BOUETARD, A., 2013. Potentiel évolutif des réponses
Transcription
BOUETARD, A., 2013. Potentiel évolutif des réponses
N° ordre : 2013-10 N° Série : D-70 THESE / AGROCAMPUS OUEST Sous le label de l’Université Européenne de Bretagne pour obtenir le diplôme de : DOCTEUR DE L'INSTITUT SUPERIEUR DES SCIENCES AGRONOMIQUES, AGRO-ALIMENTAIRES, HORTICOLES ET DU PAYSAGE Spécialité : Ecologie Ecole Doctorale : Vie Agro Santé présentée par : Anthony BOUETARD POTENTIEL EVOLUTIF DES REPONSES TRANSCRIPTOMIQUES ET PHENOTYPIQUES VIS-A-VIS DU STRESS D’ORIGINE ANTHROPIQUE : LE CAS DE LYMNAEA STAGNALIS EXPOSEE AUX PESTICIDES soutenue le 4 avril 2013 devant la commission d’Examen Composition du jury : Yannick OUTREMAN Professeur, Agrocampus Ouest / président Nico VAN STRAALEN Professeur, Université libre d’Amsterdam / rapporteur Patrice DAVID Directeur de recherche, CNRS Montpellier / rapporteur Laure GIAMBERINI Professeur, Université de Lorraine / examinateur Arnaud TANGUY Maître de conférences, Station Biologique de Roscoff / examinateur Mari-Agnès COUTELLEC Chargée de recherche, INRA Rennes / responsable scientifique Laurent LAGADIC Directeur de recherche, INRA Rennes / directeur de thèse Logo structure d’accueil 2 Résumé Les contaminations répétées par les pesticides des milieux aquatiques lentiques situés dans les zones agricoles, peuvent influencer l’évolution des populations d’organismes non-cibles qui y sont inféodées, notamment pour les espèces ayant une faible capacité de dispersion. L’objectif de la thèse fut d’évaluer le potentiel évolutif de réponses moléculaires au stress, chez un gastéropode aquatique, Lymnaea stagnalis afin de tester l’influence de la sélection sur la divergence des populations. L’hypothèse de divergence adaptative a été testée sur un ensemble de 14 populations naturelles neutralement différenciées (FST = 0,282) et contrastées du point de vue de leur degré d’exposition aux pesticides. Les traits d’histoire de vie étudiés montrent des patrons de divergence compatibles avec la sélection diversifiante, homogénéisante, ou avec l’hypothèse neutre (QST-FST). Le type d’habitat apparaît comme le principal facteur de divergence inter-population mais les résultats suggèrent une action sélective de la pression pesticide vers une fécondité accrue, comme réponse possible à la réduction de survie précoce. Du point de vue moléculaire, la réponse transcriptionnelle de gènes candidats au diquat, pesticide modèle pro-oxydant, s’est avérée plus marquée que les activités enzymatiques correspondantes. A l’échelle du transcriptome (RNAseq), l’analyse préliminaire de la variation génétique sur un sous-jeu de quatre populations, montre en premier lieu une concordance remarquable avec la divergence neutre. L’effet du diquat semble s’exprimer essentiellement via son interaction avec la population, suggérant des patrons de réponse très différents ainsi qu’une plus faible sensibilité à l’herbicide dans les populations historiquement exposées. Globalement, cette étude révèle une grande variabilité, indiquant un fort potentiel évolutif chez cette espèce, et fournit de nouveaux arguments en faveur de la prise en compte de la variation génétique dans les procédures d’évaluation du risque écologique. Mots clés : Ecotoxicologie Aquatique, Génétique des populations, Génétique quantitative, Transcriptomique, Pesticides, Evaluation du Risque Ecologique, Lymnaea stagnalis. 3 Abstract Repeated pesticides contaminations of lentic freshwater systems located within agricultural landscapes may affect population evolution in non-target organisms, especially in species with a fully aquatic life cycle. The main objective was to assess the evolutionary potential of molecular responses to stress in a freshwater gastropod, Lymnaea stagnalis, through an approach designed to test for population adaptive divergence due to pesticide pressure. The hypothesis of adaptive divergence was tested using a QST-FST approach on a set of 14 natural populations neutrally differenciated (FST = 0,282), from contrasted environments with respect to pesticide pressure. Different patterns were obtained according to the studied life history traits, from neutrality, to divergent and homogenizing selection. Habitat type was shown to be the main factor responsible for population genetic divergence. However, a possible selective effect of anthropogenic stress on some traits was also suggested (enhanced reproduction ability as a response to decreased survival at hatching). Regarding molecular responses to diquat, a pro-oxidant herbicide, results based on candidate genes revealed more pronounced or detectable effects at transcriptional than at more functional level (enzyme activities). At the transcriptomic scale (RNAseq), preliminary investigations based on a subset of four populations, revealed a pattern remarkably consistent with population neutral divergence. Consistently, statistical analyses show that the effect of diquat expressed mostly through its interaction with population, which suggests very different patterns of response according to populations. Results also suggested a possibly reduced sensitivity to diquat in exposed populations, as compared to reference ones. Overall, high genetic variability observed both within and between populations, is indicative of high evolutionary potential, and provides additional arguments to take genetic variation into account in procedures of ecological risk assessment. Keywords: Aquatic Ecotoxicology, Population Genetics, Quantitative Genetics, Pesticides, Transcriptomics, Ecological Risk Assessment, Lymnaea stagnalis. 4 Remerciements Quelle aventure ! Tout ce travail n’aurait jamais été possible sans l’aide de nombreuses personnes. Tout d’abord, je souhaite remercier Marie-Agnès Coutellec, pour avoir éloboré ce projet original et ambitieux et pour m’avoir soutenu tout au long de ces trois années. Un grand MERCI pour ton aide, ton implication dans ce travail, ta patience, ton professionnalisme et ta sympathie. J’ai appris énormément à tes côtés, aussi bien scientifiquement qu’humainement parlant, lors de ces nombreuses et riches discussions. Je t’adresse tout mon respect et mon estime. Merci aussi à Laurent Lagadic, directeur de thèse et reponsable de l’équipe « Ecotoxicologie et Qualité des Milieux Aquatiques » (EQMA), pour nous avoir fait profiter de son HDR, pour ses conseils avisés et pour l’entière confiance et l’autonomie qu’il m’a accordées. Merci également pour m’avoir aidé quelques années plus tôt, à m’orienter sur la voie de la biologie moléculaire et des sciences environnementales. Merci à Jean-Luc Baglinière, Hervé Le Bris et Jean-Marc Roussel, directeurs de l’UMR « Ecologie et Santé des Ecosystèmes » (ESE) pour leur accueil au sein du laboratoire, leur écoute et leur disponibilité, ainsi qu’à Didier Azam, directeur de l’Unité expérimentale d’Ecologie et d’Ecotoxicologie (U3E) pour m’avoir permis de réaliser les élevages et les expérimentations dans les locaux de l’U3E. Je tiens à remercier chaleureusement Nico van Straalen, Patrice David, Laure Giamberini, Arnaud Tanguy et Yannick Outreman pour m’avoir fait l’honneur d’accepter de faire partie de mon jury de thèse et pour avoir consacré du temps à l’évaluation de ce travail. Merci également aux membres de mon comité de pilotage : Guillaume Evanno, Joëlle Forget-Leray et Thierry Guillaudeux, mon tuteur de thèse, pour leurs conseils et remarques pertinentes sur ce projet. De nombreuses personnes ont contribué au bon déroulement de ce projet et m’ont aidé à surmonter ces montagnes de limnées et de bases azotées. Merci à Marc Collinet pour son 5 travail indispensable, sa minutie, sa bonne humeur et tous ces moments de franches rigolades autour des innombrables rondelles de salade. Merci également à Thierry Caquet, qui malgré ses responsabilités, a partager de son temps précieux pendant cette période d’élevage. Un grand merci aussi à tous les membres de l’U3E, Antoine Gaillard, Alphonse Quemeneur, Bernard Joseph, Cédric Lacoste et plus particulièrement Maïra Coke pour avoir participé à la mise en place, l’entretien et avoir assuré toute la logistique indispensable à la bonne réalisation de ce travail. Un grand merci Maïra pour la qualité de ton travail ainsi que pour tous ces moments partagés, ton écoute et ton soutien. Merci aussi à Anne-Laure Besnard pour sa sympathie, son dynamisme, sa rigueur et son aide lors des tests d’écotoxicité, des manipulations de biologie moléculaire et son travail réalisé aux plateformes génomiques du Rheu et de Toulouse. Merci également à Danièle Vassaux pour son aide et l’énergie consacrée à la mise au point et à la réalisation des analyses biochimiques. Merci aussi à Colette Désert, Cécile Duby et Lars-Henrick Heckmann pour leurs conseils et les discussions lors de l’étude préliminaire en qPCR. Merci également à Olivier Bouchez, Eugénie Robe, Nathalie Marsaud de la plateforme génomique Genotoul, à Céline Noirot, Claire Hoede, Cristophe Klopp de la plateforme bioinformatique Genotoul, ainsi que Damien Choine et Thierry Pécot pour leur travail et implication lors de la génération et l’analyse des données transcriptomiques. Je tiens aussi à remercier Gervaise Février et Marie-Thérèse Delaroche pour leur disponibilité et le travail considérable qu’elles réalisent au niveau administratif pour l’unité et merci à Sonia Azam pour son aide informatique au début de ma thèse. Un grand MERCI également à l’ensemble du personnel du laboratoire, et tout d’abord à mes collègues de bureau, Marc Collinet, Sabrina Le Cam et Jessica Côte pour tous ces moments conviviaux, ces éclats de rire, les p’tits gateaux, les p’tits coups de mains et toutes ces dicussions plus ou moins scientifiques. Un merci particulier à Jessica pour ton aide et ton soutien lors de la dernière ligne droite quand le stress d’origine anthropique s’est particulièrement fait sentir, pour tes conseils pertinents et relectures bénéfiques, un grand merci! Merci aussi aux autres collègues pour les bons moments partagés en pause café/clope, à la cantine, au labo ou à l’extérieur du boulot, je pense à Dominique Huteau, Glenn Suzur, Guillaume Forget, Julien Tremblay, Yannick Bayona, Caroline Gorzerino, Martine Ollitrault, 6 Quentin Rougemont, Anne Tréguier, Jérôme Sawtchuck, Guillaune Bal, Sophie Launey, Charles Perrier, Valérie Lopez, Fanny Caupos, Frédéric Lemarchand, Anna et Marc Roucaute, Virginie Ducrot, Arnaud Auber, Ludovic Jégousse et Martine Perdriaux. Petite dédicace aussi à mes homologues groluscoloques belge, serbe, et allemand Arnaud Giusti, Alpar Barsi et Elke Zimmer pour tous les bons moments passés en coloc et en colloque (Quelle descente de drapeaux Nono!), bon courage pour le sprint final ! Yannick, Anne et Quentin, c’est dans plus ou moins longtemps, courage ! Tenez bon aussi ! Je souhaite aussi remercier mes anciens encadrants de stage, Lars-Henrick Heckmann en Angleterre, et Michel Grisoni et Hélène Delatte à La Réunion, aux côtés de qui j’ai beaucoup appris. Enfin, je souhaite remercier mes proches, en premier lieu ma famille. Un grand merci à mes parents, Alain et Odile pour votre confiance, votre soutien dans mes choix, et pour tout ce que vous avez fait pour moi. Merci aussi à mes sœurs, Sophie et Virginie, ainsi qu’à toutes leurs petites familles, Marco, Jéjé, Hugo, Sido, Yaya, et Juju ; je suis un fiston, frangin et tonton comblé ! Merci aussi à mes oncles et tantes, cousins et cousines, bref la famille auxquels s’ajoutent tous mes amis, d’ici ou d’ailleurs, qui m’ont aussi construit et font mon bonheur. Mon vieux poto Sim, chez qui cette aventure a commencé, lettre et CV sont partis en bas de chez toi, lors de cette excursion inoubliable au départ de Tel-Aviv. Désolé je n’ai pas réussi à caser le conflit Sino-Tibétain dans ce manuscrit alors je profite de ces remerciements pour relever ce défi. Merci aussi à Aurèl, Matthias et Dominique… je n’ai pas abdiqué... Merci aux « Zafers », Nico D. & Nico P. et Victor pour toutes ces bouffes et sessions musicales par toujours très mélodiques mais sacrément sympathiques. Continuons à valser ! Merci aussi aux vieux d’la vieille, Camille, Elise, Alex, Vivi, BenH, Gaga, Sam, Audrey, la clic du Garage à Pau, Annie, aux dallons de la Réunion, Paulo, Alice (et Béné et Cécile de la Grosse !), Tipichon, Zozo, Mimi, Tomtom, Arthur, Solène, Lucette, Hélène, Denis, FX, Rodolphe, Caro, Daphné, Pierre, Séverine, Thierry, Leila, Céline, Rachelle, Zébulon, Vanessa, Coco, Edou, Imane, Fab, la case Kabar Boissy, les tontons de la route, Cyril, Henri, Pierre-Yves et tous ceux que j’ai pu (par erreur) oublier. Pour terminer, une petite pensée pour ces « quasi » 20000 limnées, mortes pour la science, en espérant que leur sacrifice ait contribué à apporter un peu plus de sens au pluriel… 7 Sommaire Résumé ........................................................................................................................ 3 Abstract ........................................................................................................................ 4 Remerciements ........................................................................................................................ 5 Liste des figures ........................................................................................................................ 9 Liste des tableaux ..................................................................................................................... 13 Liste des tables supplémentaires .............................................................................................. 15 Préface Chapitre I - ...................................................................................................................... 18 Introduction générale..................................................................................... 21 1. Stress environnemental et impact évolutif des polluants sur les populations naturelles............... 25 2. Etude des mécanismes évolutifs intra-spécifiques ......................................................................... 31 3. Séquençage de Nouvelle Génération, l’écotoxicogénomique à la portée des espèces « non modèles ». ....................................................................................................................................... 37 4. Le modèle biologique : Lymnaea stagnalis.................................................................................... 41 5. Stress d’intérêt : le stress oxydant ................................................................................................. 42 6. Hypothèses, problématique, objectifs et démarche scientifique. ................................................... 47 Chapitre II - Impacts moléculaires d’un herbicide pro-oxydant chez L. stagnalis: approche « gènes candidats »........................................................................................ 50 Chapitre III - Développement de ressources génomiques chez L. stagnalis par pyroséquençage 454 : marqueurs génétiques microsatellites et séquençage de transcriptome................................................................................................. 75 Chapitre IV - Impact évolutif des activités agricoles et anthropiques chez L. stagnalis : étude de 14 populations naturelles .............................................................. 121 Chapitre V - Analyse RNAseq (Illumina) de la divergence génétique des réponses moléculaires au stress entre différentes populations naturelles de L. stagnalis. ..................................................................................................................... 156 Chapitre VI - Discussion générale..................................................................................... 192 Effet toxique du diquat sur les réponses moléculaires de l’hémolymphe et de la glande digestive. 194 Structure génétique des populations naturelles de L. stagnalis dans le Nord-Ouest de l’Europe... 196 Présence d’une forte variabilité inter-populationnelle des traits quantitatifs à l’échelle phénotypique (traits d’histoire de vie) et moléculaire (transcriptome) .............................................................. 197 Effets potentiels des pressions historiques d’origine anthropique sur les réponses moléculaires au stress oxydatif et la fitness des populations .................................................................................. 199 Le type d’habitat comme principal facteur de divergence adaptative et neutre .............................. 200 Présence d’une forte variabilité intra-populationnelle des traits quantitatifs à l’échelle phénotypique et moléculaire. .............................................................................................................................. 202 Intérêt appliqué de l’étude dans le contexte de l’évaluation du risque écologique ......................... 203 Conclusions et perspectives ................................................................................................... 204 Travaux annexes .................................................................................................................... 207 Références bibliographiques .................................................................................................. 208 8 Liste des figures Introduction générale Figure 1. Evolution de la démographie et de la diversité génétique d’une population après un bottleneck. D’après Bickham et al. (2000)…………………………………………………………...p29 Figure 2. Exemple de paternal half-sib mating design. Chaque mâle se reproduit avec plusieurs femelles non apparentées (d’après Lynch & Walsh 1998)………………………………………….p33 Figure 3. Représentation schématique de différents cas de normes de réaction, d’après Pigliucci (2001)…………………………………………………………………………………………………p34 Figure 4. Représentation schématique des différents éléments de régulation de l’expression génique. CDS, séquence codante; Co-A/I, co-activateur/inhibiteur; EBS, Site de fixation de l’amplificateur de transcription ; EN, amplificateur de transcription, M, modification, Me, méthylation ; S, stabilisateur d’ARNm; TF, facteur de transcription; TFBS, site de fixation du facteur de transcription, TM, inhibiteur de traduction; Ub, ubiquitine (d’après Morgan et al., 2007)……….p38 Figure 5. Evolution du nombre des projets de génomiques référencés dans la base de données GOLD en fonction des groupes phylogénétiques. 20327 projets depuis sa création jusqu’à octobre 2012. B, Bactéries ; A, Archeabactéries ; E, Eucaryotes, M, Mammifères. source : http://www.genomesonline.org.............................................................................................................p39 Figure 6. Schéma des mécanismes impliqués dans la production, l’élimination des ROS ainsi que de leurs potentiels effets biologiques. (d’après Luschback 2011).….…..…..…..…..…..…..……...p43 Figure 7. Représentation du dibromure de diquat. (Br2C12H12N2)…………………………....….p45 Chapitre II Article 1- Impact of the redox-cycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis Figure 1. Effective concentration of diquat as function of time and nominal concentration…..p63 Figure 2. Effect of diquat on transcript expression of r18s, r28s and cor in haemolymph (A) and in the gonado digestive complex (B) of Lymnaea stagnalis, as a function of time and diquat concentration. Transcription levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post hoc test)………………….p65 Figure 3. Effect of diquat exposure for time-course on transcription of hsp40 and hsp70 in haemolymph of Lymnaea stagnalis, as a function of time and diquat concentration. Transcription levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test)…………………………………………………….…p66 9 Figure 4. Effect of diquat exposure for time-course on transcription of gene involved in antioxidant response in haemolymph of Lymnaea stagnalis, as a function of time and diquat concentration. Transcript expression levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test). ……….p66 Figure 5. Effect of diquat exposure for time-course on transcription of hsp40 and hsp70 in the gonado digestive complex of Lymnaea stagnalis, as a function of time and diquat concentration. Transcript expression levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test). ……………………...…p67 Figure 6. Temporal antioxidant profiles of transcript expression (A & B) and enzymatic activity (C & D) in the gonado-digestive complex of L. stagnalis exposed to diquat. Snails were exposed during 5, 24 or 48 hours to 22.2, 44.4 or 222.2 µg l-1 of diquat dibromide. Transcription was measured by RT-qPCR and normalized with NORMA-Gene (Heckmann et al., 2011). Transcript expression levels, as enzymatic activities (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test)…………………p68 Chapitre III Article 2 - Pyrosequencing-based transcriptomic resources in the pond snail Lymnaea stagnalis, with a focus on genes involved in molecular response to diquat-induced stress Fig.1. Distribution of annotation quality according to the database used in BlastX (percent identity between query and database sequences). Dataset = LsContig V1…………………….……..p89 Fig.2. Number of contigs classified according to the KEGG top categories. ……………………p90 Fig.3. Number of contigs classified according to the subcategories of KEGG organismal systems category (LsContigV1 annotated contigs)………………………………………….………………..p90 Figure 4. Comparison of the distribution of GO terms among three groups of contigs from Pondsnail_Contigs_V1. The X-axis shows subgroups of the three top categories of GO. The Y-axis shows the percentage (log-scale) of matched sequences in three groups of annotated contigs having at least one GO hit: non-differentially expressed among C and D libraries, overexpressed in D library, and underexpressed in D Library………………………………………………….…………….……p94 Primer note - Isolation and characterization of three new multiplex sets of microsatellite markers in the hermaphroditic freshwater snail Lymnaea stagnalis (Mollusca, Gastropoda, Heterobranchia, Panpulmonata, Hygrophila) using 454-pyrosequencing technology Figure 1. Geographic origin of Lymnaea stagnalis natural populations (Castricum and Kuinre, NL) and INRA U3E laboratory cultures (Le Rheu FR, Amsterdam NL, and Sandbjerg DK) used to describe genetic variability at 9 new microsatellites. Upper-left icon shows the UPGMA clustering of samples based on pairwise Fst-values…………………………………………..…….p114 10 Chapitre IV Figure 8. Photos du dispositif d’élevage des lignées G1….….….………………………….……p123 Article 3 - Do pesticides influence evolutionary processes in natural populations of non-target species? A study in the freshwater snail, Lymnaea stagnalis Figure 1. Location of the 14 populations studied. The number each population is indicated and the 3 different colours corresponds to the 3 environmental categories (white, grey and black for ER0, ER1 and ER2, respectively). See Table 1 for details…………………………………………...……p131 Figure 2. Schematic overview of the common garden experiment (See text for details)…….…p136 Figure 3. Correlation plot between population inbreeding and 15 days fecundity. …….…….p140 Figure 4. Genetic differentiation among the 14 studied populations. (A) Bayesian individual clustering results with STRUCTURE for k = 2. Coloured bars represent proportions of membership of each individual to each cluster. (B) Unrooted Neighbour-Joining tree based on Weir and Cockerham genetic distances among the 14 populations (see Table S2)………………………………………...p141 Figure 5. Individual growth (G1 snails) according to habitat of origin. Gompertz growth curves were based on 12 dates of measurement, performed on 1154 individuals…………………….……p143 Figure 6. Observed hatching rate depending on the level of anthropization. Plot based on 1537 clutches……………………………………………………………………………………….….….p145 Chapitre V Figure 9. Photos des sites d’échantillonnage des quatre populations naturelles utilisées pour l’approche RNAseq……………………………………………………………………………….. p157 Article 4-Genetic variation of transcriptomic expression in Lymnaea stagnalis exposed to a redox-cycling pesticide Figure 1. Overview of the scientific approach. On the map are localized the four studied populations, Unexposed and exposed sites are indicated in white and black, respectively…….……164 Figure 2. Distribution of annotation quality according to the database used in BlastX (percent identity between query and database sequences). Identity percent is represented on the axis (“20” stands for 0-20% identity, etc.) ……………………………………………………………………..p171 Figure 3. Numbers of best hit annotations among the 20 most represented species (E-value < 1e5)……………………………………………………………………………………………….