):1707-1710.
Reynolds BA, Weiss S. 1996. Clonal and population analyses demonstrate that an EGFresponsive mammalian embryonic CNS precursor is a stem cell. Dev Biol 175(1):113.
Reynolds R, Dawson M, Papadopoulos D, Polito A, Di Bello IC, Pham-Dinh D, Levine J.
2002. The response of NG2-expressing oligodendrocyte progenitors to demyelination
in MOG-EAE and MS. J Neurocytol 31(6-7):523-536.
Reynolds R, Hardy R. 1997. Oligodendroglial progenitors labeled with the O4 antibody
persist in the adult rat cerebral cortex in vivo. J Neurosci Res 47(5):455-470.
Richards LJ, Kilpatrick TJ, Bartlett PF. 1992. De novo generation of neuronal cells from the
adult mouse brain. Proc Natl Acad Sci U S A 89(18):8591-8595.
124
Richardson WD, Kessaris N, Pringle N. 2006. Oligodendrocyte wars. Nat Rev Neurosci
7(1):11-18.
Richardson WD, Pringle N, Mosley MJ, Westermark B, Dubois-Dalcq M. 1988. A role for
platelet-derived growth factor in normal gliogenesis in the central nervous system.
Cell 53(2):309-319.
Richardson WD, Pringle NP, Yu WP, Hall AC. 1997. Origins of spinal cord
oligodendrocytes: possible developmental and evolutionary relationships with motor
neurons. Dev Neurosci 19(1):58-68.
Richardson WD, Smith HK, Sun T, Pringle NP, Hall A, Woodruff R. 2000. Oligodendrocyte
lineage and the motor neuron connection. Glia 29(2):136-142.
Riemenschneider MJ, Koy TH, Reifenberger G. 2004. Expression of oligodendrocyte lineage
genes in oligodendroglial and astrocytic gliomas. Acta Neuropathol (Berl) 107(3):277282.
Rietze R, Poulin P, Weiss S. 2000. Mitotically active cells that generate neurons and
astrocytes are present in multiple regions of the adult mouse hippocampus. J Comp
Neurol 424(3):397-408.
Robinson AP, White TM, Mason DW. 1986. Macrophage heterogeneity in the rat as
delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42, the latter
recognizing complement receptor type 3. Immunology 57(2):239-247.
Rodriguez EM, Blazquez JL, Pastor FE, Pelaez B, Pena P, Peruzzo B, Amat P. 2005.
Hypothalamic tanycytes: a key component of brain-endocrine interaction. Int Rev
Cytol 247:89-164.
Rodriguez-Pena A. 1999. Oligodendrocyte development and thyroid hormone. J Neurobiol
40(4):497-512.
Rorke LB. 1983. The cerebellar medulloblastoma and its relationship to primitive
neuroectodermal tumors. J Neuropathol Exp Neurol 42(1):1-15.
Rosso L, Peteri-Brunback B, Vouret-Craviari V, Deroanne C, Troadec JD, Thirion S, Van
Obberghen-Schilling E, Mienville JM. 2002a. RhoA inhibition is a key step in
pituicyte stellation induced by A(1)-type adenosine receptor activation. Glia
38(4):351-62.
Rosso L, Peteri-Brunback B, Vouret-Craviari V, Deroanne C, Van Obberghen-Schilling E,
Mienville JM. 2002b. Vasopressin and oxytocin reverse adenosine-induced pituicyte
stellation via calcium-dependent activation of Cdc42. Eur J Neurosci. 16(12):2324-32.
Rothstein JD, Martin L, Levey AI, Dykes-Hoberg M, Jin L, Wu D, Nash N, Kuncl RW. 1994.
Localization of neuronal and glial glutamate transporters. Neuron 13(3):713-725.
Rousselot P, Lois C, Alvarez-Buylla A. 1995. Embryonic (PSA) N-CAM reveals chains of
migrating neuroblasts between the lateral ventricle and the olfactory bulb of adult
mice. J Comp Neurol 351(1):51-61.
125
Rowitch DH. 2004. Glial specification in the vertebrate neural tube. Nat Rev Neurosci
5(5):409-419.
Rowitch DH, Lu QR, Kessaris N, Richardson WD. 2002. An 'oligarchy' rules neural
development. Trends Neurosci 25(8):417-422.
Saez JC, Contreras JE, Bukauskas FF, Retamal MA, Bennett MV. 2003. Gap junction
hemichannels in astrocytes of the CNS. Acta Physiol Scand 179(1):9-22.