……p172 Figure 4. Number of contigs classified according to the KEGG top categories. (12581 contigs, BLAST threshold > 50% identity)…………………………………………………………………..p173 11 Figure 5. Genetic differentiation among the four studied populations. A, Unrooted Neighborjoining tree based on FST values estimated from 12 SSR loci. B, Bayesian individual clustering results with STRUCTURE for k=2. C, hierarchical clustering based on the count data of the 8 control libraries…………………………………………………………………………………………..….p174 Figure 6. Heatmap based on Euclidean distance between samples, as calculated from the variance stabilising transformation of the count data. * indicates 100% family homology between replicates……………………………………………………………………………………….……p175 Figure 7. Venn Diagramm of the DE contigs according to the three factors implemented in the multi-factorial model analyzed in Deseq. The count data dispersion of the 45249 contigs were fitted with a "local" parameter, adjusted p-value < 0.1. Number of Contigs having annotation in KEGG is indicated between brackets………………………………………………………………………….p176 Figure 8. Hierarchical clustering based on correlation table of subset of contigs matching in signalling pathways apoptosis, ubiquitin metiated proteolysis and the cellular process “Folding, sorting and degradation”. Numbers of contigs is indicated under each corresponding trees. 100% homology between family replicates is indicated by a point after samples names. Colored frames differentiate population types according to the historical pesticide pressure, i.e., low (red) or high (green)……………………………………………………………………………………………….p180 Figure 9. Heatmap of DE contigs detected by t-test statistics and ranged by KEGG processes. Only annotated contigs presented (p-val < 0.1) a foldchange > |2| for at least one of the four populations are presented. On the left, foldchange intensity is determined by divided the mean expression of treated samples by the mean expression of the control samples of the relative population. On the right, count data of each sample are divided by the mean count obtained from the two controls of the relative population. …………………………………………………………………………..p181 12 Liste des tableaux Chapitre II Article 1- Impact of the redox-cycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis Table 1. Characteristics of the sequences used for real-time qPCR analysis.…………………...p60 Table 2. Physicochemical parameters as measured under control conditions.………………….p63 Table 3. Results of the normalization procedure based on GeNorm, using ribosomal RNA 28S, 18S and cortactin as reference genes.………………………………………………………………p64 Chapitre III Article 2 - Pyrosequencing-based transcriptomic resources in the pond snail Lymnaea stagnalis, with a focus on genes involved in molecular response to diquat-induced stress Table 1. Results of cleaning processes applied to the raw sequences obtained from L. stagnalis C and D libraries. The number of sequences is given for each library…....….….….…..……………p88 Table 2. Number of genes having at least one significant match (best-hit annotation) in Pondsnail_Contig_V1, and involved in 13 KEGG pathways selected for their implication in oxidative and molecular stress. ……………………………………………………………………p91 Table 3. Contig annotations matching with genes involved in apoptosis pathway (ko04210) (IAP = inhibitors of apoptosis)……………………………………………………………………………..p92 Table 4. List of gene hits (identity > 50%) matching exclusively with contigs for which Log2FoldChange is either less than - 2 or higher than + 2 between diquat and control conditions (D<C; D>C), or with contigs with no read under one condition and at least 4 reads in the other condition. ………………………………………………………………………………………...p95-96 Primer note - Isolation and characterization of three new multiplex sets of microsatellite markers in the hermaphroditic freshwater snail Lymnaea stagnalis (Mollusca, Gastropoda, Heterobranchia, Panpulmonata, Hygrophila) using 454-pyrosequencing technology Table 1. Sequence and multiplex characteristics of 9 microsatellites loci isolated in L. stagnalis.…………………………………………………………………………………………….p116 13 Table 2. Polymorphism statistics for nine microsatellites loci in L. stagnalis. NA is the total number of alleles, A allelic richness, n number of individuals, nA number of observed alleles per locus per population, Ho observed heterozygosity, He expected heterozygosity (Nei 1978). Bolded characters indicate significant departures from HWE, asterisks the presence of null alleles……….p118 Table 3. Genetic diversity and correlation parameters estimated per population. Hexp = Expected heterozygosity, unbiased estimate. HWE p-values: p-value of the Hardy-Weinberg test with H1 = heterozygote deficiency (HD), or with H1 = heterozygote excess (HE), significant value in bold………………………………………………………………………………………………….p119 Chapitre IV Article 3 - Do pesticides influence evolutionary processes in natural populations of non-target species? A study in the freshwater snail, Lymnaea stagnalis Table 1. Geographical and ecological characteristics of the sites of origin of the 14 investigated Lymnaea stagnalis populations and presentation of their respective genetic diversity indices. The classification of populations in two levels of anthropogenic pressure (AL1 < AL2), two levels of pesticide risk (PR1 < PR2) and three levels of environmental risk (ER0 < ER1 < ER2) was based on the percentage of land use categories within a radius of 100 m around the sampled sites. n indicates the number genotyped individuals, N is the number of alleles, AR is allelic richness (based on samples of 12 individuals), HE is the unbiased expected heterozygosity, HO is the observed heterozygosity, and FIS is the inbreeding coefficient (significance is indicated by asterisk). Ne is the effective population size and estimates of self-fertilization rates are also presented……………………………………..p133 Table 2. Results of the QST-FST comparison for 11 traits studied under a full-sib design. ……p142 Chapitre V Article 4-Genetic variation of transcriptomic expression in Lymnaea stagnalis exposed to a redox-cycling pesticide Table 1. Ecological neutral genetic characteristics of four Lymnaea stagnalis populations. Pesticide exposure risk was based on the percentage of land use categories within a radius of 100 m around the sampled sites. n indicates the number of genotyped individuals, N is the number of alleles, AR is allelic richness (based on samples of 12 individuals), HE is the unbiased expected heterozygosity, HO is the observed heterozygosity, and FIS is the inbreeding coefficient (significance is indicated by asterisk). Ne is the effective population size and estimations of self-fertilization rates calculated are also presented………………………………………………………………………………………..p165 Table 2. Organization of the 16 libraries on the Illumina flow-cell and family relatedness within library………………………………………………………………………………..……………..p167 Table 3. Summary of Illumina sequencing data of the L. stagnalis transcriptome. …..………p170 Table 4. Overview of the preliminary results obtained from Kegg annotation and statistical analyses conducted per population, using t-test statistics and DEseq. ………………….…….p177 14 Liste des tables supplémentaires Chapitre III Article 2 - Pyrosequencing-based transcriptomic resources in the pond snail Lymnaea stagnalis, with a focus on genes involved in molecular response to diquat-induced stress Table S1 Tentative estimates of EC50s for diquat, using data from Coutellec et al. 2008 (Chemosphere 73:326-336). Average values are given with their bootstrapped 95%CIs, as estimated under a Hill model, using the EXCELTM macro REGTOX ………………………………………...p98 Table S2. Tissue volume / mass per condition (C = control, D = diquat exposure) and sample, and corresponding quantity of extracted total RNAs. GDC holds for gonado-digestive complex, BAP for body anterior part, and BPP for body posterior part…………………………………….…p98 Table S3. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in alanine, aspartate and glutamate metabolism pathway (Ko00250)..........................p99 Table S4. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in Ascorbate and aldarate metabolism (KEGG ko00053)….….….…………………..p100 Table S5. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in cystein and methionine metabolism pathway (ko00270). …………………………p100 Table S6. Genes with least one significant match (best-hit annotation) in LsContigV1, and involved in glutathione metabolism pathway (KEGG: ko00480)……………………….………p101 Table S7. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in MAPk signaling pathway (KEGG ko0410) …...….…………….....……….…..p102-103 Table S8. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in metabolism of xenobiotics by cytochrome P450 (ko00980). ………....….…………p103 Table S9. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in oxidative phosphorylation pathway (KEGG Ko00190)…………………..……p104-105 Table S10. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in in p53 signaling pathway (KEGG Ko04115)………………………………………...p106 Table S11. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in peroxisome pathway (KEGG ko04146)……………………………….…………..….p107 Table S12. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in porphyrin and chlorophyll metabolism (KEGG pathway Ko00860)……………….p108 Table S13. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in protein processing in endoplasmic reticulum (KEGG pathway ko04141)….…..109-110 Table S14. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in retinol metabolism pathway (KEGG pathway ko00830)…………………………....p111 15 Table S15-S16-S17-18 Available on line (http://link.springer.com/article/10.1007/s10646-012-0977-1) Table S15. Summary of GO annotation statistics in “Cellular Component” GO category, as provided by WEGO. Columns 1 and 2: first value refers to non-differentially expressed genes (1), second and third values (2 and 3) to over and under-expressed genes, respectively. Column 3: P-values are given for Pearson Chi-square pairwise tests, ordered as 1:2,1:3, 2:3. Ml holds for “meaningless” (count<5), Na for “not available”. Dataset = Pondsnail_Contigs_V1. Table S16. Summary of GO annotation statistics in “Molecular Function” GO category, as provided by WEGO. Columns 1 and 2: first value refers to non-differentially expressed genes (1), second and third values (2 and 3) to over and under-expressed genes, respectively. Column 3: P-values are given for Pearson Chi-square pairwise tests, ordered as 1:2,1:3, 2:3. Ml holds for “meaningless” (count <5), Na for “not available”. Dataset = Pondsnail_Contigs_V1 Table S17. Summary of GO annotation statistics in “Biological Process” GO category, as provided by WEGO. Columns 1 and 2: first value refers to non-differentially expressed genes (1), second and third values (2 and 3) to over and under-expressed genes, respectively. Column 3: P-values are given for Pearson Chi-square pairwise tests, ordered as 1:2,1:3, 2:3. Ml holds for “meaningless” (count <5), Na for “not available”. Dataset = Pondsnail_Contigs_V1 Table S18. KEGG code, abbreviation and name of genes identified in L. stagnalis transcriptome as putatively regulated by diquat (see Table 4) Chapitre IV Article 3 - Do pesticides influence evolutionary processes in natural populations of non-target species? A study in the freshwater snail, Lymnaea stagnalis Table S1. Locus and population genetic characteristics. n indicates the number genotyped individuals, Na is the number of alleles, AR is allelic richness (based on samples of 12 individuals), HO is the observed heterozygosity, HE is the unbiased expected heterozygosity, and FIS is the inbreeding coefficient (significance is indicated in bold characters). ……………………………………..p151-152 Table S2. Pairwise θ values, estimated on the basis of 12 SSR loci (lower diagonal). Upper diagonal: nominal level for multiple comparisons (adjusted to 0.000549)…………………………p152 Table S3. Mean values of the life history traits obtained for the 14 studied populations…..…p153 Table S4. Effects of fixed factors on life history traits using GLMM (Y ~ covar + Geo + Hab + Environmental Risk+ (1 | pop / fam))…………………………………………………….………p154 Table S5. Effects of the fixed covariates on Life history traits from the GLMM analyses : Y ~ covar + Geo + Hab + ER + (1 | pop / fam)………………………………………………….…….p155 16 Chapitre V Article 4-Genetic variation of transcriptomic expression in Lymnaea stagnalis exposed to a redox-cycling pesticide Table S1. List of gene hits (identity > 50%) in the “Enzymes” and “Cytochrome P450” categories matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene.…………………………………………………………….………………….……..p185 Table S2. List of gene hits (identity > 50%) in the “Cellular processes category” matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene…………………………………………………………………………………….……………p186 Table S3. List of gene hits (identity > 50%) in the “Environmental Information Processing” category matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene…………………………………………………………………………………………..…p187-188 Table S4. List of gene hits (identity > 50%) in the “Genetic Information Processing” category matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene………………………………………………………………………………………………….p189 Table S5. List of gene hits (identity > 50%) in the “Metabolism” category matching exclusively matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene…………………………………………………………………………………….……………p190 Table S6. List of gene hits (identity > 50%) in the “Organismal system” category matching matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene…………………………………………………………………………….……………………p191 17 Préface « Si j’admettais l’intervention des impressions sentimentales dans les sciences, je dirais, comme M. Claparède, que j’aimerais mieux être un singe perfectionné qu’un Adam dégénéré. » (P. Broca 1870) 18 Nous vivons une époque extraordinaire, bienvenus dans l’Anthropocène ! Que de chemins parcourus par notre espèce depuis que de lointains ancêtres se dressèrent sur leurs pattes arrière ! Qui sait, pour cueillir une de ces succulentes pommes africaines peut-être? À cette époque révolue, il n’y avait encore ni bombe H, ni hypermarché, ni 4x4, ni McDonalds. Il lui a fallu s’adapter, lentement, émigrer, souvent et tout le temps se réadapter à un paysage changeur et ses locataires inféodés. À mesure de la prise de conscience de son environnement, tant écologique que culturel, au rythme de l’acquisition de connaissances empiriques, des dogmes et des progrès techniques, l’espèce humaine a cherché à se trouver une place, à se définir, donner du sens à l’improbable, au mystère de la vie. Autant de définitions que de civilisations, cultures et courants de pensées, entraînant son flot de conflits, échanges, dominations et révolutions. En occident où la pensée est longtemps restée cloisonnée dans le carcan catholique, « l’image de Dieu » a senti bon de se placer au centre d’un univers initialement réduit au système solaire, selon le modèle géocentrique inspiré par Aristote et Ptolémée. Malgré quelques astronomes visionnaires de l’Inde et de la Grèce antique, ainsi que de la Perse médiévale, il faudra attendre les travaux de Copernic, Kepler et Galilée, conduits aux cours des XVIe et XVIIe siècles, pour voir réellement émerger le modèle héliocentrique. Toutefois, plusieurs décennies et le siècle des Lumières seront encore nécessaires pour qu’il s’impose devant les critiques et la censure et que l’église reconnaisse définitivement la trajectoire elliptique de la terre autour du soleil. S’initie alors une effervescence durable et sans précédent dans de multiples domaines scientifiques notamment en biologie, dont le terme fut introduit par Jean-Baptiste de Lamarck en 1802. En 1831, Charles Darwin s’engage sur le Beagle en tant que géologue et naturaliste, dans l’exploration de cette terre sphérique et nomade. De ses nombreuses observations, découvertes de fossiles et autres spécimens rapportées de ces cinq années de voyage, il élabore sa théorie sur l’origine des espèces qu’il publiera en 1859, apportant des éléments d’explication logique pour interpréter les similarités et la diversité du monde vivant présent et passé. En dépit de son opposition directe avec la doctrine créationniste ancrée dans le prolongement de la Genèse biblique, la théorie de l’évolution s’imposa progressivement, appuyée par l’avènement de la génétique Mendélienne (1865), de la microbiologie puis au gré des avancées technologiques du XXe siècle, par la découverte de l’ADN, le support universel nécessaire à toute vie sur terre. Entre temps, Edwin Hubble démontra définitivement en 1924 la multiplicité des galaxies, de quoi chambouler encore les dogmes et certains fondements philosophiques sur la nature humaine, la descendant 19 de ce piédestal pseudo-divin pour la rendre microscopique et perdue dans un univers toujours plus grand et indéfini et la considérant sur le plan évolutif au même rang que les autres espèces sur une planète déjà âgée, aux contours et réserves limités. Cependant, une certaine interprétation de la loi de la sélection naturelle dont se sont largement inspirés le modèle d’économie libérale et les dérives scientistes et eugénistes, tendent à penser que l’anthropocentrisme est toujours bien ancré dans les rouages et l’inconscient collectif de nos sociétés industrialisées. Certes les progrès médicaux et technologiques des ces derniers siècles ont permis à notre espèce de passer le cap des sept milliards d’individus en 2012, démontrant ainsi son incroyable potentiel d’adaptation, de créativité, et une intelligence remarquable à faire rougir plus d’un DRH, lui permettant d’ériger bâtisses et monuments démesurés, de mettre au point des moyens de transport et de communication toujours plus puissants et rapides mais aussi des armes de destructions capables de tout anéantir. En 2012 l’UICN, Union International pour la Conservation de la Nature, a recensé environ 30% des espèces menacées d’extinction parmi les 65000 étudiées (http://www.iucnredlist.org). Dans le contexte du réchauffement climatique constaté au cours du siècle dernier et directement imputé aux émissions de gaz à effet de serre résultant des activités anthropiques, la crainte que de nombreuses espèces n’aient pas le temps de s’adapter au « changement global » et que n’augmente le taux d’extinction des espèces déjà estimé 100 à 1000 fois supérieur au taux naturel (Pimm et al., 1995), mène à penser que nous assistons peut-être actuellement à la sixième extinction de masse de l’histoire de la biosphère (Barnosky et al., 2011) et que l’ère post-industrielle pourrait marquée le début d’une nouvelle ère géologique : l’Anthropocène (Zalasiewicz et al., 2010; Barnosky et al., 2012). 20 Chapitre I - Introduction générale « Quel est la différence entre un pigeon ? » (Michel Colucci, Qui perd perd, 1978) 21 Contexte socio-économique et historique Au lendemain de la seconde guerre mondiale, pour subvenir aux besoins alimentaires d’une population en pleine explosion démographique s’apprêtant à passer de 2.5 milliards à plus de 6 milliards dans la seconde moitié du XXe siècle (INED, 2013), la révolution industrielle s’étend aux systèmes agricoles. Des usines d’armement se voient alors recyclées en usines d’engrais et de produits phytosanitaires, tandis que des tracteurs et ensileuses remplacent les chars et autres machines de guerre en sortie de chaîne. Les systèmes agraires traditionnels polyvalents, fonctionnant à la manière d’écosystèmes relativement clos et autosuffisants, sont remplacés en quelques décennies par de plus grandes exploitations mécanisées orientées vers la monoculture de variétés à haut rendement, gourmandes en eau et consommatrices d’intrants (engrais et pesticides) principalement conçus à partir des énergies fossiles. La mondialisation et les enjeux économiques ont rapidement répandu ce modèle à travers le globe, généralisant ainsi les risques de pollutions et la modification des habitats liés à ces pratiques (modification physique des rivières ou prélèvements de leurs eaux, déforestation, etc.). L’agriculture, combinée aux activités industrielles et domestiques, utilise plus d'un tiers des ressources d'eau douce accessibles et renouvelables de la Terre (environ 4.430 km3 / an en 2006) et cette consommation intensive est souvent liée à des contaminations (Schwarzenbach et al., 2010). Environ 140 millions de tonnes d'engrais et plusieurs millions de tonnes de pesticides sont appliquées chaque année (Schwarzenbach et al., 2006). D'importantes pertes de biodiversité sont attribuées à l'intensification de l’exploitation des terres arable au cours des 50 dernières années (Memmott, 2009), de même que les activités anthropiques sont tenues responsables du déclin de nombreuses populations d’amphibiens (Bridges et al., 2001). L’écotoxicologie, une science à finalité environnementale Pour faire face aux problèmes environnementaux et de santé publique relatifs à l’utilisation de produits phytosanitaires, émergea une nouvelle discipline à l’interface entre l’écologie et la toxicologie: l’écotoxicologie, dont le terme fut proposé pour la première fois en 1969 par le Professeur René Truhaut, lors du Conseil International des Unions Scientifiques tenu à Stockholm (Molle, 1984). Les sciences environnementales et l’écotoxicologie jouent aujourd’hui un rôle essentiel dans la gestion des risques environnementaux, en fournissant des outils pour les décisionnaires chargés de la gestion des 22 écosystèmes et de leur protection face aux potentiels effets indésirables des contaminants issues des activités humaines. Conscients des risques liés à ces pollutions, notamment dans les écosystèmes aquatiques, les gouvernements ont progressivement mis en place tout un panel de législation. Dans l’Union Européenne, diverses directives ont ainsi vu le jour fixant des seuils de contamination maximale tolérés dans les eaux de consommation (Directive CEE 80778), renforçant successivement les critères d’évaluation toxicologique et écotoxicologique pour l’homologation et la mise sur le marché des anciennes et des nouvelles molécules (Directive 79/117/CEE ; Directive 91/414/CEE ; système REACH ; Règlement (CE) 1107/2209), déterminant le cadre de leurs applications dans un contexte de développent durable (Directive 2009/128/CE) et obligeant les Etats à atteindre des objectifs en matière de qualité et « bonne santé » des eaux de surface et la préservation des nappes d’eaux souterraines (Directive 2008/105/CE) ainsi que la mise en place de zones naturelles protégées pour assurer le maintien de la biodiversité (Natura 2000). L’Homme et la biodiversité : vers une durabilité des relations Le concept de biodiversité, dans son sens le plus commun, désigne l’ensemble des espèces vivantes ainsi que les communautés formées par celles-ci et les différents types d’écosystèmes (Wilson & Peter, 1988). Chaque écosystème repose sur des relations complexes entre les éléments biotiques et abiotiques. L’importance écologique de la biodiversité se manifeste dans les interdépendances qui existent entre les différentes espèces, assurant des services essentiels à la vie tels que la production de dioxygène et la fixation du dioxyde de carbone de l’air, la filtration et la purification de l’eau, la pollinisation des plantes, la décomposition des déchets et le transfert des substances nutritives dans les chaînes trophiques. D’après la définition de la Convention sur la Diversité Biologique (CBD) de 1993, la biodiversité est définie comme la variabilité entre organismes vivants de toutes origines, incluant entre autre, les écoystèmes terrestres, marins et autres systèmes aquatiques, et les complexes écologiques auxquels ils participent ; cette définition inclut la diversité génétique intraspécifique, interspécifique et au sein des écosystèmes (http://www.cbd.int/convention/articles). Le concept de biodiversité est également étroitement relié à celui de service écosystémique, lui-même défini comme toute activité ou fonction d’un écosystème bénéfique à l’humanité, incluant non seulement les services écosystémiques terminaux (qui fournissent un gain ou une perte de bien-être aux populations à travers les 23 biens) mais aussi l’ensemble des processus écologiques qui conduisent à ces services, biens et valeurs pour l’Homme. La biodiversité est soit considérée comme l’équivalent de l’ensemble des services écosystémiques, soit comme un service écosystémique (valeur de conservation) parmi les autres (Mace et al., 2012). Dans ce contexte, l’Homme tente également de formaliser ses relations avec l’environnement pour en accroître la durabilité, via l’évaluation du risque écologique, qui estime la probabilité que des effets écologiques négatifs se produisent comme résultat de l’exposition à un ou plusieurs agents de stress (Lackey, 1997). L’évaluation du risque repose sur une stratégie générale de comparaison de concentrations d’exposition et d’effet en 4 étapes : identification du danger, évaluation de la relation « dose-réponse », évaluation de l’exposition, et caractérisation du risque (Breitholtz et al., 2006). Que ce soit en termes de services écosystémiques ou d’évaluation du risque écologique, la biodiversité est donc un élément central à considérer. En particulier, la « variabilité génétique intraspécifique » représente un niveau d’intérêt actuellement croissant en écotoxicologie, car sa prise en compte dans l’évaluation du risque est supposée accroître la pertinence écologique des estimations (Depledge, 1994; Forbes, 1998; Klerks, 2002). La justification de cette prise en compte repose sur l’importance théorique des effets évolutifs potentiels des polluants, et sur leur documentation empirique de plus plus riche (voir Bickham 2011 ; Coutellec & Barata 2011, et le numéro spécial d’Ecotoxicology dans son ensemble). Pourquoi s’intéresser aux impacts évolutifs des polluants Du point de vue scientifique, les arguments justifiant la prise en compte des effets évolutifs des polluants peuvent être classés selon quatre critères : Connaissance fondamentale : les environnements anthropisés constituent des conditions d’évolution rapide et «en action» qui permettent de tester des hypothèses fondamentales relatives aux processus micro-évolutifs ; Précision des effets estimés : la variation génétique est une réalité biologique qui, jusqu’à présent, a été sciemment ignorée dans les procédures d’évaluation du risque, pour des raisons de contrôle de variabilité des réponses. Cependant, l’adaptation évolutive, si elle se produit, a la capacité de modifier les attendus toxicologiques en terme 24 d’effet (courbe dose-réponse) et devrait donc être considérée a priori dans une démarche d’évaluation ; Pertinence biologique (i.e., éco-évolutive) des effets estimés : les conséquences évolutives peuvent être plus dommageables à la fois sur le long-terme et dans un contexte de stress multiples, que des effets purement démographiques ou des effets limités aux individus exposés ; Conservation de la biodiversité et des services qu’elle peut produire : tout impact sur le niveau de variabilité génétique intraspécifique a des conséquences négatives en termes de biodiversité, et doit donc pouvoir être considéré a priori, de manière à pouvoir être estimé. Dans cette thèse située à l’interface entre la biologie évolutive et l’écotoxicologie, l’étude du potentiel évolutif des réponses au stress a été menée chez un mollusque gastéropode hermaphrodite, la limnée des étangs, Lymnaea stagnalis. Elle porte plus précisément sur les réponses moléculaires et phénotypiques vis-à-vis du stress généré par un herbicide pro-oxydant (le diquat), chez un organisme non-cible. Ce travail repose sur l’utilisation de méthodes de génétique quantitative, de génétique des populations et sur l’intégration de données d’expression transcriptomique. Dans la suite de cette introduction, nous définirons différents concepts issus de la biologie évolutive et de l’écotoxicologie, ainsi que les modèles biologique et chimique utilisés, avant de présenter la démarche scientifique et les hypothèses testées. 