Salm AK, Hatton GI, Nilaver G. 1982. Immunoreactive glial fibrillary acidic protein in
pituicytes of the rat neurohypophysis. Brain Res 236(2):471-476.
Sanai N, Alvarez-Buylla A, Berger MS. 2005. Neural stem cells and the origin of gliomas. N
Engl J Med 353(8):811-822.
Sanai N, Tramontin AD, Quinones-Hinojosa A, Barbaro NM, Gupta N, Kunwar S, Lawton
MT, McDermott MW, Parsa AT, Manuel-Garcia Verdugo J, Berger MS, AlvarezBuylla A. 2004. Unique astrocyte ribbon in adult human brain contains neural stem
cells but lacks chain migration. Nature 427(6976):740-744.
Satoh J, Kim SU. 1995. Ganglioside markers GD3, GD2, and A2B5 in fetal human neurons
and glial cells in culture. Dev Neurosci 17(3):137-148.
Sauvageot CM, Stiles CD. 2002. Molecular mechanisms controlling cortical gliogenesis. Curr
Opin Neurobiol 12(3):244-249.
Sawamoto K, Wichterle H, Gonzalez-Perez O, Cholfin JA, Yamada M, Spassky N, Murcia
NS, Garcia-Verdugo JM, Marin O, Rubenstein JL, Tessier-Lavigne M, Okano H,
Alvarez-Buylla A. 2006. New neurons follow the flow of cerebrospinal fluid in the
adult brain. Science 311(5761):629-632.
Schmechel DE, Rakic P. 1979. A Golgi study of radial glial cells in developing monkey
telencephalon: morphogenesis and transformation into astrocytes. Anat Embryol
(Berl) 156(2):115-152.
Schober F, Hoheisel G. 1977. [Myelinized oxytocinergic neurosecretory fibers in the region
of the median eminence of the rat]. Gegenbaurs Morphol Jahrb 123(2):224-235.
Schonemann MD, Ryan AK, McEvilly RJ, O'Connell SM, Arias CA, Kalla KA, Li P,
Sawchenko PE, Rosenfeld MG. 1995. Development and survival of the endocrine
hypothalamus and posterior pituitary gland requires the neuronal POU domain factor
Brn-2. Genes Dev 9(24):3122-3135.
Scolding N, Franklin R, Stevens S, Heldin CH, Compston A, Newcombe J. 1998.
Oligodendrocyte progenitors are present in the normal adult human CNS and in the
lesions of multiple sclerosis. Brain 121 ( Pt 12):2221-2228.
Seidenfaden R, Desoeuvre A, Bosio A, Virard I, Cremer H. 2006. Glial conversion of SVZderived committed neuronal precursors after ectopic grafting into the adult brain. Mol
Cell Neurosci 32(1-2):187-198.
126
Seidman KJ, Teng AL, Rosenkopf R, Spilotro P, Weyhenmeyer JA. 1997. Isolation, cloning
and characterization of a putative type-1 astrocyte cell line. Brain Res 753(1):18-26.
Setoguchi T, Kondo T. 2004. Nuclear export of OLIG2 in neural stem cells is essential for
ciliary neurotrophic factor-induced astrocyte differentiation. J Cell Biol 166(7):963968.
Seyama S, Pearl GS, Takei Y. 1980. Ultrastructural study of the human neurohypophysis. III.
Vascular and perivascular structures. Cell Tissue Res 206(2):291-302.
Shaw G, Osborn M, Weber K. 1981. An immunofluorescence microscopical study of the
neurofilament triplet proteins, vimentin and glial fibrillary acidic protein within the
adult rat brain. Eur J Cell Biol 26(1):68-82.
Sheng HZ, Westphal H. 1999. Early steps in pituitary organogenesis. Trends Genet
15(6):236-240.
Shibata T, Yamada K, Watanabe M, Ikenaka K, Wada K, Tanaka K, Inoue Y. 1997.
Glutamate transporter GLAST is expressed in the radial glia-astrocyte lineage of
developing mouse spinal cord. J Neurosci 17(23):9212-9219.
Shih AH, Holland EC. 2004. Developmental neurobiology and the origin of brain tumors. J
Neurooncol 70(2):125-136.
Shihabuddin LS, Ray J, Gage FH. 1997. FGF-2 is sufficient to isolate progenitors found in the
adult mammalian spinal cord. Exp Neurol 148(2):577-586.