1. Stress environnemental et impact évolutif des polluants sur les populations naturelles Les sources de stress environnemental sont multiples, que leur origine soit naturelle ou anthropique, leur nature biotique ou abiotique. Le stress environnemental résulte des variations spatiales et temporelles de l’environnement, susceptibles d’entraîner des modifications biochimiques et physiologiques chez les organismes qui y sont soumis. La valeur sélective ou fitness, c’est à dire la capacité des individus à transmettre leur génotype aux générations ultérieures, peut aussi être affectée par le stress environnemental (Hoffmann & Hercus, 2000; Meyers & Bull, 2002). Le contexte actuel de changement climatique et de 25 changements globaux intensifie les probabilités de mise en place de processus évolutifs au sein des écosystèmes (Bijlsma & Loeschcke, 2012). En théorie, le stress environnemental peut interagir avec l’ensemble des forces évolutives majeures et les mécanismes sous-jacents : dérive génétique au hasard, consanguinité, flux génique, taux de mutation, sélection naturelle (van Straalen & Timmermans, 2002). Le stress environnemental peut donc avoir des conséquences évolutives rapides (Hoffmann & Hercus, 2000), en particulier dans les cas de colonisation de nouveaux milieux, ou d’hétérogénéité environnementale associée à une structure en métapopulation (Reznick & Ghalambor, 2001). Le stress environnemental peut aussi accroître le taux même d’évolution phénotypique (Hendry et al., 2008). Pour cette raison, les concepts et principes évolutifs sont de plus en plus intégrés aux problématiques relatives aux sciences environnementales et à la biologie de la conservation (Smith & Bernatchez, 2008; Bijlsma & Loeschcke, 2012). Dans les milieux anthropisés, les polluants sont des sources potentielles de stress et d’hétérogénéité environnementale, pouvant avoir diverses conséquences évolutives (Medina et al., 2007). On peut les classer parmi 4 grands types : l’adaptation (sélection directionnelle de mutations avantageuses), la dérive génétique au hasard, la mutation (Eeva et al., 2006; Matson et al., 2006), et les effets trans-générationnels non génétiques (Vandegehuchte & Janssen, 2011). Ces derniers, bien que transmis de façon non mendélienne classique, peuvent toutefois avoir des conséquences évolutives (pour une revue détaillée, voir Bonduriansky & Day 2009 ; voir aussi Mousseau et al., 2009), notamment en modifiant la réponse à la sélection et sa dynamique (Kirkpatrick & Lande, 1989). Nous nous intéresserons de façon plus détaillée aux effets de sélection et de dérive, dans un contexte d’exposition aux contaminants. 1.1. Effets sélectifs, directs et indirects Face à un stress, la réponse des populations peut reposer sur la plasticité phénotypique des génotypes ou sur l’adaptation génétique. Cependant, bien que la plasticité elle-même ait une base génétique et puisse donc être sélectionnée (voir Pigliucci, 2005), nous ne nous intéressons ici qu’à l’adaptation génétique au sens classique du terme. Bien que l’adaptation d’une population à un contaminant permette le maintien de la fitness en présence de ce contaminant, le phénomène sélectif sous-jacent, s’il est directionnel 26 entraîne en théorie une baisse de la diversité génétique (la sélection épuise la diversité), qui diminue le potentiel adaptatif des populations vis-à-vis de futurs stress environnementaux (van Straalen & Timmermans, 2002; Jansen et al., 2011). Les effets sélectifs des polluants sont aujourd’hui documentés par de nombreux cas rapportés de résistance, par exemple aux métaux (Reznick & Ghalambor, 2001; Morgan et al., 2007; Bourret et al., 2008) ou aux pesticides (Brausch & Smith, 2009; Coors et al., 2009) au sein de populations naturelles soumises à des expositions récurrentes ou chroniques de polluants d’origine industrielle ou agro-chimique. Parmi les substances émises dans l’environnement par les activités humaines, les pesticides constituent un groupe de molécules qui demande une attention particulière, car ils sont spécialement conçus pour avoir un effet biologique négatif. Ils sont ainsi reconnus à juste titre comme des facteurs sélectifs potentiels majeurs (Jansen et al., 2011). L’apparition de résistances aux pesticides chez les espèces cibles est un phénomène répandu, notamment dans le cadre de la lutte contre les adventices (Powles & Yu, 2010), les moustiques (Tantely et al., 2010), les acariens (Umina et al., 2012) ou les rongeurs (Ishizuka et al., 2008), pouvant conduire, en réponse, à l’augmentation des concentrations de traitement, l’utilisation ponctuelle de molécules interdites et nécessitant la recherche perpétuelle de nouvelles substances. La résistance se définit comme un changement héritable dans une population, qui se traduit par une meilleure aptitude à survivre ou à se reproduire en présence d’une condition environnementale ayant auparavant eu un effet létal sur l’espèce à laquelle appartient cette population. Pour qu’une résistance puisse évoluer et s’étendre dans une population, plusieurs critères doivent être vérifiés, même s’ils ne sont pas forcément suffisants. En plus de la variation génétique (condition de base), il faut notamment que : (i) l’intensité du stress soit supérieure à la capacité de persistence des populations locales par pure plasticité ; (ii) la durée d’exposition soit assez longue, relativement au temps de génération de l’espèce considérée ; (iii) des génotypes résistants pré-existent, même en très faible nombre, et (iv) le flux de gènes et la mobilité soient réduits. L’apparition d’une résistance résultant de l’effet sélectif exercé par un contaminant peut affecter d’autres traits, en raison de corrélation génétique entre ces traits et le trait répondant à la sélection (Sgro & Hoffmann, 2004). Ces effets peuvent résulter de déséquilibres de liaison entre gènes controllant les différents traits ou d’effets pléiotropiques. 27 La sélection opérée par un contaminant peut conférer une meilleure tolérance vis-à-vis d’autres contaminants. On parle alors de résistance croisée ou de co-résistance (e.g., Brausch & Smith, 2009) pouvant résulter de mécanismes communs de détoxication, telle que la production accrue de métallothionéines en réponse au cadmium et au cuivre (Morgan et al., 2007). Les corrélations génétiques peuvent aussi être négatives et se traduire par un coût de la résistance. Ainsi, la résistance évolutive à un contaminant donné peut comporter un coût en terme de fitness globale (Duron et al., 2006), ou vis-à-vis d’autres contaminants ou agents de stress spécifiques (Salice & Roesijadi, 2009). Le coût d’une adaptation se mesure par la baisse de performance observée chez les génotypes résistants lorsque la pression de sélection à l’origine de l’adaptation est levée. Il en résulte que l’adaptation rapide à un nouveau stress environnemental ne garantit pas la persistence des populations sur le long-terme. Une augmentation de l’allocation d’énergie aux mécanismes de détoxication, si elle reste physiologiquement constitutive en l’absence de stress, peut expliquer une diminution de la fécondité des individus adaptés en l’absence de stress, notamment si l’énergie allouées aux fonctions reproductives est en partie détournée. La notion de coût de la résistance demeure difficile à démontrer empiriquement. Ainsi, les exemples de coûts adaptatifs associés à la résistance aux pesticides sont peu nombreux. Chez la rainette versicolore, Hyla versicolor, une baisse de la survie des têtards les plus tolérants à l’insecticide Carbaryl a été constatée en l’absence de pollution (Semlitsch et al., 2000). Toutefois, le fait que ce coût ne s’exprime que sous certaines conditions de stress (densité individuelle élevée) montre l’importance des interactions entre facteurs de stress, que ceux-ci aient un effet sélectif ou non. Chez l’adventice Ipomoea purpurea, les génotypes tolérants au glyphosate présentent une fécondité plus faible en absence de l’herbicide (Baucom & Mauricio, 2004). De même, la résistance aux pesticides des populations de la tordeuse à bandes obliques Choristoneura rosaceana conduit à une diminution de la taille et un allongement du temps de développement au stade nymphal comparativement aux populations sensibles (Carriere et al., 1994). Le potentiel migratoire des génotypes tolérants vers des zones non contaminées peut ainsi être limité en cas de diminution de la pression de sélection, tandis que l’immigration de génotypes sensibles peut entraîner une baisse progressive de la fréquence des génotypes résistants dans la populations (Mackie et al., 2010). Cependant, les phénomènes de résistance ne sont pas toujours associés à un coût (Lopes et al., 2008; Brausch & Smith, 2009), et peuvent même parfois induire une meilleure 28 fitness en l’absence de pollution (Arnaud et al., 2005). Il semblerait que l’existence de coût lié à la résistance dépende principalement du mécanisme moléculaire impliqué dans l’apparition de cette résistance. Ainsi, un coût maximal est attendu pour les mécanismes de désactivation des récepteurs et les mutations structurelles dans les systèmes de détoxication (Taylor & Feyereisen, 1996). Le coût éventuel peut être réduit si les mécanismes impliqués sont uniquement sollicités lorsque le polluant est présent. 1.2. Effets non sélectifs : dérive génétique et processus associés Le stress environnemental peut également avoir des conséquences évolutives de nature non adaptative sur les populations. Du point de vue des polluants, les impacts évolutifs sont de plus en plus documentés, et reflètent en effet aussi bien des processus adaptatifs que l’augmentation des effets de dérive génétique au hasard (Barata et al., 2002; Matson et al., 2006; Medina et al., 2007; Whitehead et al., 2012). A la base du second type d’effet, les réductions démographiques potentiellement associées au stress (mortalité, réduction de la fécondité) peuvent se traduire par une réduction de la diversité génétique des populations, qui lorsque le stress est levé, ne peut se rétablir en absence de nouvelles mutations ou d’apport de variation par flux de gènes (immigration), et ce, même si les effectifs de la population sont reconstitués de façon intrinsèque (Fig 1). Figure 1. Evolution de la démographie et de la diversité génétique d’une population après un bottleneck. D’après Bickham et al. (2000). 29 Ce type d’effet est proportionnel à la réduction démographique (la dérive est d’autant plus forte que la taille de la population est petite), et concerne en premier lieu la variation génétique neutre. A l’échelle de plusieurs populations, l’effet de dérive, de par sa nature aléatoire, conduit en outre à la différenciation accrue des populations (Hartl & Clark, 1997). Au-delà des effets sur les mutations neutres, la dérive peut aussi affecter les mutations délétères spontanées, lorsque celles-ci on un faible effet individuel. Ces mutations peuvent, par dérive soit disparaître, soit se fixer (i.e., se comporter comme si elles étaient neutres), et conduire dans le second cas à une accumulation du fardeau de dérive locale au fil des générations (Whitlock et al., 2000). L’importance de ce fardeau va dépendre de la relation entre l’ampleur de la dérive et l’intensité de la sélection contre ces mutations (s). On considère cet effet possible dès que |s| < 1/2Ne (Ne étant la taille efficace de la population). Ainsi, la probabilité de fixation de mutations délétères augmente dans les petites populations, car l’effet de la sélection contre elles est contrarié par celui de la dérive au hasard qui devient prédominant. L’effet du stress environnemental, par sa capacité à amplifier l’expression délétère des mutations (Szafraniec et al., 2001), peut donc être amplifié dans des conditions qui favorisent l’accumulation de ces mutations ou l’augmentation de leur fréquence sous forme homozygote, i.e., respectivement la petite taille des populations et la consanguinité. L’expression accrue de la dépression de consanguinité en conditions de stress est bien documentée (Armbruster & Reed, 2005; Bijlsma & Loeschcke, 2012), tandis que l’effet du stress sur l’hétérosis entre populations (meilleure fitness des hybrides, mettant en évidence l’existence de fardeau dans les populations parentales) semble plus difficile à montrer (mais voir Coutellec & Caquet 2011). Les conditions environnementales où les sources de stress sont multiples et récurrentes, comme par exemple dans un contexte d’application répétée de traitements pesticides variés (programmes protection des cultures, itinéraires techniques), qui peuvent être transmis aux pièces d’eau voisines des parcelles traitées par diverses voies (dérive atmosphérique, ruissellement, drainage), peuvent donc conduire à une accumulation du fardeau génétique dans les populations d’organismes aquatiques non-cibles. Ces effets peuvent être amplifiés par les réductions démographiques occasionnées, et par l’isolement des populations résultant de la dégradation/fragmentation de l’habitat. 30 La conséquence générale de ces effets de dérive est une perte d’adaptabilité génétique aux changements environnementaux dans les petites populations (Willi et al., 2006), qui peut à l’extrême conduire à l’extinction de celles-ci. Ce scénario est d’autant plus probable que les changements environnementaux sont imprédictibles (limitation de la sélection en faveur des mutations avantageuses) et multiples. 2. Etude des mécanismes évolutifs intra-spécifiques L’étude des mécanismes micro-évolutifs repose principalement sur la mesure de « traits d’histoire de vie » (THV) en lien avec la valeur sélective des populations et / ou sur l’utilisation de marqueurs neutres. Ces approches renseignent respectivement sur la diversité génétique additive et de la diversité génétique neutre. Estimation de la diversité génétique neutre des populations Les méthodes moléculaires permettant d’estimer la diversité génétique neutre se focalisent sur le polymorphisme observable dans des régions non codantes du génome, et n’ayant a priori pas d’impact sur la fitness des individus. Elles utilisent des marqueurs, dits « neutres » car supposés affectés uniquement par la dérive génétique au hasard, permettant de différencier les individus au niveau de motifs particuliers telles que les séquences microsatellites (séquences di- ou tri-nucléotidiques répétées de longueurs variables). Ces marqueurs moléculaires sont typiquement utilisés en génétique des populations, en raison de leur caractère codominant et de leur variabilité élevée (Jarne & Lagoda, 1996). L’analyse des fréquences alléliques et génotypiques permet d’estimer divers indices de diversité génétiques et paramètres de génétique des populations, tels que l’hétérozygotie attendue sous l’équilibre de Hardy-Weinberg, la diversité génétique, la richesse allélique, le coefficient de consanguinité (FIS), la taille efficace des populations (Ne) ou encore la différenciation génétique des populations (FST). L’analyse de la structure génétique est classiquement fondée sur l’estimation des indices F de Wright (FST, FIT, FIS) à partir d’une décomposition de la variance des fréquences alléliques en composantes inter-échantillon, inter-individuelle intraéchantillon, et intra-individuelle (Weir & Cockerham, 1984). Les marqueurs neutres codominants sont également appropriés pour l’étude des systèmes de reproduction 31 hermaphrodites, notamment via l’estimation des paramètres relatifs à l’autofécondation (Ritland, 2002; David et al., 2007). Estimation de la variation génétique quantitative L’expression phénotypique des traits quantitatifs (codés par plusieurs gènes) est le résultat de l’influence du génotype et de celle de l’environnement. Cette relation est à la base de la génétique quantitative, et de ses applications à l’écologie évolutive (Lynch & Walsh, 1998), et en écotoxicologie (Klerks et al., 2011). L’estimation de la part héritable (variance génétique additive) de ces traits permet d’aborder les questions d’évolution relatives à l’adaptation, et en particulier d’en inférer le potentiel adaptatif des populations vis-à-vis du changement environnemental (e.g., Hoffmann & Sgrò, 2011). Trois types d’approches de génétique quantitative peuvent être utilisés dans l’étude de l’évolution des résistances. Une première approche d’« évolution expérimentale » consiste à appliquer la sélection en laboratoire et à déterminer après plusieurs générations si le développement de résistances est possible au sein d’une population et si tel est le cas, à quelle vitesse elles apparaissent. Ce type d’approche utilise généralement des espèces modèles issues de populations de laboratoire à cycle de vie court (e.g., résistance au cadmium chez Drosophilia melanogaster ; Shirley & Sibly, 1999). Une deuxième approche est de déterminer si la population présente de la variation génétique pour la sensibilité vis-à-vis d’un contaminant, et si elle possède la variation nécessaire pouvant conduire à une réponse à la sélection. Ce type d’approche, généralement expérimental, repose sur des protocoles de génétique quantitative classique permettant d’estimer l’héritabilité du ou des traits focaux (voir ci-dessous). Cependant, ces estimations peuvent également être estimées en milieux naturel, via l’utilisation de matrices d’apparentement génétique et de variation phénotypique observée (Ritland, 2000). Un troisième type d’approche vise également à estimer l’action passée de la sélection sur les populations naturelles, et repose sur la décomposition de la variance génétique additive des traits d’intérêt en composantes intra et inter-populations, à partir de protocoles de mesures de normes de réaction en conditions communes controlées (common garden). Bien qu’encore peu appliqué au contexte écotoxicologique (voir JimenezAmbriz et al., 2007), ce type d’approche semble approprié à la recherche de patrons de sélection en lien avec l’exposition chronique et historique (multi-génération) à des polluants. 32 L’héritabilité L’adaptation génétique est le résultat de la sélection agissant sur des traits héritables, et qui favorise au cours des générations les allèles conférant une meilleure valeur de trait dans l’environnment considéré. Dans une population, l'héritabilité au sens strict d’un caractère désigne la proportion de variation génétique additive relative à la variation phénotypique globale de ce caractère (i.e., qui résulte de l’effet additif des allèles codant pour ce trait, seule part transmissible à la génération suivante). L’héritabilité (h²) d’un trait correspond au ratio de sa variance génétique additive (VA) sur la variance phénotypique totale (VP) observée dans la population (Lynch & Walsh, 1998). VP comprend la variance génétique (VG) et la variance liée à l’environnement (VE), théoriquement transmise et non-transmise aux générations suivantes, respectivement. VG quant à elle, comprend trois composantes : la variance additive (Va), la variance de dominance (Vd) et la variance d’interaction (Vi). Ce paramètre peut varier en fonction du trait considéré et est spécifique d’une population dans un environnement donné (Lynch & Walsh, 1998). Pour estimer au mieux la part de variance de chacune de ces composantes, le protocole expérimental doit reposer sur l’élevage ou la culture contrôlé d’un nombre important de lignées d’individus en conditions standardisées. Le protocole de type half-sib permet de découpler l’effet maternel et l’effet de dominance, de l’effet famille (Figure 2). Figure 2. Exemple de paternal half-sib mating design. Chaque mâle se reproduit avec plusieurs femelles non apparentées (d’après Lynch & Walsh 1998). 33 Il permet de prendre en compte les différents niveaux de relations familiales (pèreprogéniture, mère-progéniture, pleins-frères, demi-frères, intra- et inter famille, etc.) et l’héritabilité est alors estimée de la façon la plus précise « narrow sense heritability » (h²). Ce type d’analyse a notamment été testé chez des amphibiens démontrant un certain potentiel adaptatif chez Rana sphenocephala vis-à-vis d’un stress induit par l’insectide carbaryl (Bridges et al., 2001), ainsi que chez Hyla versicolor, avec la mise en évidence d’un trade-off entrainant une baisse de survie des têtards en condition non stressante (Semlitsch et al., 2000). Cependant, la séparation totale des effets additifs et non additifs, n’est pas toujours réalisable pour des raisons biologiques (croisements multiples parfois impossibles) ou de faisabilité technique. Des protocoles plus simples d’estimation peuvent alors être mis en œuvre, (full-sib design) conduisant à une estimation plus grossière (héritabilité au sens large, « broad sens heritability », H²), qui tend à surestimer la variance génétique en incluant les effets maternels et d’environnement commun (Lynch & Walsh, 1998; Pakkasmaa et al., 2003). Plus h² (ou H²) est élevée pour un trait, plus sa réponse à la sélection sera forte. Common garden experiment et normes de réaction Le design experimental en common garden consiste à mesurer la variation phénotypique en laboratoire ou en milieu semi-naturel, sur des individus F1 issus d’adultes sauvages échantillonnés dans différentes populations naturelles. Ce protocole peut être enrichi en imposant plusieurs conditions contrôlées à chacune des lignées étudiées, permettant alors de mesurer une norme de réaction (Stearns, 1989) vis-à-vis du facteur testé, à l’échelle familiale (par exemple, témoin vs. contamination par un polluant à différentes concentrations). Ces plans expérimentaux permettent d’établir des normes de réaction correspondant à la gamme de phénotypes possibles pour un génotype ou une population dans des conditions environnementales différentes. Figure 3. Représentation schématique de différents cas de normes de réaction, d’après Pigliucci (2001). 