Shinojima N, Tada K, Shiraishi S, Kamiryo T, Kochi M, Nakamura H, Makino K, Saya H,
Hirano H, Kuratsu J, Oka K, Ishimaru Y, Ushio Y. 2003. Prognostic value of
epidermal growth factor receptor in patients with glioblastoma multiforme. Cancer
Res 63(20):6962-6970.
Shoshan Y, Nishiyama A, Chang A, Mork S, Barnett GH, Cowell JK, Trapp BD, Staugaitis
SM. 1999. Expression of oligodendrocyte progenitor cell antigens by gliomas:
implications for the histogenesis of brain tumors. Proc Natl Acad Sci U S A
96(18):10361-10366.
Sievers J, Pehlemann FW, Gude S, Hartmann D, Berry M. 1994. The development of the
radial glial scaffold of the cerebellar cortex from GFAP-positive cells in the external
granular layer. J Neurocytol 23(2):97-115.
Silbernagl S, Despopoulos A. 1997. Atlas de Physiologie. Doin.
Silver R, Silverman AJ, Vitkovic L, Lederhendler, II. 1996. Mast cells in the brain: evidence
and functional significance. Trends Neurosci 19(1):25-31.
Silverman AJ, Zimmerman EA. 1983. Magnocellular neurosecretory system. Annu Rev
Neurosci 6:357-380.
Simard M, Arcuino G, Takano T, Liu QS, Nedergaard M. 2003. Signaling at the gliovascular
interface. J Neurosci 23(27):9254-9262.
127
Simard M, Nedergaard M. 2004. The neurobiology of glia in the context of water and ion
homeostasis. Neuroscience 129(4):877-896.
Singh SK, Clarke ID, Hide T, Dirks PB. 2004a. Cancer stem cells in nervous system tumors.
Oncogene 23(43):7267-7273.
Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, Dirks PB. 2003.
Identification of a cancer stem cell in human brain tumors. Cancer Res 63(18):58215828.
Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano
MD, Dirks PB. 2004b. Identification of human brain tumour initiating cells. Nature
432(7015):396-401.
Skoff RP. 1990. Gliogenesis in rat optic nerve: astrocytes are generated in a single wave
before oligodendrocytes. Dev Biol 139(1):149-168.
Small RK, Riddle P, Noble M. 1987. Evidence for migration of oligodendrocyte--type-2
astrocyte progenitor cells into the developing rat optic nerve. Nature 328(6126):155157.
Soares S, Sotelo C. 2004. Adult neural stem cells from the mouse subventricular zone are
limited in migratory ability compared to progenitor cells of similar origin.
Neuroscience 128(4):807-817.
Sommer I, Schachner M. 1981. Monoclonal antibodies (O1 to O4) to oligodendrocyte cell
surfaces: an immunocytological study in the central nervous system. Dev Biol
83(2):311-327.
Soriano P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat
Genet 21(1):70-71.
Spassky N, de Castro F, Le Bras B, Heydon K, Queraud-LeSaux F, Bloch-Gallego E,
Chedotal A, Zalc B, Thomas JL. 2002. Directional guidance of oligodendroglial
migration by class 3 semaphorins and netrin-1. J Neurosci 22(14):5992-6004.
Spassky N, Goujet-Zalc C, Parmantier E, Olivier C, Martinez S, Ivanova A, Ikenaka K,
Macklin W, Cerruti I, Zalc B, Thomas JL. 1998. Multiple restricted origin of
oligodendrocytes. J Neurosci 18(20):8331-8343.
Spassky N, Merkle FT, Flames N, Tramontin AD, Garcia-Verdugo JM, Alvarez-Buylla A.
2005. Adult ependymal cells are postmitotic and are derived from radial glial cells
during embryogenesis. J Neurosci 25(1):10-18.
Spassky N, Olivier C, Cobos I, LeBras B, Goujet-Zalc C, Martinez S, Zalc B, Thomas JL.
2001. The early steps of oligodendrogenesis: insights from the study of the plp lineage
in the brain of chicks and rodents. Dev Neurosci 23(4-5):318-326.
Spassky N, Olivier C, Perez-Villegas E, Goujet-Zalc C, Martinez S, Thomas J, Zalc B. 2000.
Single or multiple oligodendroglial lineages: a controversy. Glia 29(2):143-148.
128
Staugaitis SM, Zerlin M, Hawkes R, Levine JM, Goldman JE. 2001. Aldolase C/zebrin II
expression in the neonatal rat forebrain reveals cellular heterogeneity within the
subventricular zone and early astrocyte differentiation. J Neurosci 21(16):6195-6205.
Steiner B, Kronenberg G, Jessberger S, Brandt MD, Reuter K, Kempermann G. 2004.
Differential regulation of gliogenesis in the context of adult hippocampal neurogenesis
in mice. Glia 46(1):41-52.
Stenman J, Toresson H, Campbell K. 2003. Identification of two distinct progenitor
populations in the lateral ganglionic eminence: implications for striatal and olfactory
bulb neurogenesis. J Neurosci 23(1):167-174.
Stephenson DA, Mercola M, Anderson E, Wang CY, Stiles CD, Bowen-Pope DF, Chapman
VM. 1991. Platelet-derived growth factor receptor alpha-subunit gene (Pdgfra) is
deleted in the mouse patch (Ph) mutation. Proc Natl Acad Sci U S A 88(1):6-10.
Stevens B, Porta S, Haak LL, Gallo V, Fields RD. 2002. Adenosine: a neuron-glial transmitter
promoting myelination in the CNS in response to action potentials. Neuron 36(5):855868.
Stoeckel ME, Hindelang-Gertner C, Dellmann HD, Porte A, Stutinsky F. 1975. Subcellular
localization of calcium in the mouse hypophysis. I. Calcium distribution in the adenoand neurohypophysis under normal conditions. Cell Tissue Res 157(3):307-322.
Stolt CC, Lommes P, Sock E, Chaboissier MC, Schedl A, Wegner M. 2003. The Sox9
transcription factor determines glial fate choice in the developing spinal cord. Genes
Dev 17(13):1677-1689.
Stolt CC, Rehberg S, Ader M, Lommes P, Riethmacher D, Schachner M, Bartsch U, Wegner
M. 2002. Terminal differentiation of myelin-forming oligodendrocytes depends on the
transcription factor Sox10. Genes Dev 16(2):165-170.
Streit WJ. 2000. Microglial response to brain injury: a brief synopsis. Toxicol Pathol
28(1):28-30.
Streit WJ. 2001. Microglia and macrophages in the developing CNS. Neurotoxicology
22(5):619-624.
Streit WJ, Kreutzberg GW. 1987. Lectin binding by resting and reactive microglia. J
Neurocytol 16(2):249-260.
Sugimoto Y, Taniguchi M, Yagi T, Akagi Y, Nojyo Y, Tamamaki N. 2001. Guidance of glial
precursor cell migration by secreted cues in the developing optic nerve. Development
128(17):3321-3330.
Sun T, Echelard Y, Lu R, Yuk DI, Kaing S, Stiles CD, Rowitch DH. 2001. Olig bHLH
proteins interact with homeodomain proteins to regulate cell fate acquisition in
progenitors of the ventral neural tube. Curr Biol 11(18):1413-1420.
Sussel L, Kalamaras J, Hartigan-O'Connor DJ, Meneses JJ, Pedersen RA, Rubenstein JL,
German MS. 1998. Mice lacking the homeodomain transcription factor Nkx2.2 have
129
diabetes due to arrested differentiation of pancreatic beta cells. Development
125(12):2213-2221.
Suzuki SO, Goldman JE. 2003. Multiple cell populations in the early postnatal subventricular
zone take distinct migratory pathways: a dynamic study of glial and neuronal
progenitor migration. J Neurosci 23(10):4240-4250.
Takebayashi H, Nabeshima Y, Yoshida S, Chisaka O, Ikenaka K. 2002. The basic helix-loophelix factor olig2 is essential for the development of motoneuron and oligodendrocyte
lineages. Curr Biol 12(13):1157-1163.
Takebayashi H, Yoshida S, Sugimori M, Kosako H, Kominami R, Nakafuku M, Nabeshima
Y. 2000. Dynamic expression of basic helix-loop-helix Olig family members:
implication of Olig2 in neuron and oligodendrocyte differentiation and identification
of a new member, Olig3. Mech Dev 99(1-2):143-148.
Takei Y, Seyama S, Pearl GS, Tindall GT. 1980. Ultrastructural study of the human
neurohypophysis. II. Cellular elements of neural parenchyma, the pituicytes. Cell
Tissue Res 205(2):273-287.