34 Des interactions génotype x environnent (G x E) ou de la plasticité phénotypique peuvent ainsi être mis en évidence (Pigliucci, 2001). Si aucune différence phénotypique n’est constatée pour un génotype malgré les changements de conditions environnementales, il n’y a pas de plasticité phénotypique détectée comme c’est le cas pour les deux génotypes représentés dans la figure 3a. Lorsque les normes de réaction sont parallèles et que les pentes sont non nulles, la réponse phénotypique induite par le stress est due à la plasticité (b) tandis que si les pentes sont différentes, les différences phénotypiques observées ont une base génétique (G x E) pouvant mettre en évidence des processus de sélection passés (c). Ce type d’approche a notamment été utilisé pour comparer la fitness de populations de Styela plicata, un invertébré marin soumis à différentes concentrations de cuivres (Galletly et al., 2007), ou encore chez Lymnaea stagnalis pour tester l’impact de l’exposition parentale à des mélanges de pesticides sur divers traits d’histoire de vie de la descendance, en fonction d’un gradient de stress biotique (Coutellec et al., 2011). Cependant, la divergence entre populations peut simplement résulter d’effets liés à la dérive génétique au hasard (isolement par la distance). Cette hypothèse peut être testée par l’approche QST - FST (Leinonen et al., 2008; Whitlock, 2008). Recherche de patrons de sélection, la comparaison QST vs. FST Cette méthode permettant de tester l’hypothèse d’adaptation locale entre des populations issues de milieux contrastés du point de vue d’un stress d’intérêt, consiste à comparer le niveau de différenciation génétique neutre estimé à partir de marqueurs neutres (indice FST ; Wright 1952) avec la variation observée pour des traits quantitatifs reflétant la variation génétique additive globale (QST ; Spitze 1993). Dans la littérature, l’estimation des valeurs de QST repose principalement sur des mesures de traits d’histoire de vie réalisées sur la descendance issue de populations naturelles et élevée en conditions de common garden. L’étude de la descendance de ces populations en laboratoire permet d’écarter des biais potentiels dus aux effets directs de l’environnement d’origine ainsi que d’éventuels effets génétiques non additifs et effets maternels (O'Hara & Merila, 2005). Les indices FST et QST sont comparables car ils sont estimés selon des calculs similaires (Whitlock, 2008). 35 Pour le calcul de QST, l’équation est la suivante: QST trait = Vb (V b + 2V w ) où Vb correspond à la variance génétique entre les populations (between) et Vw à la variance génétique intra-population (within) (Spitze, 1993; O'Hara and Merila, 2005). Pour chaque trait, les variances intra- et inter-population sont extraites de l’analyse statistique des traits basée sur des modèles linéaires mixtes généralisés (GLMM) (Pinheiro & Bates, 2002). Vb est obtenue directement à partir de la valeur de la composante de variance estimée pour l’effet population et Vw est obtenue à partir de la composante de variance estimée pour l’effet famille, qui est multiplié par 2 dans le cadre de designs en full-sib ou par 4 dans le cadre de designs en half-sib (Lynch & Walsh, 1998). Dans la méthode développée par Whitlock & Guillaume (2009), la différence observée entre les valeurs estimées des indices QST et FST à partir des composantes de variance de FST (Weir & Cockerham, 1984) est comparée par bootstrap avec la distribution théorique attendue sous l’hypothèse de neutralité (la dérive génétique au hasard est suffisante pour expliquer les patrons de divergence observés pour les traits quantitatifs). En l’absence de sélection, les valeurs de QST et de FST sont donc censées être similaires et si la valeur observée n’est pas significativement différente des valeurs attendues, le test conclut que le trait est principalement soumis à la dérive génétique (neutralité, FST = QST). En revanche, des écarts significatifs à la distribution attendue sous l’hypothèse neutre indiquent une sélection vers un optimum commun aux différentes populations (FST > QST , sélection homogenéisante) tandis que QST > FST indique que l’effet de la sélection vers différents optima est supérieur à celui de la dérive génétique, ce qui induit une sélection divergente entre les populations (Spitze, 1993; O'Hara & Merila, 2005; Whitlock, 2008; Lamy et al., 2012). Cette approche est classiquement utilisée en biologie évolutive (Evanno et al., 2006; Johansson et al., 2007; Eroukhmanoff et al., 2009; Nemec et al., 2012; Rogell et al., 2012). Elle a notamment permis de démontrer chez le gastéropode d’eau douce Galba truncatula, une divergence adaptative entre des populations naturelles occupant des habitats temporaires et permanents (Chapuis et al., 2007), ou encore la sélection vers différents optima selon la pression sélective issue de l’acidification des habitats chez la grenouille des landes Rana arvalis (Hangartner et al., 2012). Egalement appliquée en écotoxicologie, elle a permis la 36 mise en évidence d’une sélection divergente induite par une pollution au zinc chez Thlaspi caerulescens (Jimenez-Ambriz et al., 2007). La recherche de traits d’histoire de vie corrélés à l’évolution de résistance et de coûts potentiels pour la fitness des génotypes résistants, est importante pour avoir une compréhension globale des mécanismes évolutifs à l’origine des patrons observés. L’approche écotoxicogénomique peut alors apporter des explications sur les mécanismes moléculaires impliqués dans l’acquisition de la résistance, d’éventuels trade-offs et des effets pléiotropiques. 3. Séquençage de Nouvelle Génération, l’écotoxicogénomique à la portée des espèces « non modèles ». L’écotoxicogénomique L’écotoxicogénomique correspond au domaine utilisant les techniques permettant l’exploration des génomes et des réponses transcriptomiques, protéomiques, et métabolomiques dans un contexte écotoxicologique. Elle est définie comme l’étude chez des organismes non-cibles de l’expression génique et protéique contribuant à la réponse des organismes non-cibles aux toxiques environnementaux (Snape et al., 2004). Le terme génomique émergea au milieu des années 80 et se trouve depuis en perpétuelle évolution. A mesure que la compréhension des processus moléculaires et cellulaires avance, le champ des problématiques de recherche permettant d’estimer les effets induit par des toxiques sur les organismes s’élargit. Etudier les réponses individuelles au stress à un seul niveau de l’organisation biologique ne donne que peu d’informations sur la façon dont les organismes gèrent la réponse au stress mais l’intégration de réponses à différents niveaux favorise une compréhension plus globale. Les biomarqueurs moléculaires correspondent au niveau d’organisation biologique le plus élémentaire dans l’investigation de la réponse au stress. Les réponses moléculaires sont à la source d’une cascade de réactions dans l’organisme résultant de l’altération des conditions environnementales. Cette cascade se répercute ensuite à des niveaux d’organisation biologique plus élevés, depuis la survie et le succès reproducteur des individus jusqu’aux conséquences au niveau de la population et de la communauté (Morgan et al., 2007). La connaissance des conséquences phénotypiques du stress couplée aux composantes transcriptomiques induites ou réprimées rend possible une caractérisation plus fine des modes d’action des agents stressants, mais aussi des mécanismes 37 pouvant affecter la croissance, la survie et la reproduction (Heckmann et al., 2008). Cependant, la complexité des processus d’expression génique incite à la prudence dans les conclusions tant il est difficile de maîtriser tous les facteurs génétiques et épigénétiques de régulation agissant et interagissant à trois niveaux, la transcription, la traduction, et le repliement protéique. (Fig.4). Figure 4. Représentation schématique des différents éléments de régulation de l’expression génique. CDS, séquence codante; Co-A/I, co-activateur/inhibiteur; EBS, Site de fixation de l’amplificateur de transcription ; EN, amplificateur de transcription, M, modification, Me, méthylation ; S, stabilisateur d’ARNm; TF, facteur de transcription; TFBS, site de fixation du facteur de transcription, TM, inhibiteur de traduction; Ub, ubiquitine (d’après Morgan et al., 2007). Il y a maintenant une décennie, des chercheurs ont pu mettre en évidence chez D. melanogaster, qu’en réponse à un stress, la régulation de la réponse transcriptomique résulterait de modifications physiques locales de la chromatine changeant l’accessibilité et l’expression de gènes regroupés en clusters, ce qui indiquerait l’existence de « territoires de transcription » (Spellman & Rubin, 2002; Weitzman, 2002). Disposant du génome complet, ils ont pu démontrer que certains groupes de gènes physiquement proches sur les chromosomes, présentaient des profils d’expression comparables en fonction des conditions environnementales. Ces groupes peuvent compter une dizaine de gènes adjacents voire plus et de tels clusters d’expression pourrait concerner 20 % du génome codant. Cela montre comment la génomique peut fondamentalement changer la façon d’appréhender la relation entre les gènes et leur environnement (van Straalen & Roelofs, 2006). 38 Next Generation Sequencing (NGS) Grâce aux progrès techniques et informatiques, l’avènement des technologies de séquençage haut-débit de dernière génération (NGS) a révolutionné les méthodes de séquençage traditionnel (type Sanger) au début des années 2000 élargissant ainsi la portée de ce champs disciplinaire aux problématiques phylogéniques, évolutives, écologiques ou écotoxicologiques. Jusqu’alors restreinte aux espèces modèles du point de vue du génome, telles que Drosophilia melanogaster, Arabidopsis thaliana, Saccharomyces cerevisiae, Caenorhabditis elegans, Mus musculus ou encore Escherichia coli, l’acquisition de données génomiques et transcriptomiques était en plus très longue et coûteuse, nécessitant l’appui de grands consortiums (van Straalen & Roelofs, 2006). Les NGS regroupant les technologies de pyroséquençage 454, les systèmes Illumina ou SOLID, associées aux différentes méthodes statistiques et bioinformatiques d’assemblages, de comptage et d’annotations, ont considérablement diminué les coûts associés à ces projets, permettant ainsi de les appliquer aux espèces non-modèles (Wang et al., 2009). Ainsi, d’après la Genomes OnLine Database (GOLD) créée en 1997, 20327 projets étaient enregistrés en octobre 2012, parmi lesquels environ 4000 sont déjà complets (http://www.genomesonline.org) (fig.5). Leur nombre en nette croissance depuis 2008 est à corréler à une diminution du coût de tels projets d’une part mais également à l’intégration dans GOLD depuis 2009, des projets de séquençage de transcriptome, de métatranscriptome et de re-séquençage de génome, en plus des projets de génomique et de métagénomique (Pagani et al., 2012). Figure 5. Evolution du nombre des projets de génomiques référencés dans la base de données GOLD en fonction des groupes phylogénétiques. 20327 projets depuis sa création jusqu’à octobre 2012. B, Bactéries ; A, Archeabactéries ; E, Eucaryotes, M, Mammifères. source : http://www.genomesonline.org 39 Cette révolution de la génomique n’est pas seulement due aux avancées en biologie moléculaire. Les progrès des nanotechnologies, notamment grâce à la technologie laser, ont ouvert les portes d’un « nanomonde ». De plus, des technologies informatiques d’analyse se sont développées en conséquence pour s’adapter aux procédures d’assemblage basées sur des programmations complexes et nécessitant de grandes puissances de calcul. Enfin, les technologies de communication ont joué un rôle primordial pour la consultation des bases de données génomiques nécessaires aussi bien pour l’assemblage que pour l’annotation. L’utilisation d’outils tels que les bases de données GO (Gene Onthology) et KEGG (Kyoto Encyclopedia of Genes and Genomes) permettent de raisonner à plus large échelle en termes de processus moléculaires, cellulaires, métaboliques et de replacer les résultats obtenus dans le contexte des voies de signalisation déjà connues et partiellement définies. Dans une approche transcriptomique utilisant la technologie RNAseq, la génération de séquences courtes de ~100pb augmente la profondeur d’analyse. l’intérêt est non seulement de caractériser les gènes exprimés, mais aussi de quantifier leur expression de façon absolue ou relative (Wang et al., 2009). Elle permet en quelque sorte d’obtenir une photo instantanée du transcriptome, c'est-à-dire obtenir la quasi-totalité de l’activité transcriptionnelle d’un génome à un instant t et dans une condition donnée. Potentiel des NGS en écotoxicologie évolutive Les possibilités d’investigation de la variation génétique naturelle (à de multiples niveaux de variation) permises par les NGS, sont une source d’information sans précédents (Gilad et al., 2009). Cependant, la technologie RNAseq étant relativement récente, peu d’applications en écotoxicologie et en biologie évolutive ont déjà été publiées, mais de nombreux projets utilisant les NGS émergent actuellement ou sont en cours d’avancement. On peut toutefois mentionner l’acquisition récente de ressources transcriptomiques couplées à deux études d’expression différentielle en présence ou en absence de stress thermique chez la moule d’eau douce Villosa lienosa (Wang et al., 2012) et chez le copépode Tigriopus californicus suggérant des divergences génétiques adaptatives entre deux populations naturelles (Schoville et al., 2012). A noter également l’étude de De Wit et Palumbi (2012) explorant la structure génétiques entre trois populations naturelles d’ormeaux Haliotis rufescens, via la recherche de polymorphisme SNPs (Single Nucleotide Polymorphism) le long d’un gradient thermique. 40 4. Le modèle biologique : Lymnaea stagnalis Dans cette thèse, l’étude du potentiel évolutif des réponses au stress est réalisée chez la limnée des étangs, Lymnaea stagnalis, un gastéropode pulmoné d’eau douce occupant des habitats lentiques. De par sa large distribution, L. stagnalis est une espèce représentative des milieux lentiques d’eau douce et de la communauté herbivore invertébrée. Les escargots d’eau douce sont estimés représenter 20 à 60 % de la biomasse totale de la communauté invertébrée dans ces milieux où ils jouent un rôle essentiel dans la chaine alimentaire (Habdija et al., 1995). De telles espèces sont considérées comme étant de bons modèles pour estimer l’impact évolutif de pollutions agricoles liées à l’usage de pesticide (Coutellec et al., 2011). En effet, les milieux aquatiques lentiques localisés au sein des paysages agricoles sont susceptibles d’être exposés de façon récurrente à la contamination par les pesticides, via des processus variés tels que la dérive durant l’application, le ruissellement et le drainage (Liess, 2002; Brown & van Beinum, 2009). Les espèces non-cibles occupant ces milieux sont par conséquent exposées à un risque important d’impact évolutif. Ce risque est d’autant plus important pour les espèces habitant des mares, fossés ou petits étangs et pour lesquelles le cycle complet est aquatique (Coutellec et al., 2011). En effet, d’une part l’absence de flux génique entre populations facilite en théorie les processus adaptatifs locaux, et d’autre part, la petite taille des populations augmente les effets de dérive génétique (Richards, 2000; Whitlock et al., 2000). Le patron de sélection opérant sur ces populations naturelles dépend donc de l’intensité relative de ces forces, sachant que la sélection est moins efficace dans les petites populations (Keller and Waller, 2002), leur potentiel adaptatif vis-à-vis du changement environnemental étant limité (Willi et al., 2006). D’un point de vue taxonomique, L. stagnalis appartient au groupe des gastéropodes hermaphrodites, sous-ordre des Basommatophores (Escobar et al., 2011). Bien que sa préférence pour la fécondation croisée ait été démontrée à plusieurs reprises, la dépression de consanguinité chez cette espèce semble très réduite (Puurtinen et al., 2007; Coutellec & Caquet, 2011). L. stagnalis est utilisée comme organisme modèle dans divers domaines de recherche incluant, l’écologie comportementale (Hoffer et al., 2010), la biologie évolutive (Coutellec and Caquet, 2011), la parasitologie (Adema et al., 1994), l’écotoxicologie aquatique (Coutellec & Lagadic, 2006; Coutellec et al., 2011; Byzitter et al., 2012) et la neurophysiologie (Carter et al., 2006). Au début de ce projet de thèse, les ressources 41 génétiques disponibles pour cette espèce comprenaient deux banques EST produites par séquençage de type Sanger (Davison & Blaxter, 2005; Feng et al., 2009), ainsi qu’un jeu de 392 séquences nucléotidiques (Genbank) et 15 loci microsatellites (Knott et al., 2003; Kopp & Wolf, 2007). Un consortium visant à séquencer son génome était également en construction (voir http://www.lymnaea.org). De plus, la souche Renilys® élevée dans l’unité expérimentale (U3E) de l’INRA de Rennes est actuellement candidate en tant qu’espèce modèle pour un test de reprotoxicité standardisé de l’OCDE. 5. Stress d’intérêt : le stress oxydant Un rôle évolutif primordial et paradoxal Il y a environ 2,45 milliards d’années commence une augmentation de la concentration en dioxygène (O2) dans l’atmosphère initiée par l’activité photosynthétique des premières cyanobactéries dans les océans, pour se stabiliser en quelques 100 millions d’années au 21% que nous connaissons actuellement (Sessions et al., 2009). Le stress oxydant généré par ce nouveau « polluant » a provoqué des ravages considérables sur les premières formes de vies anaérobies, favorisant la sélection des espèces aptes à développer des systèmes de défense appropriés à l’aérobiose. Ces systèmes antioxydants ont ensuite évolué au gré de la complexification d’une partie du monde vivant optant pour la respiration. Grâce à l’endosymbiose de protéobactéries ancestrales à l’origine des mitochondries, les premiers organismes eucaryotes ont pu tirer profit de l’apport d’énergie issue du métabolisme de l’O2, tout en se protégeant de ses dérivés pro-oxydants générés au cours des différentes étapes de sa réduction (ROS pour reactive oxygen species), pouvant nuire à l’intégrité et aux fonctions des macromolécules (protéines, phospholipides, ADN, etc.) (Costantini et al., 2010). Cependant, le rôle des ROS est paradoxal. Bien que toxiques et responsable du vieillissement cellulaire (Junqueira et al., 2004), leur forte réactivité chimique joue un rôle essentiel dans la communication intracellulaire, une certaine concentration minimale étant même nécessaire pour maintenir l’homéostasie et le bon fonctionnement cellulaire (D'Autreaux and Toledano, 2007). Environ 90% des ROS générées au niveau intracellulaire proviennent de la respiration mitochondriale, les 10 % restants étant produits par des cyclo-oxydases cytosoliques, des NADPH transmembranaires ou dans les peroxisomes au cours du métabolisme des lipides (Balaban et al., 2005). Au niveau physiologique, les ROS interviennent aussi dans de nombreux processus, tels que la régulation de la circulation sanguine, la relaxation des 42 muscles lisses ou les défenses immunitaires (Dröge, 2002) (Fig. 6). Dans des conditions environnementales stressantes, la perturbation de l’équilibre redox dans les tissus peut être à l’origine de nombreux dysfonctionnements. Le stress oxydant est une source potentielle de trade-offs pour la valeur sélective façonnant depuis son apparition les multiples chemins de l’évolution (Monaghan et al., 2009). Pour se prémunir des cascades réactionnelles d’oxydation induites par le non-contrôle des ROS, les organismes aérobies ont développé des systèmes enzymatiques et non-enzymatiques. Elimination Production Chaîne de Transport d’électrons Neutralisants de faible masse moléculaire Oxygénases Auto-oxydation Etat d’équilibre du niveau de ROS Systèmes spécifiques (NADPH-oxydase NO-synthase) Effets / Fonctions Conséquences Antioxydants de forte masse moléculaire Détérioration des constituants cellulaires Régulation des processus cellulaires Attaque de corps étrangers Lésion cellulaire, apoptose, nécrose Adaptation aux changements internes et environnementaux Protection de l’organisme contre l’infection Figure 6. Schéma des mécanismes impliqués dans la production, l’élimination des ROS ainsi que de leurs potentiels effets biologiques (d’après Luschback 2011). Les systèmes de défense antioxydants Les systèmes de défense contre les ROS incluent des enzymes anti-oxydantes telles que la superoxide dismutase (SOD), qui réduit l’anion superoxyde O2.- en peroxyde d’hydrogène H2O2, à son tour réduit par la catalase (Cat) ou la glutathion péroxidase (GPx) en H2O et O2. La GPx, utilisant le glutathion comme co-faceur, participe au cycle du glutathion impliquant également la glutathion réductase (GRed) et les glutathion S-transferases (GSTs), 43 enzymes de détoxication secondaire (Lushchak, 2011). Selon le tissu et l’espèce, le facteur de transcription RXR (récepteur X de rétinoïdes) est reconnu pour jouer un rôle dans la réponse au stress oxydant, notamment en activant des réponses de détoxication de phase II (Kang et al., 2005), la production de facteurs anti-apoptotiques ou encore l’activation de catalase (Shan et al., 2008). Toutes ces enzymes et protéines sont donc des biomarqueurs d’effets potentiels pour l’étude du stress oxydant. Les dommages causés aux protéines nécessitent l’intervention de protéines chaperons telles que les Heat Shock Proteins (HSPs) pour préserver leur activité fonctionnelle, prévenir leur agrégation et faciliter leur dégradation en cas de dommage irréversible (Qiu et al., 2006; Kim et al., 2007). On peut citer notamment HSP70 qui est la protéine chaperon la plus étudiée chez les invertébrés, impliquée dans la réponse à de nombreux types de stress, elle est utilisée comme biomarqueur de toxicité (Lee et al., 2006; Park et al., 2009; Park et al., 2010). De par leur rôle vital dans la réponse physiologique au stress, les HSPs ont été fortement conservées au cours de l’évolution. Leurs activités réparatrices diminueraient ou amplifieraient les variations phénotypiques en fonction de leur quantité et de l’intensité des stress. En assurant le bon repliement fonctionnel des protéines malgré la présence éventuelle de mutations, les protéines chaperons contribuent au maintien du polymorphisme génétique dans les populations quand les conditions du milieu sont normales. C’est en particulier le cas de HSP90, connue pour réparer lors du développement l’effet de mutations (voir Yeyati et al. 2007). Ces variations augmentent alors la capacité d’expression de caractères phénotypiques héritables adaptés en cas de changements environnementaux (Rutherford, 2003). En cas de stress oxydant, elles participent donc activement à la réponse en limitant l’accumulation de protéines dénaturées potentiellement cytotoxiques. La dégradation et le recyclage des protéines impactées sont assurés dans des péroxisomes susceptibles de proliférer en cas de stress (Schrader & Fahimi, 2006; Aiken et al., 2011). Lorsque l’intensité du stress dépasse le seuil de tolérance des cellules, les processus apoptotiques constituent souvent le dernier rempart face à la nécrose des cellules qui engendrent des effets en cascade sur leurs cellules adjacentes. L’apoptose est un mécanisme de mort cellulaire programmée dont les caractéristiques physiologiques et biochimiques présentent également de fortes homologies entre les espèces. De l’équilibre redox des cellules dépendent l’induction ou l’inhibition de ces mécanismes, le système antioxydant et les ROS agissant à de nombreux points clés dans la signalisation de ces processus (Kannan & Jain, 44 2000; Alberts et al., 2008). Les dysfonctionnements de ses systèmes sont à l’origine de nombreuses pathologies tels que des cancers, des déficiences immunitaires ou encore des maladies neuro-dégénératives (Junqueira et al., 2004; Balaban et al., 2005). La toxicité de nombreux polluants tels certains produits pharmaceutiques, métaux lourds ou autres pesticides pouvant se retrouver dans les milieux aquatiques, est induite par du stress oxydant (Scandalios, 2005; Valavanidis et al., 2006). Le diquat, un herbicide générateur de stress oxydant. Le diquat est un herbicide non sélectif de la famille des bipyridyles (Fig. 7). Il fait partie de la première génération d’herbicides synthétiques commercialisés dans les années 1940 (Karuppagounder et al., 2012). Depuis, de nombreuses formulations contenant cette substance active seule ou combinée à d’autres agents similaires tels que le paraquat, sont utilisées en agriculture, notamment pour le désherbage dans les vignes, le défanage des cultures de pomme de terre ou encore la récolte de cultures portegraines (betterave, colza, tournesol) (US-EPA, 1995; Ritter et al., 2000; FAO, 2008; French Ministry of Agriculture, 2012). Figure 7. Représentation du dibromure de diquat. (Br2C12H12N2) En France, il est commercialisé par Syngenta sous la marque Reglone 2® et utilisé en association avec l’Agral 90, un adjuvant tensioactif à base de nonylphénols polyéthoxylés. En moyenne, 90% de sa production est utilisé en Amérique du Nord, Europe, Australie et Japon bien qu’il soit considéré comme un toxique majeur et suspecté responsable de nombreux cas de Parkinson parmi les anciens utilisateurs (Karuppagounder et al., 2012). Cependant, selon des estimations probabilistes des risques et de modélisations de données d’expositions et de toxicité (Bartell et al., 2000; Campbell et al., 2000), peu d’impacts écologiques du diquat ont été démontrés sur les invertébrés et les poissons, les principales conclusions indiquant une dissipation rapide du cation diquat dans l’eau (Ritter et al., 2000). Ainsi, son utilisation pour le faucardage des étangs est jugée sans risques, autorisée et même recommandée. Il est établi que la toxicité du diquat et plus généralement celle des herbicides de la famille des bipyridyles, est élicité par l’induction de stress oxydant (Smith et al., 1985), 45 susceptible de perturber des processus physiologiques chez les organismes aquatiques (Schultz et al., 1995; Figueiredo-Fernandes et al., 2006; Sanchez et al., 2006). Etant donné ses propriétés pro-oxydantes, le diquat est très utilisé comme molécule modèle en toxicologie et en biologie cellulaire dans les tests in vivo et in vitro pour l’étude du stress oxydant chez les mammifères (Crabtree et al., 1977; Smith et al., 1985; Gallagher et al., 1995; Anton et al., 2002; Rogers et al., 2006). Ce puissant hépatotoxique est capable d’induire le transfert d'électrons de NADPH (NADH) vers l’O2, ce qui génère un flux d'O2.