Temple S. 2001. Stem cell plasticity--building the brain of our dreams. Nat Rev Neurosci
2(7):513-520.
Temple S, Raff MC. 1985. Differentiation of a bipotential glial progenitor cell in a single cell
microculture. Nature 313(5999):223-225.
Temple S, Raff MC. 1986. Clonal analysis of oligodendrocyte development in culture:
evidence for a developmental clock that counts cell divisions. Cell 44(5):773-779.
Theodosis DT. 2002. Oxytocin-secreting neurons: A physiological model of morphological
neuronal and glial plasticity in the adult hypothalamus. Front Neuroendocrinol
23(1):101-135.
Theodosis DT, Bonhomme R, Vitiello S, Rougon G, Poulain DA. 1999. Cell surface
expression of polysialic acid on NCAM is a prerequisite for activity-dependent
morphological neuronal and glial plasticity. J Neurosci 19(23):10228-10236.
Theodosis DT, El Majdoubi M, Pierre K, Poulain DA. 1998. Factors governing activitydependent structural plasticity of the hypothalamoneurohypophysial system. Cell Mol
Neurobiol 18(2):285-298.
Theodosis DT, Rougon G, Poulain DA. 1991. Retention of embryonic features by an adult
neuronal system capable of plasticity: polysialylated neural cell adhesion molecule in
the hypothalamo-neurohypophysial system. Proc Natl Acad Sci U S A 88(13):54945498.
Thibonnier M, Conarty DM, Plesnicher CL. 2000. Mediators of the mitogenic action of
human V(1) vascular vasopressin receptors. Am J Physiol Heart Circ Physiol.
279(5):H2529-39.
130
Thomas JL, Spassky N, Perez Villegas EM, Olivier C, Cobos I, Goujet-Zalc C, Martinez S,
Zalc B. 2000. Spatiotemporal development of oligodendrocytes in the embryonic
brain. J Neurosci Res 59(4):471-476.
Timsit S, Martinez S, Allinquant B, Peyron F, Puelles L, Zalc B. 1995. Oligodendrocytes
originate in a restricted zone of the embryonic ventral neural tube defined by DM-20
mRNA expression. J Neurosci 15(2):1012-1024.
Tiveron MC, Hirsch MR, Brunet JF. 1996. The expression pattern of the transcription factor
Phox2 delineates synaptic pathways of the autonomic nervous system. J Neurosci
16(23):7649-7660.
Tohyama T, Lee VM, Rorke LB, Marvin M, McKay RD, Trojanowski JQ. 1992. Nestin
expression in embryonic human neuroepithelium and in human neuroepithelial tumor
cells. Lab Invest 66(3):303-313.
Torregrossa P, Buhl L, Bancila M, Durbec P, Schafer C, Schachner M, Rougon G. 2004.
Selection of poly-alpha 2,8-sialic acid mimotopes from a random phage peptide
library and analysis of their bioactivity. J Biol Chem 279(29):30707-30714.
Treier M, Rosenfeld MG. 1996. The hypothalamic-pituitary axis: co-development of two
organs. Curr Opin Cell Biol 8(6):833-843.
Triaca V, Tirassa P, Aloe L. 2005. Presence of nerve growth factor and TrkA expression in
the SVZ of EAE rats: evidence for a possible functional significance. Exp Neurol
191(1):53-64.
Tropepe V, Sibilia M, Ciruna BG, Rossant J, Wagner EF, van der Kooy D. 1999. Distinct
neural stem cells proliferate in response to EGF and FGF in the developing mouse
telencephalon. Dev Biol 208(1):166-188.
Tweedle CD, Hatton GI. 1980. Evidence for dynamic interactions between pituicytes and
neurosecretory axons in the rat. Neuroscience 5(3):661-671.
Tweedle CD, Smithson KG, Hatton GI. 1989. Neurosecretory endings in the rat
neurohypophysis are en passant. Exp Neurol 106(1):20-26.
Ullian EM, Christopherson KS, Barres BA. 2004. Role for glia in synaptogenesis. Glia
47(3):209-216.
Ullian EM, Sapperstein SK, Christopherson KS, Barres BA. 2001. Control of synapse number
by glia. Science 291(5504):657-661.