-, ainsi que de réduire les ions ferriques (Fe3+) en ions ferreux (Fe2+), soit indirectement par O2.- et H2O2, soit directement via les espèces de cations radicaux bipyridil (Smith et al., 1985; Sandy et al., 1986; Thomas & Aust, 1986). Une étude transcriptomique conduite sur des tissus hépatiques de truite arc-en-ciel Oncorhynchus mykiss et basée sur des puces à ADN, a montré que le diquat impactait l’expression de nombreux gènes (Hook et al., 2006). Chez L. stagnalis, des perturbations sur divers traits d’histoire de vie tels que le taux d’éclosion, la croissance et la survie des juvéniles et des adultes ont déjà été constatées lors d’expositions en laboratoire à des concentrations de diquat écologiquement réalistes (Coutellec et al., 2008; Ducrot et al., 2010). Une induction significative de l’apoptose des hémocytes a également été démontrée par microscopie à fluorescence après 48h d’exposition à 44,4 et 222,2 µg/L, tandis que les mesures de certaines activités enzymatiques antioxydantes dans le complex gonado-digestif après deux à 31 jours d’exposition se sont révélées peu concluantes (Lagadic, 2007). Ainsi, de par l’utilisation répandue et déjà ancienne de ses propriétés herbicides en agriculture et dans le contrôle de la végétation aquatique, son pouvoir pro-oxydant, la connaissance partielle mais croissante de ses mécanismes de toxicité au niveau cellulaire et les différents effets sub-létaux déjà constatés chez L. stagnalis, le diquat semble être une molécule très pertinente pour estimer le potentiel évolutif de la réponse moléculaire vis-à-vis du stress oxydant chez cette espèce. 46 6. Hypothèses, problématique, objectifs et démarche scientifique. Le projet se place dans le contexte de l’évaluation du risque écotoxicologique lié à l’utilisation de pesticides. Cette démarche inclut la recherche de marqueurs d’exposition et d’effet, ainsi que la mise au point de modèles prédictifs. L’intégration d’une dimension évolutive à ces questions de recherche est assez récente et reflète la prise de conscience actuelle de l’impact à long terme de l’exposition des organismes aux polluants, et des processus adaptatifs et/ou d’extinction qui peuvent se développer au fil des générations. Hypothèse initiale Dans cette thèse, nous nous intéressons aux composantes évolutives de la réponse des populations naturelles de Lymnaea stagnalis vis-à-vis du stress environnemental généré par les pesticides et autres polluants présents en milieu aquatique. L’objectif est d’explorer les systèmes moléculaires de défense régulant les effets du stress oxydant chez cette espèce non cible, ainsi que leur potentiel évolutif. Ce stress pouvant résulter de la toxicité induite par un grand nombre de xénobiotiques, l’hypothèse générale de ce projet suppose que ce type de perturbations répétées ou chroniques pourrait entraîner des processus de différenciation adaptative entre populations naturelles de L. stagnalis situées à proximité des activités agricoles ou de façon plus générale, à proximité des activités humaines. Problématique La recherche de tels patrons sélectifs chez notre espèce modèle passe tout d’abord par une caractérisation plus fine de ses systèmes moléculaires antioxydants, de leurs éventuels liens avec les traits relatifs à la valeur sélective, et l’étude de la composante génétique de ces caractéristiques phénotypiques (incluant les réponses moléculaires) aux niveaux intra et interpopulations. Ce projet de thèse s’articule autour de quatre questions centrales : Q1 Existe-t-il une divergence génétique phénotypique et moléculaire entre populations naturelles génétiquement différenciées du point de vue neutre ? Q2 L’exposition historique aux stress d’origine anthropique peut-elle entraîner une divergence adaptative des populations (sélection divergente sur les traits d’histoire de vie) ? 47 Q3 A l’échelle moléculaire, observe-t-on une variation inter-populations dans la réponse au stress oxydant généré par le diquat ? Si tel est le cas, cette variation résulte-t-elle des pressions de sélection d’origine anthropique auxquelles sont soumises les populations impliquées ? Q4 Quel est le potentiel adaptatif de ces populations naturelles vis-à-vis du stress d’origine anthropique en général ? Objectifs Les enjeux sont doubles. Ils sont cognitifs d’une part, visant à l’acquisition de connaissances sur les mécanismes populationnels évolutifs chez les organismes exposés de façon non intentionnelle à des substances xénobiotiques, et de façon plus spécifique, à une meilleure compréhension des réponses moléculaires antioxydantes chez L. stagnalis. D’autre part, ce projet a pour finalité de proposer des outils pouvant servir dans le contexte de l’évaluation du risque écologique, grâce à la recherche d’indicateurs de processus adaptatifs ou d’extinction et à l’estimation des conséquences à long-terme des expositions aux pesticides dans les écosystèmes aquatiques situés dans les paysages agricoles. Démarche scientifique Dans ce projet, l’étude de la réponse au stress oxydant chez L. stagnalis a été réalisée via des expositions au diquat, un herbicide reconnu pour son fort pouvoir oxydant. • Dans le but de mieux caractériser sa toxicité au niveau moléculaire et définir les conditions d’expositions (temps x concentration) permettant d’obtenir les réponses les plus contrastées, une étude préliminaire évaluant par PCR quantitative l’expression de gènes cibles potentiels parmi les ressources génétiques disponibles, et quelques activités enzymatiques associées, a été réalisée sur deux tissus, l’hémolymphe et le complexe gonado-digestif, de la population de laboratoire Renilys®. • Sur la base des résultats obtenus lors de cette approche préliminaire ont été définies les conditions expérimentales des tests d’écotoxicité utilisées dans le reste du projet de thèse. Afin d’augmenter de façon significative des ressources transcriptomiques jusque là très limitées pour l’investigation à grande échelle des réponses moléculaires, 48 deux librairies d’ADN complémentaires (ADNc), regroupant les transcriptomes de 3 populations exposées ou non à l’agent oxydant, ont été séquencées lors d’un run de pyroséquençage 454 (AIP Bioressources INRA, projet EGELys). Une première analyse transcriptomique d’expression différentielle a été réalisée à cette occasion permettant de mieux cibler les voies de signalisation potentiellement impactées par le diquat. De plus, en parallèle de ce projet, de nouveaux marqueurs microcatellite ont été mis au point et font l’objet d’une primer note. • L’étude a ensuite porté sur 14 populations naturelles échantillonnées dans des milieux contrastés du point de vue de la pression pesticide pour tester l’hypothèse de divergence adaptative associée aux processus sélectifs locaux, grâce à une analyse statistique multifactorielle de la variation génétique de 11 traits d’histoire de vie mise en relation avec la variation génétique neutre basée sur 12 marqueurs microsatellites dans une approche QST-FST. • Enfin, la composante évolutive / adaptative des réponses moléculaires de L. stagnalis au stress pesticide a été étudiée en comparant l’expression différentielle entre diquat et condition témoin de différentes familles maternelles issues d’un sous-jeu de 4 populations naturelles. Un total de 16 librairies a été séquencé par RNAseq sur une demie flow-cell Illumina Hiseq2000. Ici, l’intérêt majeur de l’examen des réponses (post)génomiques est qu’il informe sur une réponse intégrée à l’échelle des organismes, les normes de réactions pouvant mettre en évidence d’éventuelles interactions G x E. Ces différents points font l’objet des quatre chapitres suivants présentés sous la forme de quatre articles scientifiques, deux déjà publiés, deux en préparation et une note. Pour terminer, les résultats obtenus permettront de discuter l’influence de l’exposition chronique aux pesticides sur le potentiel évolutif des populations naturelles étudiées ainsi que l’intérêt de considérer de telles problématiques dans les procédures d’estimations des risques. 49 Chapitre II - Impacts moléculaires d’un herbicide prooxydant chez L. stagnalis: approche « gènes candidats » 50 Ce premier chapitre présente le travail réalisé en première étape de la thèse, et visant à mieux comprendre les mécanismes moléculaires de réponse sollicités chez Lymnaea stagnalis lors d’une exposition à la substance active d’un herbicide générateur de stress oxydant, le dibromure de diquat. Sur la base des ressources génétiques initialement disponibles chez L. stagnalis, des marqueurs transcriptionnels ont été mis au point par PCR quantitative pour évaluer l’impact du diquat sur un ensemble de gènes candidats, codant pour : la catalase (cat), une superoxyde dismutase cytosolique (Cu / Zn-sod), une glutathion peroxydase sélénium-dépendante (gpx), une glutathion réductase (gred), le récepteur rétinoïde X des rétinoïdes (rxr), deux protéines chaperons (hsp40 et hsp70). L’expression de ces gènes a été étudiée dans deux tissus supposés répondre au stress généré par la substance testée, la glande digestive et l’hémolymphe, chez des individus issus de la souche INRA Renilys®. Les niveaux de transcription des gènes codant pour la cortactine (cor) et les sous-unités ribosomiques r18S et r28s ont aussi été étudiés dans le but initial de normaliser l’expression des gènes cibles. Les activités enzymatiques de SOD, Gpx, Gred et de la glutathion S-transférase (GST) ont également été étudiées dans la glande digestive via des méthodes spectrophotométriques et fluorimétriques. Sur la base de résultats antérieurs issus d’analyses biochimiques menées sur la même souche de L. stagnalis (Lagadic et al., 2007), nous avons choisi d’explorer les effets du diquat sur les réponses moléculaires précoces. Nous avons ainsi exposé des individus pendant des temps relativement courts (5, 24 et 48 heures), à trois concentrations de diquat considérées comme réalistes du point de vue des doses environnementales (22,2 ; 44,4 et 222,2 µg/L) ; la plus forte de ces concentrations correspond à la dose maximale d’application recommandée pour le faucardage des étangs (Ritter et al., 2000), et reste proche des valeurs maximales mesurées dans le milieu naturel après traitement (Emmett, 2002). Globalement, ce travail a apporté des résultats intéressants sur la toxicité du diquat sur la limnée. Les valeurs d’expression normalisées selon une méthode basée sur le niveau d’expression de l’ensemble des gènes étudiés (i.e., NormaGene ; Heckmann et al., 2011), a mis en évidence une perturbation significative de l’ensemble des gènes cibles, ainsi que des gènes initialement utilisés comme référence (« gènes de ménage ») selon la méthode classique basée sur l’expression relative (i.e., GeNorm ; Vandesompele et al., 2002). Dans l’hémolymphe, le sens des effets diffère selon la concentration et le temps d’exposition: à la surexpression significative de cor, hsp40, rxr, et sod, après 24 hrs d’exposition à la plus faible 51 concentration, s’oppose une régulation négative de l'expression de la plupart des gènes étudiés sous la plus forte concentration, surtout après 48 heures d'exposition. Ce résultat tend à confirmer l’observation antérieure d’une induction massive de processus apoptotiques sous ces conditions. Dans le tissu de la glande digestive, des réponses plus précoces et d’amplitudes plus élevées ont été obtenues. Quelle que soit la concentration en diquat, la transcription de tous les gènes cibles a augmenté de manière significative (excepté pour cat) après 5 heures d'exposition, avant de revenir aux niveaux des conditions témoin après 24 et 48 heures d’exposition. Ces résultats suggèrent une forte réactivité des réponses moléculaires vis-à-vis du stress oxydant induite par une perturbation de l’équilibre homéostatique des espèces réactives de l'oxygène (ROS) dans les hépatocytes. Bien que l’augmentation d’activité enzymatique de Gred et SOD soient globalement conformes aux niveaux de transcription des gènes correspondants, nous avons constaté qu’une augmentation de la transcription n'était pas toujours accompagnée de l'augmentation de l'activité enzymatique associée. Ce résultat indique un effet post-transcriptionnel du diquat, qui peut concerner la traduction, le repliement protéique ou l’activation des domaines catalytiques. Dans un contexte d’utilisation de ces réponses comme biomarqueur, le maintien des activités enzymatiques à un niveau constitutif en présence de diquat montre que l’absence d’observation de réponse significative au niveau fonctionnel (activité enzymatique) peut masquer des effets toxiques plus en amont, et met en évidence un risque de sous-estimation des effets. En conclusion, ce travail représente à notre connaissance la première étude démontrant la mise place, chez un gastéropode d’eau douce, de réponses moléculaires au stress oxydant induites par la toxicité du diquat, un herbicide utilisé en traitement de cultures mais aussi pour le contrôle des plantes aquatiques. Les résultats permettent de justifier l’utilisation de cette molécule dans le cadre de l’objectif général de la thèse, qui porte sur le potentiel évolutif des réponses moléculaires chez L. stagnalis, en particulier vis-à-vis du stress oxydant. Par ailleurs, d’un point de vue secondaire plus finalisé, les marqueurs d’expression génique mis au point constituent des outils utiles pour l’étude du stress oxydant chez L. stagnalis. Ce chapitre a fait l’objet d’un article accepté en novembre 2012 et publié en janvier 2013 dans la revue Aquatic toxicology (vol 126: 256-265). 52 Article 1 - Impact of the redox-cycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis Anthony Bouétard1§, Anne-Laure Besnard1, Danièle Vassaux1, Laurent Lagadic1, MarieAgnès Coutellec1 1 INRA, UMR INRA-Agrocampus Ouest ESE 0985, Equipe Ecotoxicologie et Qualité des Milieux Aquatiques. 65 rue de Saint-Brieuc, 35042 Rennes cedex, France. § Corresponding author at: Tel : +33 2 2348 5529 ; E-mail : [email protected] Keywords: Oxidative stress, Pesticides, Molecular response, Haemolymph, Digestive gland, Pond snail. 53 Abstract The presence of pesticides in the environment results in potential unwanted effects on non-target species. Freshwater organisms inhabiting water bodies adjacent to agricultural areas, such as ditches, ponds and marshes, are good models to test such effects as various pesticides may reach these habitats through several ways, including aerial drift, run-off, and drainage. Diquat is a non-selective herbicide used for crop protection or for weed control in such water bodies. In this study, we investigated the effects of diquat on a widely spread aquatic invertebrate, the holarctic freshwater snail Lymnaea stagnalis. Due to the known redox-cycling properties of diquat, we studied transcript expression and enzymatic activities relative to oxidative and general stress in the haemolymph and gonado-digestive complex (GDC). As diquat is not persistent, snails were exposed for short times (5, 24, and 48 hrs) to ecologically relevant concentrations (22.2, 44.4, and 222.2 µg l-1) of diquat dibromide. RTqPCR was used to quantify the transcription of genes encoding catalase (cat), a cytosolic superoxide dismutase (Cu/Zn-sod), a selenium-dependent glutathione peroxidase (gpx), a glutathione reductase (gred), the retinoid X receptor (rxr), two heat shock proteins (hsp40 and hsp70), cortactin (cor) and the two ribosomal genes r18S and r28s. Enzymatic activities of SOD, Gpx, Gred and glutathione S-tranferase (GST) were investigated in the GDC using spectrophoto/fluorometric methods. Opposite trends were obtained in the haemolymph depending on the herbicide concentration. At the lowest concentration, effects were mainly observed after 24 hrs of exposure, with over-transcription of cor, hsp40, rxr, and sod, whereas higher concentrations down-regulated the expression of most of the studied transcripts, especially after 48 hrs of exposure. In the GDC, earlier responses were observed and the foldchange magnitude was generally much higher: transcription of all target genes increased significantly (or non-significantly for cat) after 5 hrs of exposure, and went back to control levels afterwards, suggesting the onset of an early response to oxidative stress associated to the unbalance of reactive oxygen species (ROS) in hepatocytes. Although increases obtained for Gred and SOD activities were globally consistent with their respective transcript expressions, up-regulation of transcription was not always correlated with increase of enzymatic activity, indicating that diquat might affect steps downstream of transcription. However, constitutive levels of enzymatic activities were at least maintained. In conclusion, diquat was shown to affect expression of the whole set of studied transcripts, reflecting their suitability as markers of early response to oxidative stress in L. stagnalis. 54 Introduction The presence of pesticides in the environment results in potential unwanted effects on non-target species. Assessing such effects is a complicated task, in part due to the fact that they may not be related to the mode of action of the molecules in target species. Freshwater organisms inhabiting water bodies adjacent to agricultural parcels, such as ditches and marshes, are good models to test such effects as various pesticides may reach these habitats through several ways, including aerial drift, run-off, and drainage (Brown and van Beinum, 2009). Diquat is a non-selective herbicide of the bipyridylium class, which was first commercially available in the 1940s with the advent of first ever synthetic herbicides (Karuppagounder et al., 2012). Since then, various formulations containing diquat alone or in combination with other similar herbicidal agents such as paraquat, have been widely used in crop protection (potato, banana, vine and other seed crops), and also in aquatic systems for the control of submersed, floating and emerging weeds (US-EPA, 1995; Ritter et al., 2000; FAO, 2008; French Ministry of Agriculture, 2012). On average, 90% of diquat consumption is reported in North America, Europe, Australia and Japan, although it is considered as a major toxic, possibly responsible for cases of Parkinson’s disease (Karuppagounder et al., 2012). It is now established that the toxicity of diquat is elicited by oxidative stress (Smith et al., 1985), as this is also the case for a number of xenobiotics, including pharmaceuticals, metals and pesticides (Scandalios, 2005; Valavanidis et al., 2006). Bipyridyl herbicides induce the production of reactive oxygen species (ROS), which may impair physiological processes in aquatic organisms (Schultz et al., 1995; Figueiredo-Fernandes et al., 2006; Sanchez et al., 2006). However, little ecological impact on invertebrates and fish was demonstrated for diquat, as shown by probabilistic risk assessment, exposure and toxicity data, and modelling of ecological processes (Bartell et al., 2000; Campbell et al., 2000). This conclusion mainly results from very rapid dissipation of diquat cation in water (Ritter et al., 2000). Furthermore, once bound to sediment and soil, diquat is no longer biologically available. Therefore, due to the minimal risk posed by diquat, the use of this herbicide for weed control is considered safe and recommended. However, as a consequence, non target organisms such as freshwater invertebrates are expected to be more often exposed to diquat, regardless of its dissipation time. For these organisms, adverse effects of diquat are not clearly characterized yet (Emmett, 2002). 55 Among aquatic invertebrates, Lymnaea stagnalis is a mollusk representative of lentic habitats, and of the herbivorous community compartment, which may be regularly exposed to diquat, either when the water is treated directly or when adjacent parcels are treated, as lentic systems are the ultimate recipient of many chemicals, through various transfer processes (Brown and van Beinum, 2009). Diquat has been shown to affect various life history traits, such as hatching rate, juvenile and adult growth, and survival, in L. stagnalis (Coutellec et al., 2008; Ducrot et al., 2010). Previous investigations on antioxidant enzymatic activities were conducted in L. stagnalis exposed during two to 31 days to 4.4 to 222.2 µg l-1 diquat, showing only slight perturbations (Lagadic, 2007). From these results, we hypothesized that the onset of more contrasted cellular responses might occur earlier, i.e. within the first two days of exposure. Given its oxidative properties, diquat is widely used as model chemical for in vivo and in vitro studies of oxidative stress in toxicology and cellular biology using mammalian models (Crabtree et al., 1977; Smith et al., 1985; Gallagher et al., 1995; Anton et al., 2002; Rogers et al., 2006). This potent hepatotoxicant is able to mediate the transfer of electrons from NADPH (NADH) to O2, which generates a flux of superoxide anion (O2.-), as well as to reduce ferric ions (Fe3+) into ferrous ions (Fe2+), either indirectly by O2.- and H2O2, or directly by the bipyridil cation radical species (Smith et al., 1985; Sandy et al., 1986; Thomas and Aust, 1986). In a microarray expression study, diquat was shown to cause large changes in transcription in rainbow trout liver (Hook et al., 2006). Although most studies were conducted on vertebrates, the resulting corpus of knowledge is a useful reference for molecular investigations in less known models such as invertebrates. In this context, we have recently generated new transcriptomic resources from multi-tissue extracts of snails exposed to diquat (Bouétard et al., 2012). In the present study, effects of diquat in L. stagnalis were explored on a set of genes encoding proteins presented hereafter, most of which being involved in oxidative pathways. Despite their toxic effects, ROS are natural by-products of aerobic metabolism and are thought to mediate the toxicity of oxygen. They also act as intracellular signalling molecules, under mechanisms that are not yet fully understood, even in the most widely studied models, i.e., mammalian models (Poulsen et al., 2000; D'Autreaux and Toledano, 2007). Defence systems against ROS include antioxidant enzymes such as superoxide dismutase (SOD), which reduces O2.- to H2O2, in turn reduced by catalase (Cat) or glutathione peroxidase (GPx) into H2O and O2. GPx, using glutathione as co-factor, is a protagonist of the glutathione cycle 56 which also involves glutathione reductase (Gred) and the second phase detoxication enzyme glutathione S-transferases (GSTs) (Lushchak, 2011). Depending on tissues and species, the transcription factor retinoid X receptor (RXR) is recognized to play different roles in response to oxidative stress, such as activator for the phase II detoxication induction (Kang et al., 2005), anti-apoptotic factor, and inhibitor of intracellular ROS generation by up-regulating catalase activity (Shan et al., 2008). ROS may also induce protein misfolding. Accumulation of misfolded proteins in stressed cells activates heat shock factors and results in the expression of Heat shock proteins (Hsps) (Kim et al., 2007). Hsps have the ability to restore the damaged proteins to their functional three-dimensional structure, to prevent aggregation of unfolded proteins, or to facilitate their degradation in case of irreversible damage (Qiu et al., 2006; Grune et al., 2011). Hsp70, which may act with its co-chaperone Hsp40 (Kim et al., 2007), is the most studied Hsp in aquatic invertebrates, and is commonly used as a biomarker inducible by pollutants (Lee et al., 2006; Park et al., 2009; Park et al., 2010). The present study aimed at investigating the mechanisms of diquat toxicity in L. stagnalis, through the exploration of enzymatic and molecular “candidate” responses which may be reasonably linked to the mode of action of this herbicide. Thus, RT-qPCR was used to study the transcription of genes encoding catalase (cat), a cytosolic superoxide dismutase (Cu/Zn-sod), a selenium-dependent glutathione peroxidase (gpx), glutathione reductase (gred), retinoid X receptor (rxr), two heat shock proteins (hsp70 and its co-chaperone hsp40), the ribosomal genes r18S and r28s and the gene encoding cortactin (cor), an actin-binding protein involved in exocytosis and endocytosis processes (Clark et al., 2007; Sung and Weaver, 2011). Gene transcription was investigated in the haemolymph and in the gonadodigestive complex (GDC) of snails exposed to diquat in its dibromate form, at concentrations of 22.2, 44.4 and 222.2 µg l-1 during 5, 24 and 48 hrs. In the GDC, temporal transcript expression profiles were complemented by measurements of antioxidant enzymatic activities of SOD, Gpx, Gred and GST. 57 Material and methods Chemical Technical diquat dibromate hydrate (6,7-Dihydrodipyridol[1,2-a:2’,1’-c]pyrazidiium dibromide) was purchased from Cluzeau Info Labo, Sainte Foy la Grande, France. Solutions were prepared in pure distilled water. Snails The Renilys strain of Lymnaea stagnalis (Linné, 1758) (Mollusca, Panpulmonata, Heterobranchia) is reared at the Experimental Unit of Aquatic Ecology and Ecotoxicology (U3E, INRA Rennes, France) under controlled conditions (14/10 L / D, 20 ± 1 ° C, pH = 8 ± 1, [O2] > 6 mg l-1, water hardness : 254 mg CaCO3 l-1, regular diet: organic salad) as previously described (Russo and Lagadic 2004). One day prior to exposure, adult snails (27 ± 1 mm shell length) were isolated from the culture and transferred to their 240 ml exposure vessels (one snail per vessel). They were fed with 0.5 g of organic lettuce for the 24 first hours prior exposure. Just before contamination, feces and lettuce leftovers, as well as 5 ml of water were removed from each vessel, so that they contained 235 ml water. Exposure conditions Snails were individually exposed to nominal diquat concentrations of 22.2, 44.4 and 222.2 µg l-1. Diquat was introduced once as 5 ml stock solution for each exposure concentration, poured into the 235 ml water. Exposures were carried out in plastic vessels. Vessel location and contamination order were randomized. After exposure, physico-chemical parameters (temperature, pH, conductivity and oxygen saturation) were measured in control vessels, and a water sample from each treatment was taken and stored at -20°C until HPLC analysis of diquat residues (Laboratoires des Pyrénées, Lagor, France). Tissue sampling Snails were sampled after 5, 24 and 48 hrs of exposure. At each sampling time, three snails (replicates) per diquat concentration were used. Haemolymph was collected after gentle stimulation of the foot sole (Russo and Lagadic, 2004), using a micropipette. 58 Individual haemolymph samples were transferred into 300 µL of concentrated lysis buffer (Norgen Biotech total RNA purification kit, Ontario, Canada) and stored at -80°C. Immediately after haemolymph collection, animals were frozen in liquid nitrogen. After shell removal, the tip of the digestive gland was plunged into RNAlater® (Ambion) and stored at 80°C. This tissue sample will be hereafter referred to as gonado-digestive complex (GDC), as it may include some parts of the ovotestis (this organ is embedded in the digestive gland and its removal may impair RNA quality). Remaining parts of the body, including proximal part of the digestive gland, were stored at -80°C for biochemical analysis. Transcript expression analysis RNA extraction and cDNA synthesis RNA was extracted from the haemolymph and GDC, using Norgen Biotek kit (Ontario, Canada) and RNeasy Plus Mini kit (Qiagen), respectively. RNAs were eluted in 50 µL of RNase-free water. Concentration and purity of samples were then determined spectrophotometrically (NanoDrop, Thermo, Fisher Scientific), and the concentrations were adjusted to 10 ng µl-1 and 20 ng µl-1 for haemolymph and GDC, respectively. After DNase treatment (DNAse I, Promega), cDNAs were synthesized in a volume of 40 µL using the iScript RT kit (Bio-Rad), according to the manufacturer’s guideline and then stored at -20 °C until qPCR analysis. RT-qPCR analysis and Normalization Gene sequences were retrieved from GenBank (http://www.ncbi.nlm.nih.gov/genbank/). Primers were designed using Primer 3 (Rozen and Skaletsky, 1999) (Tab. 1), and synthesized by Sigma-Aldrich (St Quentin Fallavier, France). Real time quantitative polymerase chain reaction (RT-qPCR) was conducted on the thermal cycler CFX 96 (Bio-Rad) using EvaGreen® chemistry (Bio-Rad). Each reaction was run in triplicate (technical replicates) and was done in 20 µl of reaction volume, containing 2 µl of cDNA, 500 nM primers, and the EvaGreen mix. Amplification was performed under the following conditions: 98°C for 2 min to activate the DNA polymerase, followed by 40 cycles at 95°C for 4 sec and 60°C for 10 sec. Dissociation curves were examined at the end of PCR reactions to check for unspecific amplification and primer dimers. 59 Table 1. Characteristics of the sequences used for real-time qPCR analysis. Gene name Catalase symbol Accession # cat FJ418795 Cu/Zn-Superoxyde Dismutase sod AY332385 Retinoïd X Receptor rxr AY846875 Glutathione Reductase gred FJ418794 Glutathione Peroxidase gpx FJ418796 Heat Shock Protein 40 hsp40 DQ278442 Heat Shock Protein 70 hsp70 DQ206432 Cortactin cor AY577343 18S rRNA r18s EF489345 28S rRNA r28s EF489367 Primer (5' > 3') F: GCAACAACACCCCAATTTTC R: TCTGGACGCAGAGTGAAGAA F: GGTGGGCCATTAGATCAAGA R: CACTAAGCTGCGACCAATGA F: TCCTGGTCTGCCTCATTCTT R: ACCGTAATGTTTGCCAGAGG F: CTTTTGACTGGAGGCGAATC R: GATTCCATGGCCCTCAATTT F: TGTAAACGGGACGGAGATTC R: GATCTCGTTTTCCCCATTCA F: GGTCTTGAATCCTGATGGACA R: CTTTGGGGAAGGTTATTTTGG F: CAGCTTGAGGGCTACGTCTT R: GCCATTTCATTGTGTCGTTG F: ACGAAGCAGCACAACATCAC R: GGTAACGACACCAGGAATGC F: CTCCTTCGTGCTAGGGATTG R: GTACAAAGGGCAGGGACGTA F: CTCAGGAGTCGGGTTGTTTG R: TTCCCTCACGGTACTTGTCC Amplicon size (bp) 133 141 82 116 118 104 115 112 106 105 Raw qPCR data were analysed using CFX manager (Bio-Rad). For each gene, a standard curve based on 7 dilutions from an equimolar mix of mRNA samples, was produced in duplicate to verify amplification efficiency. Transcript expression was normalized using two different methods. The first one, GeNorm (Vandesompele et al., 2002), is based on the determination and use of reference genes (here, r18S RNA, r28s RNA and cortactin). This method is based on the stability of their transcriptions, as indicated by the geometric mean of the variation observed between them (M) with a threshold value of 0.5 (1.0) for homogeneous (heterogeneous) tissues (Bustin, 2010). The second one, NORMA-Gene, is a data-driven normalization method, which does not require reference genes (Heckmann et al., 2011). In this method, the normalization factor is based on the calculation of the mean expression value for each replicate across the studied transcripts. It allows reducing systematic and artificial bias. Therefore, this new method is more robust than those based on reference genes. 60 Enzyme assays Sample preparation Proximal part of the GDC was removed from the rest of individuals, weighted and homogenized in 75 mM Phosphate buffer (KH2PO4, pH 7) in order to obtain a 10% (w/v) solution. Tissues were homogenised using an ice-cold glass homogenizer with a motordriven Teflon pestle. Homogenates were centrifuged at 10000 g for 5 min at 4°C. Enzyme assays were performed on the supernatants, and run in triplicate. Superoxide Dismutase The activity of superoxide dismutase (SOD; E.C.1.15.1.1) was determined using the Ransod Kit supplied by the Randox Laboratories (Ardmore, Northern Ireland, UK). Xanthine and xanthine oxidase were used to generate superoxide anion, which reacts with 2-(4indophenyl)-3-(4-nitro-phenyl)-5-phenyl tetrazolium chloride (INT) to form a red formazan dye. Changes in the absorbance were determined at 505 nm during the first three minutes of reaction. Enzyme activity was calculated from a calibration curve prepared with the standard supplied in the kit. One unit of SOD is defined as the amount that inhibits 50% of the INT reaction (Beauchamp and Fridovich, 1971; Ukeda et al., 1997). Specific activity was defined as Units mg-1 protein. Glutathione Reductase Glutathione reductase (GR; CE 1.8.1.7) activity was measured at 25°C by monitoring the rate of production of 5-thio-2-nitrobenzoic acid (TNB) from 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) at 412 nm every 9 sec during 70 sec. Production of TNB is coupled with the reduction of glutathione disulfide by the enzyme. GR activity was calculated using an extinction coefficient of 13,600 M-1 cm-1 for DNTB and was expressed as µmol min-1 mg-1 protein. Glutathione Peroxidase Glutathione peroxidase (GPx; EC 1.11.1.9) activity was measured with the Ransod Kit supplied by the Randox Laboratories (Ardmore, Northern Ireland, UK) by monitoring the continuous decrease in NADPH concentration using cumene - H2O2 as the substrate at 61 340 nm (Flohé and Günzler, 1984). One unit of GPx activity is defined as the amount of enzyme that oxidizes 1 µmol of NADPH per min and is expressed as Units mg-1 protein. Glutathione S-Transferase Glutathione S-transferase (GST; EC 2.5.1.18) activity was measured according to Habig (1974). Briefly, 5 µL of GSH solution (100 mM in phosphate buffer) and 10 µL of sample were mixed in 235 µL of 100 mM phosphate buffer (pH 6.5). After adding 5 µL of 100 mM 1 chloro-2,4 dinitrobenzene (CDNB) in ethanol, the change in absorbance at 340 nm was recorded during 40 sec. One GST Unit was defined as the amount of enzyme needed to catalyze the formation of 1 µmol of GS-DNB per minute at 25 °C. GST activity was expressed as µmol min-1 mg-1 protein. Protein assay Protein concentration (mg protein ml-1) in the enzyme extracts was evaluated according to the Bradford assay (1976) with bovine serum albumin as the standard. Data analysis Transcript expression and enzymatic activities were compared between control and treatment conditions using ANOVA, after checking for normality (Shapiro-Wilk’s test) and homoscedasticity (Bartlett’s test). When required, data were transformed (logarithmic or Box-Cox transformations) prior to analysis. ANOVAs were followed with multiple comparison tests (Tukey’s post-hoc test, α = 0.05). Analyses were performed using the R software (Windows version 2.11.1, R Development Core Team, 2006, Vienna, Austria). 62 Results Exposure characterization Diquat concentrations in water remained stable during the longest exposure period (48 hrs) and were slightly lower than the nominal ones (Fig. 1), which was consistent with previous results (Lagadic, 2007). 22.2 µg l-1 44.4 µg l-1 200 222.2 µg l-1 180 [diquat] (µg l-1) 160 140 120 100 80 60 40 20 0 5 24 48 Exposure time (hrs) Figure 1. Effective concentration of diquat as function of time and nominal concentration. Water chemistry measured in control vessels did not reveal abnormal conditions during exposure (Tab. 2). No mortality was observed during the exposure. However, a moribund state (no foot-retraction reflex upon mechanic pressure, immobility) was observed in one snail exposed during 48 hrs to 44.4 µg l-1 of diquat. This individual was discarded from the analysis. Table 2. Physicochemical parameters as measured under control conditions. Time (hrs) pH 5 24 48 7 ± 0.05 7.4 ± 0.25 7.5 ± 0.1 Oxygen saturation (%) 4.6 ± 0.6 5.6 ± 0.6 6.8 ± 0.2 63 Conductivity (µS/cm) Temperature (°C) 503.3 ± 5.1 451.7 ± 24 526.3 ± 10.6 19.7 ± 0.15 19.8 ± 0.1 19.5 ± 0.1 Normalization and transcription profiles of r18s, r28s and cortactin Genes encoding rRNA18s, rRNA28s and cortactin were initially selected among a panel of potential reference genes (including also β-tubulin, actin and thymosin) for the normalization of target transcripts expression with GeNorm. Indeed, this subset of genes presented the lowest M-values. However, these were globally above the validation threshold recommended in the MIQE guideline for homogeneous tissues (0.5). The highest instability was observed after 5 hrs of exposure in the GDC (M-value = 0.73). However, it was accepted as this tissue could be considered as heterogeneous (Tab. 3). Table 3. Results of the normalization procedure based on GeNorm, using ribosomal RNA 28S, 18S and cortactin as reference genes. r28S Exposure time r18s cortactin Mean Value Tissue M-Value CV M-Value CV M-Value CV M-Value CV Haemolymph 0.38 0.14 0.40 0.16 0.47 0.20 0.42 0.16 GDC 0.71 0.34 0.61 0.18 0.86 0.33 0.73 0.28 Haemolymph 0.56 0.22 0.56 0.21 0.60 0.24 0.57 0.22 GDC 0.63 0.27 0.63 0.24 0.68 0.28 0.65 0.26 Haemolymph 0.47 0.13 0.57 0.27 0.68 0.29 0.57 0.23 GDC 0.61 0.23 0.69 0.35 0.55 0.17 0.62 0.25 5 hrs 24 hrs 48 hrs Normalization with NORMA-Gene revealed that in both tissues, diquat exposure significantly impacted the transcription of genes encoding r18s, r28s and cor (Fig. 2), but the response was modulated both by exposure concentration and time, and evolved differently according to the tissue. Consequently, only the results from NORMA-Gene analysis will be presented and discussed hereafter. In the haemolymph of snails treated with 22.2 µg l-1 diquat, transcript expression was similar to the control level, except in the case of cor which was significantly over-expressed at 24 hrs (Fig. 2a). 64 Control 22.2 µg l-1 44.4 µg l-1 222.2 µg l-1 Normalized expression ratios A. 1 . Normalized expression ratios * * 0 B. * 2 5h 24h 48h * 5h r18s 6 24h 48h 5h r28s * 5 4 3 24h 48h cor * * . * * 2 . 1 0 5h 24h 48h 5h 24h 48h 5h 24h 48h Exposure time Figure 2. Effect of diquat on transcript expression of r18s, r28s and cor in haemolymph (A) and in the gonado digestive complex (B) of Lymnaea stagnalis, as a function of time and diquat concentration. Transcription levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post hoc test). At higher concentrations, diquat induced under-expression regardless of exposure time, but the decrease was only significant at 222.2 µg l-1 for r18s after 48 hrs (~ 0.25-fold), and for r28s after 5 and 48 hrs (~0.5- and 0.2-fold, respectively). However, it is to be noted that cor was down-regulated to a similar level by diquat after 48 hrs, although this was not statistically significant (see control variation, Fig. 2a). In the GDC, transcript expression of r18s, r28s and cor were globally up-regulated after 5 hrs of exposure (Fig. 2b). Overtranscription of cor was significant whatever the concentration (~3.2- to 5.1-fold; F = 20.2, P < 0.001), whereas only at 44.4 µg l-1 in the case of r18s and r28s. After 24 and 48 hrs, most of the expression levels were close to the control, despite a slight down-regulation of r28s (P < 0.1) observed in snails exposed to 22.2 µg l-1 for 24 hrs. 65 Transcription profiles of target genes in the haemolymph The transcription of hsp70 was not significantly affected by the treatments, although data suggest a shift from up- to down-regulation between 5 hrs and 24-48 hrs of exposure (Fig. 3). hsp70 hsp40 Control 22.2 µg l-1 44.4 µg l-1 222.2 µg l-1 Normalized expression ratios 2.5 2 * 1.5 1 * * 0.5 0 5h 24h 48h 5h 24h 48h Exposure time Figure 3. Effect of diquat exposure for time-course on transcription of hsp40 and hsp70 in haemolymph of Lymnaea stagnalis, as a function of time and diquat concentration. Transcription levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test). Regarding the transcript expression of hsp40, the lowest concentration of diquat induced significant increase after 24 hrs of exposure, whereas higher concentrations (44.4 and 222.2 µg l-1) led to an opposite trend, with significant decrease measured after 5 hrs of Normalized expression ratios exposure and a non-significant decrease after 48 hrs. rxr 3 cat * * 2.5 Control 22.2 µg l-1 44.4 µg l-1 222.2 µg l-1 sod 2 1.5 1 0.5 . * * 0 5h 24h 48h 5h 24h 48h 5h 24h 48h Exposure time Figure 4. Effect of diquat exposure for time-course on transcription of gene involved in antioxidant response in haemolymph of Lymnaea stagnalis, as a function of time and diquat concentration. Transcript expression levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test). 66 Transcription of genes involved in glutathione cycle was too low in the haemolymph to be reliably inferred from RT-qPCR. Therefore, the study of antioxidant response was limited to rxr, cat and sod (Fig. 4). Diquat had a similar effect on rxr and sod. Their transcriptions were significantly up-regulated (2.5 fold) after 24 hrs of exposure to the lowest concentration, whereas higher concentrations had a down-regulating effect after 48hrs, which was significant only at 222.2 µg l-1. The transcription of cat also increased at the lowest concentration (48 hrs, 2-fold change) and decreased at higher concentrations (48 hrs), but this was not strictly significant (but see ANOVA P-value of 0.01, followed with marginal P-value of the post-hoc test). Transcription profiles of target genes and antioxidant enzymatic activities in the gonadodigestive complex (GDC) As general features, changes in gene transcription occurred earlier and were much more important in the GDC than in the haemolymph. As also observed for r18s, r28s and cor, the main perturbation of target gene transcription was induced after 5 hrs of exposure to diquat, with a global trend to up-regulation (except for rxr at the lowest herbicide concentration) (Fig. 5 and Fig. 6a, b). Moreover, gene transcription increased in a dose– dependent manner in the case of heat shock proteins (Fig. 5), gpx and gred (Fig. 6a). Normalized expression ratios hsp70 8 7 6 5 4 3 2 1 0 hsp40 Control 22.2 µg l-1 44.4 µg l-1 222.2 µg l-1 * * * ** . . * 5h 24h 48h 5h 24h 48h Exposure time Figure 5. Effect of diquat exposure for time-course on transcription of hsp40 and hsp70 in the gonado digestive complex of Lymnaea stagnalis, as a function of time and diquat concentration. Transcript expression levels (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by post-hoc test). 67 gpx 10 9 8 7 6 5 4 3 2 1 0 rxr 5 * cat sod * 4 * 3 * . 2 * * * 1 * . * 0 5h C. 24h 48h Gpx 5h 24h * 4 Enzymatic activity ratios B. gred 48h 5h Gred 24h 48h 5h 24h 48h 5h D. GST 3 Control 22.2 µg l-1 44.4 µg l-1 222.2 µg l-1 . 2 1 Enzymatic activity ratios Normalized expression ratios A. 24h 48h SOD 3 * * 2 1 0 0 5h 24h 48h 5h 24h 48h 5h 24h 48h 5h 24h 48h Figure 6. Temporal antioxidant profiles of transcript expression (A & B) and enzymatic activity (C & D) in the gonado-digestive complex of L. stagnalis exposed to diquat. Snails were exposed during 5, 24 or 48 hours to 22.2, 44.4 or 222.2 µg l-1 of diquat dibromide. Transcription was measured by RT-qPCR and normalized with NORMA-Gene (Heckmann et al., 2011). Transcript expression levels, as enzymatic activities (mean ± SE) are presented relative to the control (mean ± SE). Significant differences between snails exposed to diquat and their control counterparts are denoted with an asterisk (p < 0.05) or a dot (p < 0.1) (ANOVA followed by posthoc test). Distinct transcription profiles were obtained for cat (up-regulation similar across concentrations, although not significant due to high variations among replicates, see Fig. 6b) and for sod (highly significant up-regulation, absence of dose-dependent relation). For all transcripts, a global return to control levels was observed afterwards, except for the significant down-regulation of hsp70 and cat at 22.2 µg l-1 (24 hrs), and the trend towards upregulation for hsp40 at 44.4 µg l-1 (48 hrs). Compared to transcript profiles, enzymatic activities were less responsive to diquat. Glutathione reductase and SOD activities were consistent with gred and sod overtranscription in the GDC after 5 hrs of exposure (Fig. 6c, d), except for the intermediate concentration (44.4 µg l-1). A weak but significant increase in GST activity also occurred after 24 hrs of exposure to the lowest concentration (~1.5-fold, ANOVA P = 0.04, but posthoc tests failed to detect significance). GPx activity was maintained at constitutive levels whatever the condition. 68 Discussion In the present study, sublethal effects of the herbicide diquat were studied at the molecular level, using two different tissues of a non-target species, the pond snail Lymnaea stagnalis. Due to the redox-cycling property of diquat (Thomas and Aust, 1986), we focused on a set of genes involved in anti-oxidant defence (rxr, cat, sod, gpx, gred), which are generally ubiquitous in animal species although their expression can differ between tissues (Livingstone, 2001). Target gene transcription was thus investigated in the haemolymph, a tissue in which immune cells are likely to manage the toxic effect of ROS to kill phagocytosed pathogens in defence mechanisms (Segal and Shatwell, 1997), and in the digestive gland, as diquat is recognized as a potent hepatotoxicant, due to its pro-oxidant property (Sandy et al., 1986). To be relevant to ecotoxicity testing and assessment of ecotoxicological risk, snails were exposed to ecologically realistic concentrations, ranging from 22.2 to 222.2 µg l-1. Results indicate significant responses produced by genes specifically involved in redox cycling and oxidative stress (rxr, cat, sod, gpx, gred), and by other stress responsive genes (hsp40 and hsp70). More surprisingly, transcription of genes traditionally considered as stable (r18s, r28s and cor) were also significantly impacted by diquat. Indeed, normalization with NORMA-Gene revealed that this set of transcripts (initially selected as reference genes for normalization with GeNorm) was mostly down-regulated in the haemolymph of snails exposed to diquat concentration of 44.4 and 222.2 µg l-1, especially after 48 hrs of exposure, whereas it was significantly up-regulated as early responses observed in the GDC. However, it is interesting to note a return to homeostasis in the GDC after 24 hrs as both normalization methods gave very similar results in this tissue at 24 and 48 hrs. These results raise the difficulty to find stable reference genes. Under the present conditions, for a minimum of 5 target genes, NORMA-Gene appears as the most relevant normalization method. Using this method, we showed that diquat induced significant changes in transcript expression in both the haemolymph and GDC, yet in different ways. Hemocyte responses Generally, opposite trends were observed for transcript expression in the haemolymph indicating biphasic molecular responses depending on herbicide concentration and exposure time, as also reported in eels exposed to sediments presenting different levels of pollution 69 (Regoli et al., 2011). At the lowest concentration (22.2 µg l-1), the most contrasted responses were obtained after 24 hrs of exposure. The significant increase of rxr transcription might reveal the establishment of an active and organized response in hemocytes. As the ligandactivated transcription factor RXR may occur as homodimers, and heterodimers, it is recognized to participate in the regulation of many aspects of metazoan life and represents the crossroad of multiple distinct biological pathways (Szanto et al., 2004). In rat cardiomyocytes, activation of the transcription factor RXR has been reported to play an antiapoptotic role in response to oxidative stress. It was also supposed to inhibit the production of intracellular ROS by up-regulating catalase activity (Shan et al., 2008), which the main peroxisomal enzyme participating in the elimination of H2O2 (Bilbao et al., 2010). Consistently, up-regulation of cat transcription was suggested in the present study (48 hrs, 22.2 µg l-1), suggesting possible peroxisome proliferation. In vertebrates, RXR has been shown to enhance transcription of various peroxisomal enzymes when coupled with the peroxisome proliferator activated receptor-γ (PPAR-γ) (Bardot et al., 1993; Szanto et al., 2004). Furthermore, PPAR-γ agonists mediate the transcription of superoxide dismutase (SOD) and catalase genes (Fong et al., 2010). Although PPARs have not been identified yet in invertebrates (Canesi et al., 2007), PPAR agonists in these organisms, as well as the transcription factor RXR, may explain the significant over-transcription of sod observed in hemocytes after 24 hrs. Despite the lack of data concerning the enzymatic activity of SOD in haemolymph, its higher transcription compared to that of catalase is consistent with the mode of action of diquat which is known to generate more likely superoxide anion (Sandy et al., 1986; Osburn et al., 2006; Fussell et al., 2011). This might reflect an increased activity of SOD, a faster turn-over of this enzyme because of its implication in O2- reduction, or the need for hemocytes to increase sod transcription to maintain its basal activity. Constitutive expression of cat might be sufficient to handle overproduction of H2O2 resulting from the reduction of O2.