Vallstedt A, Klos JM, Ericson J. 2005. Multiple dorsoventral origins of oligodendrocyte
generation in the spinal cord and hindbrain. Neuron 45(1):55-67.
van Dellen A, Blakemore C, Deacon R, York D, Hannan AJ. 2000. Delaying the onset of
Huntington's in mice. Nature 404(6779):721-722.
van Leeuwen FW, Verwer RW, Spence H, Evans DA, Burbach JP. 1998. The magnocellular
neurons of the hypothalamo-neurohypophyseal system display remarkable
131
neuropeptidergic phenotypes leading to novel insights in neuronal cell biology. Prog
Brain Res 119:115-126.
van Praag H, Kempermann G, Gage FH. 1999. Running increases cell proliferation and
neurogenesis in the adult mouse dentate gyrus. Nat Neurosci 2(3):266-270.
Velasco ME, Roessmann U, Gambetti P. 1982. The presence of glial fibrillary acidic protein
in the human pituitary gland. J Neuropathol Exp Neurol 41(2):150-163.
Virard I, Coquillat D, Bancila M, Kaing S, Durbec P. 2006. Oligodendrocyte precursor cells
generate pituicytes in vivo during neurohypophysis development. Glia 53(3):294-303.
Virchow R. 1859. Die Cellularpathologie in ihrer Begründung auf physiologische und
pathologische Gewebelehre. Berlin: August Hirschfeld.
Vitry S, Avellana-Adalid V, Lachapelle F, Evercooren AB. 2001. Migration and
multipotentiality of PSA-NCAM+ neural precursors transplanted in the developing
brain. Mol Cell Neurosci 17(6):983-1000.
Vivier E, Sorrell JM, Ackerly M, Robertson MJ, Rasmussen RA, Levine H, Anderson P.
1993. Developmental regulation of a mucinlike glycoprotein selectively expressed on
natural killer cells. J Exp Med 178(6):2023-2033.
Voigt T. 1989. Development of glial cells in the cerebral wall of ferrets: direct tracing of their
transformation from radial glia into astrocytes. J Comp Neurol 289(1):74-88.
Wang C, Rougon G, Kiss JZ. 1994. Requirement of polysialic acid for the migration of the O2A glial progenitor cell from neurohypophyseal explants. J Neurosci 14(7):4446-4457.
Ware CB, Horowitz MC, Renshaw BR, Hunt JS, Liggitt D, Koblar SA, Gliniak BC,
McKenna HJ, Papayannopoulou T, Thoma B, et al. 1995. Targeted disruption of the
low-affinity leukemia inhibitory factor receptor gene causes placental, skeletal, neural
and metabolic defects and results in perinatal death. Development 121(5):1283-1299.
Warrington AE, Barbarese E, Pfeiffer SE. 1993. Differential myelinogenic capacity of
specific developmental stages of the oligodendrocyte lineage upon transplantation into
hypomyelinating hosts. J Neurosci Res 34(1):1-13.
Watanabe M, Hadzic T, Nishiyama A. 2004. Transient upregulation of Nkx2.2 expression in
oligodendrocyte lineage cells during remyelination. Glia 46(3):311-322.
Watanabe M, Toyama Y, Nishiyama A. 2002. Differentiation of proliferated NG2-positive
glial progenitor cells in a remyelinating lesion. J Neurosci Res 69(6):826-836.
Wegner M. 2001. Expression of transcription factors during oligodendroglial development.
Microsc Res Tech 52(6):746-752.
Wegner M, Stolt CC. 2005. From stem cells to neurons and glia: a Soxist's view of neural
development. Trends Neurosci 28(11):583-588.
132
Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA. 1996a.
Multipotent CNS stem cells are present in the adult mammalian spinal cord and
ventricular neuroaxis. J Neurosci 16(23):7599-7609.
Weiss S, Reynolds BA, Vescovi AL, Morshead C, Craig CG, van der Kooy D. 1996b. Is there
a neural stem cell in the mammalian forebrain? Trends Neurosci 19(9):387-393.
Wewetzer K, Verdu E, Angelov DN, Navarro X. 2002. Olfactory ensheathing glia and
Schwann cells: two of a kind? Cell Tissue Res 309(3):337-345.
Wichterle H, Garcia-Verdugo JM, Alvarez-Buylla A. 1997. Direct evidence for homotypic,
glia-independent neuronal migration. Neuron 18(5):779-791.
Wilson L, Maden M. 2005. The mechanisms of dorsoventral patterning in the vertebrate
neural tube. Dev Biol 282(1):1-13.