- by SOD. As indicated by the slight up-regulation of hsp40 transcription observed at 24 hrs, accumulation of aggregated oxidized proteins might occur (Glover and Lindquist, 1998). Furthermore cor up-regulation might reflect alterations of cytoskeleton, cell adhesion, cell– cell connection (Chou et al., 2010), and/or induction of exocytosis (Sung and Weaver, 2011), endocytosis (Clark et al., 2007), or autophagy processes in response to potential membrane lipoperoxidation (Lee et al., 2010). 70 At higher concentrations (44.4 and 222.2 µg l-1), the toxicity of diquat to hemocytes was more clearly evidenced. Most gene transcriptions were inhibited through time, and transcript expression significantly dropped down after 48 hrs, under exposure to the highest diquat concentration. Significant induction of apoptosis by diquat was previously demonstrated in L. stagnalis hemocytes after 48 hrs of exposure to concentrations of 44.4 and 222.2 µg l-1 (Lagadic, 2007). Diquat was also shown to induce apoptosis in vitro in murine embryonic fibroblasts (Ran et al., 2004) and in rat neuronal cells (Zhang et al., 2012). There is growing evidence that environmental toxicants able to induce alterations in redox homeostasis and oxidative stress exert both agonistic and antagonistic effects on apoptotic signaling (Curtin et al., 2002; Franco et al., 2009). Although apoptotic mechanisms may differ between invertebrates and vertebrates, programmed cell death pathways are highly conserved processes throughout evolution, with a tight regulation at both transcriptional and post-translational levels (Kiss, 2010). Low transcription levels of ribosomal RNAs observed after 48 hrs of exposure to diquat could thus reflect their degradation by apoptotic enzymes as demonstrated in the yeast Saccharomyces cerevisiae submitted to oxidative stress (Mroczek and Kufel, 2008). Decrease of phagocytosis ability and lysosomal fragility have also been reported in L. stagnalis under exposure to diquat (Lagadic, 2007). This herbicide may thus negatively affect L. stagnalis immune system, making individuals more sensitive to pathogens and parasitic attacks, as reviewed by Ellis (2011) for various invertebrate models exposed to different environmental stressors. Responses observed in the gonado-digestive complex In the GDC, gene response to diquat-induced oxidative stress appeared definitely more pronounced than in the haemolymph. Whatever the transcript studied, significant changes were induced (except cat for which ANOVA analysis revealed only a trend to overtranscription; P = 0.054). In general, up-regulation was observed early (5 hrs) under all treatments (except for rxr at 22.2 µg l-1). This confirms the rapid implication of this tissue to handle diquat toxicity, as also reported in rodents (Burk et al., 1980; Smith et al., 1985; Sandy et al., 1986; Fu et al., 1999). This is also consistent with the fact that digestive tissues are considered as the primary tissue counteracting oxidative challenge caused by chemicals, notably in fishes (Bilbao et al., 2010; Regoli et al., 2011). 71 Strong increases in hsp70 and hsp40 transcription indicated the need for hepatocytes to refold or degrade damaged proteins (and to protect undamaged ones), and prevent protein aggregation. HSP40 is known to stimulate the ATPase activity of the HSP70 chaperone proteins (Qiu et al., 2006) which is also recognized to play a major role in proteasome activation or inhibition during oxidative stress in murine embryonic fibroblasts (Grune et al., 2011). Parallel to the present study, the transcriptome-wide analysis of L. stagnalis response to diquat revealed over-transcription of a gene encoding the homologous protein NEDD4 (Bouétard et al., 2012). As this protein is known to be involved in ubiquitin mediated proteolysis, this suggests that diquat exposure induces rapid oxidation of cellular proteins, which are degraded once they have been tagged by ubiquitin. The 10-fold up-regulation of polyubiquitin measured by RT-qPCR in the liver of rainbow trout exposed to diquat also supports this hypothesis (Hook et al., 2006). Marked observed effects of diquat on the activity of hepatic drug-metabolizing and antioxidant enzymes occurred, at least in part, at the pre-translational level. Although nonstatistically supported, the trend to an early up-regulation of rxr transcription observed in snails exposed to 44.4 and 222.2 µg l-1 diquat might reflect the set-up of an organized antioxidant response. As described above, the transcription factor RXR might enhance transcription of peroxisomal enzymes such as cat and sod and induce peroxisomal proliferation (Fong et al., 2010). Albeit pathways involving RXR and those inducing overtranscription of gred and gpx are not simply linked, it is suggested that the dose-dependent over-transcription observed for these genes involved in glutathione cycle could also be regulated by such transcription regulators. Glutathione and selenium have been shown to play an important role in defence against diquat-induced toxicity and lipid peroxidation in plasma, liver, kidney and lung of rats (Awad et al., 1994). Also, significant contribution of glutathione-reductase to face diquat-mediated injuries is reported to prevent renal necrosis in mice (Rogers et al., 2006). In contrast, the involvement of GST in diquat detoxication has never been clearly demonstrated, and several genes encoding different GST isoforms were even down-regulated in liver of rats following diquat intraperitoneal injection (Gallagher et al., 1995). Consistently, in the present study, increase in GST activity was not observed in the GDC, despite a slight increase was graphically suggested in snails exposed for 5 and 24 hrs to 22.2 µg l-1 diquat. Significant up-regulation of transcription of gene encoding GSTZ1 was also detected in L. stagnalis at the whole organism scale, after 5 hrs of exposure to 222.2 72 µg l-1 (Bouétard et al., 2012). Several others copies of gst genes have also been obtained in this transcriptome analysis, so that future investigations can be designed to clarify the role of glutathione cycle in diquat toxicity mechanisms. The up-regulation of gred and sod transcription in the GDC of diquat-exposed snails reflects the need for hepatocytes to mediate of H2O2 and O2.- overproduction due to the herbicide, whatever its concentration. Regarding the corresponding enzymatic activities, increase of Gred and SOD activities were in agreement with transcript expression profiles, except for the intermediate diquat concentration tested (44.4 µg l-1) for which no significant increase was observed. It is unclear whether the observed effects resulted from a chemicallyinduced decrease in mRNA stability or from a decrease in protein translation and/or activation. The significant up-regulation of ribosomal RNAs observed after 5 hrs of exposure to this intermediate concentration of diquat may reflect alterations of translation mechanisms. As for Gpx activity, mechanisms of folding and enzyme activation of Gred and SOD could be altered by oxidative stress. Such differences between transcript expression and related enzymatic activities have also been observed in gills and liver of eels exposed to polluted sediments (Regoli et al., 2011). However, enzymatic activities remained close to control levels throughout the experiment, indicating that basal levels of enzymatic activity might be sufficient to deal with oxidative stress. Nevertheless, in some cases, up-regulation of the transcription of genes encoding these enzymes may be necessary to maintain or increase this constitutive activity. The impact of diquat on transcript expression tended to be negatively related to the exposure time, although herbicide concentrations in water were stable in the course of the experiment. These responses should not be interpreted as an absence of toxicity of diquat after 24 hrs, since toxic effects were clearly evidenced in hemocytes after 48 hrs of exposure to the two highest concentrations. Possible explanations may be related to the fact that snails were not fed during the experiment, so that they could not properly cover the maintenance or the increase of enzyme activities which are energy-demanding. Circadian regulation may also have interfered with exposure time comparisons. Indeed, such regulation mechanisms are too often neglected in ecotoxicity tests although they may have a great importance, as demonstrated in Drosophila melanogaster (Claridge-Chang et al., 2001; Hooven et al., 2009). Nevertheless, we demonstrated that whatever the concentration, diquat induced significant changes in gene transcription in both the haemolymph and GDC of L. stagnalis. Transcript 73 expression was shown to evolve on a short time scale, suggesting that snails are able to set up a balance of phase I and phase II detoxication mechanisms to limit accumulation and toxicity of reactive metabolites, and to initiate folding and degradation processes involving chaperone proteins. Conclusion and Perspectives In the present study, we confirmed that diquat exerts toxic effects in non-target animal species. Moreover and for the first time in an aquatic invertebrate, we elucidated part of the underlying mechanisms at the molecular level. All genes studied here were shown to be significantly impacted by diquat exposure to realistic environmental concentrations, making them suitable biomarkers for the detection of oxidative stress in L. stagnalis. Although it is too early to draw a precise mechanism of response to diquat from the set of studied genes, hemocytes seemed to be more impacted as compared to the GDC. At the highest diquat concentrations, possible induction of apoptosis in hemocytes suggests that this herbicide may induce harmful effect on snail immune system. In the GDC, as expected, the strongest changes were observed as soon as 5 hrs of exposure reflecting the setting of an active response to oxidative stress. Transcriptomic resources recently developed in L. stagnalis (Bouétard et al., 2012a; Sadamoto et al., 2012) will be most useful to elucidate the mechanisms underlying toxicity of chemicals able to induce oxidative stress and other molecular alterations such as e.g., endocrine disruption. Acknowledgements The project has been carried out with INRA financial support (EFPA Projet Innovant 2010; AIP Bioressources 2010). AB is granted by the INRA (PhD, Contrat Jeune Scientifique). The authors thank Marc Collinet and the INRA U3E staff for technical assistance, and LarsHenrik Heckmann for useful advices. 74 Chapitre III - Développement de ressources génomiques chez Lymnaea stagnalis par pyroséquençage 454 : marqueurs génétiques microsatellites et séquençage de transcriptome 75 Grâce à leurs capacités d’exploration globale à l’échelle du transcriptome, les techniques de séquençage de nouvelle génération (NGS) ont révolutionné la façon d'appréhender les questions biologiques relatives aux réponses des organismes au stress (Wang et al., 2009). En particulier, l’étude de l'impact des polluants est aujourd’hui permise pour des organismes sans génome de référence (van Straalen & Feder, 2011) dans des approches permettant de coupler l’acquisition de nouvelles ressources génétiques à la quantification relative de la transcription des gènes. Au début de la thèse, ces ressources génétiques étaient trop limitées chez L. stagnalis pour entreprendre une quantification directe de la réponse transcriptomique par la technologie RNAseq (Illumina Hiseq2000) et appréhender la diversité génétique neutre de populations naturelles. Elles comportaient deux banques ESTs produites par séquençage de type Sanger (Davison & Blaxter, 2005; Feng et al., 2009) sur le tissu nerveux, un jeu de 392 séquences nucléotidiques codantes et 15 loci microsatellites (Knott et al., 2003; Kopp & Wolf, 2007), pour la plupart trop peu polymorphes (voire non amplifiables dans certaines populations), pour obtenir une résolution suffisante de la structure génétique des populations. Aussi, nous avons utilisé le séquençage haut-débit (pyroséquençage 454, technologie Titanium) pour d’une part, développer des nouveaux marqueurs microsatellites à partir d’ADN génomique (projet EcoMicro) et d’autre part, réaliser un premier séquençage de transcriptome en condition témoin (C) et de stress oxydant (D). Cette technique était en effet recommandée car, générant des séquences relativement longues, elle permet un assemblage en contigs également plus longs, avec comme conséquence positive une meilleure annotation. Pour augmenter la diversité et la gamme d’expression observée, deux librairies d’ADNc ont été préparées à partir de l’ensemble des tissus d’individus issus de trois souches de L. stagnalis génétiquement différenciées (Fst moyen : 0.415*), exposés (D) ou non (C) à l’herbicide diquat. Nous avons obtenu respectivement, 151.967 et 128.945 séquences de haute qualité dans les librairies C et D après nettoyage (Pyrocleaner). L'assemblage des lectures a produit 141999 contigs, dont 124387 étaient des singletons (longueur moyenne des contigs non-singlets : 761 bp ; singlets : 438 bp). La recherche d’alignements BLASTX sur les bases de données publiques (SwissProt, Refseq-Prot, Refseq-RNA, TrEMBL) a révélé des correspondances significatives pour 34,6% des contigs et 21,2% d’annotation protéique. L’annotation fonctionnelle contre la base KEGG a permis d’identifier plus de 400 gènes impliqués dans le stress oxydant, les voies de signalisation et de réponse au stress 76 cellulaire/moléculaire telles que l’apoptose ou le métabolisme des xénobiotiques. L’analyse d’expression différentielle selon la méthode adaptée à des plans expérimentaux sans réplicats proposée dans le package DEseq (Anders & Huber, 2010) suggèrent une grande diversité d’effets moléculaires pour le diquat, outre l’effet spécifiquement lié au stress oxydant. De plus, 3708 potentiels marqueurs SNPs (Single Nucleotide Polymorphism) répartis sur 1342 contigs, ont également été détectés lors de cette étude et pourront s’avérer des outils utiles pour de futures investigations. En conclusion, les données de pyroséquençage 454 ont fourni des ressources transcriptomiques permettant de générer des hypothèses sur les diverses voies moléculaires impliquées dans la réponse au stress qui seront testées lors de l’analyse de l’expression différentielle par RNAseq sur des populations naturelles de L. stagnalis. Ces données sont publiquement accessibles sur la base SRA (lectures brutes) ainsi que sur le contig-browser mis en place par Génotoul (contigs annotés). Ce travail a été accepté en juillet 2012 et publié en novembre 2012 dans la revue Ecotoxicology (vol 21: 2222-2234). De plus, la mise au point à partir des 174 loci à motifs parfaits et primers valides, de neuf marqueurs microsatellites et de leur amplification/analyse sous forme de 3 sets de multiplexes, a été réalisée en collaboration avec A.L. Besnard (UMR ESE), et a fait l’objet d’une Primer Note dans Molecular Ecology Ressources parue en janvier 2013. 77 Article 2 - Pyrosequencing-based transcriptomic resources in the pond snail Lymnaea stagnalis, with a focus on genes involved in molecular response to diquat-induced stress Bouétard Anthony1*, Noirot Céline2*, Besnard Anne-Laure1, Bouchez Olivier3, Choisne Damien1, Robe Eugénie3, Klopp Christophe2, Laurent Lagadic1, Coutellec Marie-Agnès1§ 1 INRA, UMR INRA-Agrocampus Ouest ESE, Equipe Ecotoxicologie et Qualité des Milieux Aquatiques. 65 rue de Saint-Brieuc, 35042 Rennes cedex, rance. 2 Genotoul, Plateforme Bioinformatique, INRA Toulouse-Auzeville, Chemin de Borderouge, 31326 Castanet Tolosan, France 3 Genotoul, Plateforme Génomique, INRA UMR0444 LGC Toulouse-Auzeville, Chemin de Borderouge, 31326 Castanet Tolosan, France *These authors contributed equally to this work § Corresponding author: [email protected] Keywords: Ecotoxicology, Pesticides, Oxidative Stress, Transcriptomics, Pyrosequencing, Lymnaea stagnalis. 78 Abstract Due to their ability to explore whole genome response to drugs and stressors, omicsbased approaches are widely used in toxicology and ecotoxicology, and identified as powerful tools for future ecological risk assessment and environmental monitoring programs. Understanding the long-term effects of contaminants may indeed benefit from the coupling of genomics and eco-evolutionary hypotheses. Next-generation sequencing provides a new way to investigate pollutants impact, by targeting early responses, screening chemicals, and directly quantifying gene expression, even in organisms without reference genome. Lymnaea stagnalis is a freshwater mollusk in which access to genomic resources is critical for many scientific issues, especially in ecotoxicology. We used 454-pyrosequencing to obtain new transcriptomic resources in L. stagnalis and to preliminarily explore gene expression response to a redox-cycling pesticide, diquat. We obtained 151,967 and 128,945 high-quality reads from control and diquat-exposed L. stagnalis, respectively. Sequence assembly provided 141,999 contigs, of which 124,387 were singletons. BlastX search against public databases revealed significant match for 34.6 % of the contigs (21.2% protein hits). GO categories were evenly distributed among differentially and equally expressed contigs between control / pesticide-exposed snails. KEGG annotation showed a predominance of hits with genes involved in energy metabolism and circulatory system, and revealed more than 400 putative genes involved in oxidative stress, cellular/molecular stress and signaling pathways, apoptosis, and metabolism of xenobiotics. Moreover, new genetic markers (putative SNPs) were discovered. We also created a Ensembl-like web-tool for contig data-mining (http://genotoul-contigbrowser.toulouse.inra.fr:9095/Lymnaea_stagnalis/index.html). This new resource is expected to be relevant for any genomic approach aimed at understanding the molecular basis of physiological and evolutionary responses to environmental stress in L. stagnalis. 79 Introduction Omics-based approaches are now widely used in toxicological and ecotoxicological research, and their application to ecological risk assessment and environmental monitoring programs is a question of current discussion (Snape et al., 2004; Martyniuk et al., 2011; Villeneuve and Garcia-Reyero, 2011). Recent progress in sequencing technology (NGS, nextgeneration sequencing), Omics, and bioinformatics provides indeed extremely powerful tools to investigate processes underlying biological response to stressors, for example, through the framework of system biology. Adverse outcome pathways can be inferred from molecular interaction networks, and causal / regulatory relationships as well as hypotheses about key biological processes can be tested with statistical modelling (Perkins et al., 2011). Under this framework, it is possible to link molecular processes to higher levels of biological organization, i.e., individual phenotype and population, and to community-level relationships. At the scale of an ecosystem, changes in ecological functions may also be potentially inferred from molecular trait-based ecology combined with metagenomic approaches (Raes et al., 2011). System biology approaches are currently implemented in predictive ecotoxicology (Watanabe et al., 2011), which appears particularly suited to ecological risk assessment. In particular, they are appropriate to the study of stressors which mode of action is unknown or not fully characterized (which is likely for numerous pesticides / non-target species systems), and also to the study of complex mixtures (as effectively encountered by organisms in their real environment). Furthermore, Omics tools are not restricted to model-species anymore, and can now be successfully applied to species of eco-evolutionary or ecotoxicological significance (Vera et al., 2008; Martyniuk et al., 2011). NGS allows pollutant impact to be investigated in a completely new and hopefully more comprehensive manner. First, gene expression is thought to be among the earliest molecular responses to be triggered in exposed organisms, which makes toxicogenomic endpoints good candidates as markers of early effects (van Straalen and Roelofs, 2008). Second, transcriptome-wide approaches allow various chemicals to be screened and classified, based on the mechanistic description of their mode of action (Garcia-Reyero et al., 2011; Villeneuve and Garcia-Reyero, 2011). Third, high through-put sequencing techniques allow direct quantification of expression, even for rare transcripts (Wang et al., 2009). Compared to microarrays, NGS techniques have their own biases, however sequencing has been shown to have higher sensitivity and dynamic range, coupled with lower technical 80 variability. Moreover, sequencing has greater ability to provide important information on various transcriptional characteristics, such as novel transcribed regions, allele-specific expression, RNA editing, or alternative splicing (Oshlack et al., 2010). Finally, sequencingbased gene expression studies are possible for any species, including those for which no microarrays exist. The evolutionary impact of human-induced environmental disturbance to wildlife is a central issue in conservation biology (Smith and Bernatchez, 2008). Evolutionary responses to environmental stress may occur rapidly (Hoffmann and Hercus, 2000), and the rate of evolutionary change can be altered by human factors (Hendry et al., 2008). The question of long-term impact also represents a serious concern in the field of ecological risk assessment, especially for xenobiotic substances, since such an impact may have negative consequences on ecosystem sustainability. Therefore, new assessment criteria have been recently proposed to account for evolutionary impact, using e.g., population genetics and evolutionary indices or parameters (Breitholtz et al., 2006; Bickham, 2011; Coutellec and Barata, 2011). The incorporation of genomic tools into evolutionary issues appears promising in this context, as hypotheses can be built and tested on a mechanistic basis. From the above, it is evident that access to genomic resources in non-model species is critical for ecotoxicological and conservation issues. Among invertebrate models, Lymnaea stagnalis is a freshwater mollusk representative of lentic habitats, and of the herbivorous community compartment. It is currently used as a model in various research fields, including aquatic ecotoxicology (Coutellec et al., 2011; Byzitter et al., 2012), evolution (Coutellec and Caquet, 2011), behavioral ecology (Hoffer et al., 2010), parasitology (Adema et al., 1994), and neurophysiology (Carter et al., 2006), all of which are in need for genomic resources. Current genetic resources are composed of two EST banks based