Windrem MS, Nunes MC, Rashbaum WK, Schwartz TH, Goodman RA, McKhann G, 2nd,
Roy NS, Goldman SA. 2004. Fetal and adult human oligodendrocyte progenitor cell
isolates myelinate the congenitally dysmyelinated brain. Nat Med 10(1):93-97.
Windrem MS, Roy NS, Wang J, Nunes M, Benraiss A, Goodman R, McKhann GM, 2nd,
Goldman SA. 2002. Progenitor cells derived from the adult human subcortical white
matter disperse and differentiate as oligodendrocytes within demyelinated lesions of
the rat brain. J Neurosci Res 69(6):966-975.
Winner B, Cooper-Kuhn CM, Aigner R, Winkler J, Kuhn HG. 2002. Long-term survival and
cell death of newly generated neurons in the adult rat olfactory bulb. Eur J Neurosci
16(9):1681-1689.
Winner B, Geyer M, Couillard-Despres S, Aigner R, Bogdahn U, Aigner L, Kuhn G, Winkler
J. 2006. Striatal deafferentation increases dopaminergic neurogenesis in the adult
olfactory bulb. Exp Neurol 197(1):113-121.
Wittkowski W, Brinkmann H. 1974. Changes of extent of neuro-vascular contacts and
number of neuro-glial synaptoid contacts in the pituitary posterior lobe of dehydrated
rats. Anat Embryol (Berl) 146(2):157-165.
Wolswijk G, Noble M. 1989. Identification of an adult-specific glial progenitor cell.
Development 105(2):387-400.
Wong KK, Chang YM, Tsang YT, Perlaky L, Su J, Adesina A, Armstrong DL, Bhattacharjee
M, Dauser R, Blaney SM, Chintagumpala M, Lau CC. 2005. Expression analysis of
juvenile pilocytic astrocytomas by oligonucleotide microarray reveals two potential
subgroups. Cancer Res 65(1):76-84.
Woodruff RH, Tekki-Kessaris N, Stiles CD, Rowitch DH, Richardson WD. 2001.
Oligodendrocyte development in the spinal cord and telencephalon: common themes
and new perspectives. Int J Dev Neurosci 19(4):379-385.
Worthington WC, Jr., Cathcart RS, 3rd. 1963. Ependymal cilia: distribution and activity in the
adult human brain. Science 139:221-222.
133
Wren D, Wolswijk G, Noble M. 1992. In vitro analysis of the origin and maintenance of O2Aadult progenitor cells. J Cell Biol 116(1):167-176.
Wu S, Wu Y, Capecchi MR. 2006. Motoneurons and oligodendrocytes are sequentially
generated from neural stem cells but do not appear to share common lineage-restricted
progenitors in vivo. Development 133(4):581-590.
Yamaguchi M, Saito H, Suzuki M, Mori K. 2000. Visualization of neurogenesis in the central
nervous system using nestin promoter-GFP transgenic mice. Neuroreport 11(9):19911996.
Yang Y, Ge W, Chen Y, Zhang Z, Shen W, Wu C, Poo M, Duan S. 2003. Contribution of
astrocytes to hippocampal long-term potentiation through release of D-serine. Proc
Natl Acad Sci U S A 100(25):15194-15199.
Young D, Lawlor PA, Leone P, Dragunow M, During MJ. 1999. Environmental enrichment
inhibits spontaneous apoptosis, prevents seizures and is neuroprotective. Nat Med
5(4):448-453.
Yu WP, Collarini EJ, Pringle NP, Richardson WD. 1994. Embryonic expression of myelin
genes: evidence for a focal source of oligodendrocyte precursors in the ventricular
zone of the neural tube. Neuron 12(6):1353-1362.
Zhang SC. 2001. Defining glial cells during CNS development. Nat Rev Neurosci 2(11):840843.
Zhou Q. 2003. Glial cell development in the vertebrate central nervous system. Thèse de
biologie, California Institute of Technology, Pasadena.
Zhou Q, Anderson DJ. 2002. The bHLH transcription factors OLIG2 and OLIG1 couple
neuronal and glial subtype specification. Cell 109(1):61-73.
Zhou Q, Wang S, Anderson DJ. 2000. Identification of a novel family of oligodendrocyte
lineage-specific basic helix-loop-helix transcription factors. Neuron 25(2):331-343.
Zigova T, Pencea V, Betarbet R, Wiegand SJ, Alexander C, Bakay RA, Luskin MB. 1998.
Neuronal progenitor cells of the neonatal subventricular zone differentiate and
disperse following transplantation into the adult rat striatum. Cell Transplant 7(2):137156.
Zlatescu MC, TehraniYazdi A, Sasaki H, Megyesi JF, Betensky RA, Louis DN, Cairncross
JG. 2001. Tumor location and growth pattern correlate with genetic signature in
oligodendroglial neoplasms. Cancer Res 61(18):6713-6715.
Sites internet :
http://embryology.med.unsw.edu.au/OtherEmb/Rat.htm
http://www.embryology.ch
134
Gliogenèse dans la neurohypophyse de rongeur
au cours du développement et chez l’adulte
Par sa composition cellulaire simple, la neurohypophyse (NH) de rongeur représente un modèle
idéal pour étudier la genèse des cellules gliales dans le système nerveux central. En effet, hormis les
axones de neurones hypothalamiques, la NH est seulement constituée de vaisseaux sanguins et de
cellules gliales appelées pituicytes. De plus, la gliogenèse peut y être induite par des stimulations
physiologiques comme la déshydratation.
Mon premier objectif était de déterminer l’origine développementale des pituicytes. Des tests
fonctionnels in vitro, des greffes et des marquages in situ ont démontré que la NH périnatale contient
des précurseurs d’oligodendrocytes (OPC). Le traçage génétique de ces OPC a ensuite permis
d’établir une relation de lignage avec les pituicytes.
En second lieu, j’ai souhaité réexaminer l’identité des pituicytes chez l’adulte, en recherchant
notamment la présence de cellules souches ou progénitrices. Fondés sur l’expression de marqueurs
gliaux in vivo et sur des cultures d’explants et de neurosphères, mes résultats ont mis en évidence
l’existence de différentes populations de pituicytes, incluant des progéniteurs gliaux. Enfin, j’ai utilisé
des marqueurs de prolifération cellulaire pour montrer que plusieurs de ces populations gliales
participent à la gliogenèse induite lors d’une déshydratation.
Ainsi, cette étude révèle l’hétérogénéité des pituicytes et les redéfinit comme une branche du
lignage oligodendrocytaire. Elle permet également une meilleure compréhension des propriétés des
cellules gliales et de leur lignage, étape fondamentale pour élucider l’origine et améliorer le traitement
de différentes pathologies nerveuses.
Mots-clés : système nerveux central, glie, lignage, gliogenèse, progéniteurs d’oligodendrocytes,
cellules souches, neurohypophyse, pituicytes, déshydratation, prolifération
Gliogenesis in the rodent neurohypophysis during development and in the adult
The simple cellular composition of the rodent neurohypophysis (NH) makes it an ideal model to
study glial cell genesis in the central nervous system. Indeed, apart from axons of hypothalamic
neurons, the NH only contains blood vessels and glial cells called pituicytes. Moreover, gliogenesis
can be induced in the NH through physiological stimulations such as dehydration.
In the work presented here, my first objective was to determine the developmental origin of
pituicytes. In vitro functional tests, transplantations and in situ stainings demonstrated that the
perinatal NH contains oligodendrocyte precursor cells (OPCs). Genetic tracing of these OPCs then
allowed me to establish a lineage relationship with pituicytes.
In the second part of this thesis, I sought to reexamine pituicyte identity in the adult NH, especially
searching for the presence of stem or progenitor cells. Based on in vivo glial marker expression and
on explant and neurosphere cultures, my results revealed the existence of different pituicyte
subpopulations, including glial progenitors. Finally, I used proliferation markers to show that several of
these glial populations participate in dehydration-induced gliogenesis.
Overall, this study uncovers heterogeneity among pituicytes and redefines these cells as a branch
of the oligodendrocyte lineage. It also allows a better understanding of glial cell properties and lineage,
a fundamental step in elucidating the origin of various nervous pathologies and in improving their
treatment.
Keywords : central nervous system, glia, lineage, gliogenesis, oligodendrocyte progenitors, stem
cells, neurohypophysis, pituicytes, dehydration, proliferation
Intitulé et adresse du laboratoire :
Institut de Biologie du Développement de
Marseille-Luminy, CNRS UMR 6216
Parc scientifique de Luminy, Case 907
13288 Marseille cedex 09
France
www.ibdml.univ-mrs.fr
tél: 33 (0)4 91 26 97 46
fax: 33 (0)4 91 26 97 57