on Sanger sequencing (Davison and Blaxter, 2005; Feng et al., 2009), and a set of 392 nucleotidic sequences (Genbank). A genome project is under construction in L. stagnalis (see http://www.lymnaea.org). Finally, L. stagnalis is also currently candidate as model species for standardized toxicity tests (under validation, OECD). In this context, we developed a project based on the model L. stagnalis, with the main goal of exploring the evolvability of gene expression responses to pesticides, at the transcriptome level (de novo RNAseq). Here is presented the first step of the transcriptomic 81 study, in which genomic resources were obtained by pyrosequencing L. stagnalis cDNAs from various pooled tissues. Laboratory-reared individuals originating from three different populations were pooled, in order to include some level of genetic diversity and to minimize the risk of idiosyncratic patterns due to the use of a single isolated lineage. In order to further broaden the range of expression, two libraries were constructed (i) one from individuals exposed to a redox cycling herbicide, diquat, and (ii) one from control individuals. Diquat is a non selective herbicide (chemical class: bipyridylium) widely used to control crops (potato, cotton and other seed crops), but also submersed and floating weeds (US-EPA, 1995). L. stagnalis is thus likely to be regularly exposed to diquat, either directly when the water is treated, or indirectly, since lentic aquatic systems are the ultimate recipient of many chemicals, through various transfer processes (Brown and van Beinum, 2009). As a redox cycling molecule, diquat generates ROS (reactive oxygen species) and oxidative stress. ROS are thought to mediate the toxicity of oxygen, yet they also operate as intracellular signaling molecules (Mager et al., 2000), under mechanisms that are not yet fully understood, even in the most widely studied models, i.e., mammalian models (Poulsen et al., 2000; D'Autreaux and Toledano, 2007). Oxidative stress is known to mediate trade-offs between reproduction, immunity, lifespan and aging (Monaghan et al., 2009). This feature may thus have important consequences for fitness-related traits. In L. stagnalis, diquat has been shown to affect various life history traits (Coutellec et al., 2008; Ducrot et al., 2010), and its effect on several genes involved in cellular stress (oxidative stress, metabolism of xenobiotics, and chaperone activity) has been preliminarily explored in haemolymph and digestive gland, to determine the most contrasted molecular response among 3 exposure time (5, 24 & 48h) and 3 concentrations (22.2, 44.4 & 222.2 µg/L) compaired to controls (Bouétard et al., 2013). The present study reports on the generation and analysis of EST sequences based on 454 pyrosequencing of two L. stagnalis transcriptomic libraries, stemming from control and exposure to diquat conditions (short read assembly, contig annotation, functional annotation, differential expression) and on the creation of an publically accessible genomic resource web tool, which allows sequence and annotation retrieval, as well as SNP putative location (http://genotoul-contigbrowser.toulouse.inra.fr:9095/Lymnaea_stagnalis/index.html ; Great Pond Snail Contig Browser). This tool is expected to be useful for any upcoming genomic approach developed in L. stagnalis, from single gene expression to complex molecular pathways and population genomics. In the toxicological context of the study, functional 82 annotation (Gene ontology, KEGG pathways) allowed the identification of a number of genes potentially useful to investigations on cellular and molecular response to oxidative stress in a multidisciplinary invertebrate model. We also present preliminary results on differential expression under diquat exposure. Material and methods Biological material L. stagnalis individuals were taken as adults from the INRA U3E laboratory cultures (Experimental Unit of Aquatic Ecology and Ecotoxicology, INRA, Rennes). Rearing conditions have been described earlier (Coutellec et al., 2008). Snails from three different origins were used: a local population (Le Rheu, France), a culture from VU University Amsterdam (Netherlands) and a natural population from Sandbjerg (Denmark). Half of the snails were individually exposed to a diquat solution of 222.2 µg/L for 5 hours, and the other half was maintained under control conditions. This concentration was chosen as it is close to the maximum recommended application rate (Emmett, 2002), and because it falls in the range of field concentrations measured after spraying (Emmett, 2002). Moreover, we applied the concentration we used in previous studies, with the purpose of comparing results. Several life history traits were indeed shown to be impaired in snails exposed to this concentration (adult growth, progeny development time and hatching success ; Coutellec et al. 2008). Exposure time was determined on the basis of preliminary expression experiments using candidate genes (Bouétard et al., 2013). Three days prior to contamination, animals were isolated from the culture, placed in exposure vessels, and fed until the last 24hrs. Feces and salad leftovers were removed from the vessels just before contamination. In order to limit potential stress due to water change, contamination was performed by adding a small volume (5ml) of stock solution (concentration: 10.66 mg/L) to the initial water volume (240 ml). Tissue sampling and processing Five hours after contamination, haemolymph was collected as described earlier (Russo and Madec, 2007) and centrifuged (2 min at 4000 rpm). Pellets were homogenized in 350 µL of lysis buffer (Norgen Biotek) and stored at -80°C. Snails were then quickly plunged into liquid nitrogen, and their body was rapidly split into three parts: (i) digestive gland and 83 ovotestis (both are intricate and cannot be easily separated), (ii) front part of the body (including : head, anterior part of the digestive tract and distal reproductive structures, central nervous system, tegument, mantel and part of the foot), (iii) posterior part of the body (essentially foot and proximal part o f the reproductive apparatus, except ovotestis). As the aim was to explore the whole range of transcriptomic expression, all tissues and organs were included. Each part was stored in RNAlater at -80°C until further processing. RNA preparation Total RNA was extracted from haemolymph using Total RNA extraction Kit (Norgen Biotek), and from solid tissues using TRIzol reagent (Invitrogen). Haemolymph RNA was extracted from pooled samples taken from 3 to 4 individuals. A total of 16 different extractions were performed (8 control, 8 diquat exposure conditions). For solid tissues, RNA was extracted from pooled samples corresponding to 9 individuals. One extraction per condition per tissue category was performed (i.e., 6 different extractions in total). For each treatment, the same number of individuals was used. RNA quantity and purity were assessed with Nanodrop (Thermo, Fisher Scientific). Absorbance ratio values were A260/A280 = 2.04 ± 0.07 and A260/A230 = 1.52 ± 0.18 for haemolymph, and A260/A280 = 2.05 ± 0.03 and A260/A230 = 1.93 ± 0.11 for solid tissues. The amount of tissue used and of total RNAs obtained from each sample and condition, are available as supplementary material (Table S1). Total RNAs (45 µg from each pool of solid tissue samples, whole haemolymph RNAs) were treated with DNAse I (Promega) and purified with the RNeasy Minelute Cleanup Kit (Qiagen). Absence of genomic DNA was PCR-checked. RNA quality was determined with Agilent 2100 Bioanalyzer (Agilent Technologies). Messenger RNAs (polyA-tailed) were then purified using the purification kit Dynabeads® Oligo (dT) 25 (Invitrogen). RNA amounts were controlled at each step. cDNA synthesis This step was performed following Leroux et al. (2010). First strand cDNA was synthesized and using the SuperscriptTM II RT kit from Invitrogen. An oligodT modified primer (GAGAGAGAGACTGGAG(T)16VN) containing the GsuI restriction site was used, in order to cut the polyA tail after synthesis. To avoid internal cleavage by GsuI, methylated 84 dCTP was used (dm5CTP, Fermentas) instead of dCTP (see manufacturer’s protocol). The Second strand synthesis protocol was used to synthesize the second strand cDNA: 30 µL of 5x Second strand Reaction Buffer 20% (Invitrogen) were added (1x final concentration), 3 µL of 10mM dNTP mix (0.2 mM final concentration), 10 U of E. coli DNA ligase, 40 U of E. coli DNA Polymerase, and 2.5 U of E. coli RNAse H (all enzymes from New England Biolabs). Samples were then incubated at 16°C for 2 hours. After adding 10 U of T4 DNA Polymerase (New England Biolabs), samples were incubated at 16°C for 5 minutes. EDTA was used to stop the reaction (30 mM final concentration). Finally, samples were added 5 U of Ribonuclease I (Fermentas) and incubated for 15 minutes at 37°C. Double-strand cDNAs were then purified using a phenol-chloroform-isoamyl alcohol extraction (25:24:1) with Phase Lock Gel (Phase Lock Gel Light, 2ml, 5 Prime), following the manufacturer’s protocol. Pellets were suspended in 6 µL of DEPC-treated water, and cDNA concentration was estimated on Nanodrop. Two pools of cDNA (control and exposure conditions) were then created from an equimolar mixture of the four sample types (haemolymph, GDC, BAP, BBP). Digestion of cDNAs by GsuI was performed at 30°C for one hour, with 5 U of the enzyme (Fermentas). Samples were then placed at 65°C for 20 minutes, to stop the reaction. Library construction and 454 pyrosequencing For each pool, the amount and quality of cDNA was estimated using a picogreen dosage (500 and 502 ng of C and D library were used, respectively). DNA was fragmented by nebulization and adaptors were ligated (GS Rapid Library Prep kit). Emulsion PCR was then performed using GS FLX Titanium LV emPCR Kit, and the two libraries were pyrosequenced (each on half a run, as physically separated). Sequencing was performed on the Roche 454 Genome Sequencer FLX, using the GS FLX Sequencing Kit Titanium Reagents XLR70. All steps were performed following Leroux et al. (2010). Sequence cleaning and assembly Raw sequences (reads) were cleaned with the software Pyrocleaner (Mariette et al., 2011), using the following criteria: (1) complexity/length ratio less than 40 (using a sliding window approach based on 100 bp sequence length, and a step of 5 bp); (2) duplicate read removal (see bias associated with pyrosequencing, due to the random generation of duplicate reads); (3) removal of too long/too short reads (maximum read length= mean read length ± 85 2SD); (4) removal of reads with too many undetermined bases (more than 4%). Contaminations were discarded by searching hits against the following databases: ecoli536 2011-01-10, genbank_phage178 and Saccharomyces_cerevisiae 2011-01-07. Finally, polyAtailed reads and reads shorter than 100pb were removed from the dataset using Seqclean. Reads were assembled into contigs with Tgicl (Pertea et al. 2003). External databases were also included (11697 sequences of L. stagnalis dbEST and 279 sequences from Genbank, which after cleaning by Seqclean represented 11639 sequences). Contig annotation NCBI BlastX or Blastn was used to search for sequence homology between contigs and the following generalist databases: UniProtKB/Swiss-Prot, UniProtKB/TrEMBL Release 2011_02 of 08-Feb-2011, RefSeq Protein Index Blast of 09-Jan-2011, Pfam Release 24.0 of Jul-2009, and RefSeq RNA Index Blast of 09-Jan-2011. The cut-off e-value was set to 1e-5. The following species specific databases were queried with a cut-off e-value of 1e-2: TIGR Spisula solidissima CLAMGI 1.0, UniGene Aplysia_Californica Build #8, UniGene Lottia_gigantea Build #2. Finally, we realigned our contigs with the cut-off e-value of 1e-30 (Pondsnail_Contigs_V1 database). Putative function of unigene elements having at least one significant hit against generalist databases was determined using Gene Ontology (GO) and its GOslim generic version (http://www.geneontology.org/GO.slims.shtml). Functional annotation was also performed using “single best hit” Blast comparison against the manually curated KEGG genes database, with the program KAAS (KEGG Automatic Annotation Server: http: www.genome.jp/tools/kaas/). Annotated sequences were further categorized using KEGG Orthology (KO) and the BRITE hierarchy for protein families, where four top categories were examined: metabolism, genetic information processing, environmental information processing, and cellular processes. Pathways relative to organismal systems were also investigated. Some specific pathways were examined further, due to their link with oxidative stress, cell and molecular stress and signalling, and apoptosis. 86 Differential expression As each read could be reassigned to the initial library, i.e. control (C) or diquatexposed (D) pool, contigs were characterized by their relative number of C and D reads. Singlets and contigs containing only external sequences were excluded. Among the remaining contigs, some were exclusively composed of C or D reads, the others being a mixture thereof. Functional annotation (GO terms) was first globally compared among three categories of annotated contigs: (1) exclusively expressed and over-expressed under diquat exposure (D, and D>C according to Fisher exact test), (2) exclusively expressed under control condition and under-expressed under diquat exposure (C, and C>D according to Fisher exact test), and (3) equally expressed under control and diquat exposure conditions (C=D, Fisher exact test). Differential expression (DE) was then tested using DESeq package (Anders and Huber, 2010). The analysis was performed after library normalization (function estimateSizeFactor), and following the procedure for data without replication. However, due to a large variance between libraries, the test was extremely conservative (only 6 DE cases). In order to elaborate some hypotheses to be further tested (using RNAseq on replicated data from Illumina Hiseq2000; ongoing project), we finally investigated KEGG annotation in contigs for which Log2Fold-Change fell outside the range [-2; +2] i.e., exhibiting a 4-fold increased expression under one of the conditions (after normalization). For contigs with no read in either control or diquat exposure condition, we selected those with at least 4 reads in the other condition. Then, we discarded annotation hits which were also found in the set of “non differentially expressed” contigs, as based on the criterion of |Log2FoldChange|<2. Furthermore, we also excluded all annotations with identity less than 50%. SNPs detection Putative SNPs (single-nucleotide polymorphism) were screened for contigs with a coverage depth of more than seven sequences. If the less frequent allele count was more than two and 100 % identical for four bases before and after the polymorphic site, we considered this site as a putative SNP. The putative SNPs were identified among 1362 (7.7%) contigs, resulting in 3708 sites with putative polymorphism. 87 Results & Discussion The prime objective of the present study was to increase the genomic resources in Lymnaea stagnalis and to make them available to the scientific community who uses this species as model. A Ensembl-like public database (Great pond snail Contig Browser) has been constructed which includes previously available sequences, and the ones developed in the present study (141,999 contigs in total). Contigs and annotations can be accessed directly from the database, and data mining can be performed using the incorporated Biomart tool. Pyrosequencing and contig assembly of ESTs Pyrosequencing of the two libraries led to a total of 406,245 raw sequences (after using Roche quality filters). Table 1 summarizes the effect of cleaning procedures on the final number of sequences. In total, 30.8 % of the initial reads were discarded from the dataset (37.1% in library C, 21.6% in library D). Sequence assembly was performed using reads from the present study and external L. stagnalis nucleotide sequences. A total of 141,999 contigs was generated, of which 124,387 were singlets and 17,612 non singlets. Mean length was 761bp for non singlet contigs and 438 bp for singlets. Excluding singlets, contig mean depth was 9.54 reads. The whole set of short reads is submitted to SRA (Sequence Read Archive, National Center for Biotechnology Information; accession [SRA049626.2]). Assembled contigs are publically available at http://genotoul- contigbrowser.toulouse.inra.fr:9095/Lymnaea_stagnalis/index.html. Table 1. Results of cleaning processes applied to the raw sequences obtained from L. stagnalis C and D libraries. The number of sequences is given for each library. Sequence type Initial sequences Too short / too long sequences Sequences with too many Ns Low complexity sequences Duplicate sequences Contaminations* Final sequences C D 241449 5631 431 12481 70808 131 151967 164408 2998 194 9816 22333 122 128945 * from Blast against ecoli536, genbank_phage 178 and Saccharomyces cerevisiae. 88 Annotation BLAST search led to the annotation of 34.2% of the 141,999 contigs, with significant E-value (cut-off value set to 1e-5): 4.7 % against SwissProt, 13.8 % against TrEMBL, 2.7 % against RefSeqProt, and 13% against RefSeqRNA. The mean identity obtained with these 4 annotation databases was 64, 59, 53, and 92%, respectively. Fig.1 illustrates the distribution of identities according to the database. It is to be noted that high identities (> 90%) stemmed mostly from matches with Swissprot and RefseqRNA databases. With regard to Swissprot, this is likely to result from the automatic preference given to this database compared to frequency TrEMBL when both produce similar identity values. 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 RefSeqProt SwissProt TrEMBL RefSeqRNA 20 30 40 50 60 70 80 90 100 % identity Fig.1. Distribution of annotation quality according to the database used in BlastX (percent identity between query and database sequences). Dataset = LsContig V1. Functional annotation General processes GO annotation was summarized using the GO_slim generic ontology. GO terms (6,540 in total, ignoring 26 obsolete terms) were mapped to 556 GO_slim keywords and to 113 GO_slim classes. Main categories were represented as follows: biological process (31.26%), cellular component (33.60%), and molecular function (35.14%). Second, the KEGG database was also used. KEGG annotation helped identify predominant processes within each top category (Fig. 2). Energy metabolism was by far the most represented (metabolism category). In other categories, patterns were less marked. Nevertheless, translation predominated in genetic information processing, as did signal transduction in environmental information processing, and cell communication in cellular processes (although transport and catabolism were also well represented in the latter) (Fig. 2). 89 Considering organismal systems, most contigs matched with GO terms related to the circulatory system, whereas excretory system, development and environmental adaptation were the least represented (Fig. 3). It is to be mentioned that without a sequenced genome in L. stagnalis, observed abundances of GO and KEGG terms cannot be compared to any reference. Number of contigs 0 2000 Carbohydrate Metabolism Energy Metabolism Lipid Metabolism Nucleotid Metabolism Amino Acid Metabolism Metabolism of Other Amino Acids Glycan Synthesis and Metabolism Metabolism of Cofactors and Vitamins Metabolism of Terpenoids and Polyketides Biosynthesis of Other Secondary Metabolites Xenobiotic Biodegradation and Metabolism Transcription Translation Folding, Sorting and Degradation Replication and Repair Membrane Transport Signal Transduction Signaling Molecules and Interaction Transport and Catabolism Cell Motility Cell Growth and Death Cell Communication 4000 6000 8000 Metabolism Genetic Information Processing Environmental Information Processing Cellular Processes Fig.2. Number of contigs classified according to the KEGG top categories. 10000 8000 6000 4000 2000 0 Im 10000 E De Ne Se Ex Di En Ci ge rc mu nd o ns cr v ir ve ula eto r vou sti cr or on l o ne p ine v t y s r m o e m y Sy Sy Sy en Sy en Sy Sy ry S s ste s tal s t t t s y s e e t t m ste te em m e m Ad m m m ap ta ti o n Fig.3. Number of contigs classified according to the subcategories of KEGG organismal systems category (LsContigV1 annotated contigs). 90 12000 Stress response related genes Genes involved in various molecular pathways were searched for using KEGG annotations and KEGG pathways. In the context of the study, some pathways were given a specific attention (Tab. 2; see also detailed annotations per pathway in supplementary Table S2 to Table S13). Significant homology was found with 403 different genes involved in 13 pathways related to oxidative stress, antioxidant defense mechanisms, molecular and cellular stress, apoptosis, and metabolism of xenobiotics (Tab. 2). Table 2. Number of genes having at least one significant match (besthit annotation) in Pondsnail_Contig_V1, and involved in 13 KEGG pathways selected for their implication in oxidative and molecular stress. Molecular pathway KEGG pathway code Number of annotations in Pondsnail_ Contigs_V1 Alanine, aspartate and glutamate metabolism Apoptosis Ascorbate and aldarate metabolism Cystein and methionin metabolism Glutathione metabolism MAP kinase signaling Metabolism of xenobiotics by cytochrome P450 Oxidative phosphorylation p53 signaling Peroxisome Porphyrin and chlorophyll metabolism Protein processing in endoplasmic reticulum Retinol metabolism ko00250 ko04210 ko00053 ko00270 ko00480 ko04010 ko00980 ko00190 ko04115 ko04146 ko00860 ko04141 ko00830 24 20 8 20 29 56 12 62 19 45 17 76 15 Pathways related to the metabolism of non-enzymatic antioxidant scavengers were well represented (glutathione: 29 genes, ascorbate and aldarate: 8 genes). Cysteine and methionine metabolism was represented by 20 genes (supplementary Table S4), among which, cystathionine-γ-lyase, involved in the synthesis of cysteine, a critical amino-acid for glutathione synthesis (Diwakar and Ravindranath, 2007). Main enzymes involved in oxidative stress were represented, such as superoxide dismutases (Cu/Zn and Fe/Mn families), glutathione peroxidases, glutathione reductase, peroxiredoxins, glutathione S-transferases and catalase (Chaudière and Ferrari-Iliou, 1999; Wood et al., 2003; Rogers et al., 2006). Numerous genes involved in the peroxisome pathway had significant matches in the set of L. 91 stagnalis contigs (supplementary Table S10). Significant matches with genes implicated in apoptosis are listed in Table 3, with representatives of both intrinsic (AIF, EndoG) and extrinsic (caspase 8, IAP, etc.) pathways (Riedl and Shi, 2004). Table 3. Contig annotations matching with genes involved in apoptosis pathway (ko04210) (IAP = inhibitors of apoptosis) Gene name (enzyme code) Gene code KEGG Apoptosis regulator Apoptosis regulator BCL2 Ataxia telangectasia mutated family protein (EC 2.7.11.1) Baculoviral IAP repeat containing protein 2/3/4 cAMP-dependant protein kinase regulator (EC 2.7.11.1) Caspase 7 (EC 3.4.22.60) Caspase 8 (EC 3.4.22.61) Cytochrome C DNA fragmentation factor, 45 kD, alpha subunit Endonuclease G (EC 3.1.30.-) Inhibitor of nuclear factor kappa-B kinase subunit alpha (EC 2.7.11.10) Interleukin 1 receptor-associated kinase 4 (EC 2.7.11.1) Myeloid differentiated primary response protein Neurotrophic tyrosine kinase receptor type 1 (EC 2.7.10.1) NFKBIA: NF-kappa-B inhibitor alpha Nuclear factor NF-kappa-B p105 subunit Phosphatidylinositol-4,5-bisphosphate kinase (EC 2.7.1.153) Programmed cell death (apoptosis-inducing factor) (EC 1.-.-.-) Protein phosphatase 3, catalytic subunit (3.1.3.16) Protein phosphatase 3, regulatory subunit RAC serine / threonine protein kinase (EC 2.7.11.11) BAX BCL2 ATM, TEL1 IAP, BIRC_2_3_4 PRKAR CASP7 CASP8 CYC DFF45 (DFFA) EndoG IKBA, IKKA, CHUK IRAK4 MyD88 NRRK, TRKA I B NFKB1 PIK3C PDCD8,AIF Cn, PPP3C Cn, PPP3R PKA K02159 K02161 K04728 K04725 K04739 K04397 K04398 K08738 K02310 K01173 K04467 K04733 K04729 K03176 K04734 K02580 K00922 K04727 K04348 K06268 K04345 BlastX homology search found matches with other important genes, such as the one encoding biliverdin reductase, which role in antioxidant defense was recently demonstrated (Barañano et al., 2002), GADD45, a p53 target gene which is oxidative stress-responsive (Han et al., 2008), ferritin heavy chain, which reduces ROS production (H2O2) and apoptosis (Berberat et al., 2003; Aung et al., 2007), or a member of the ataxia telengectasia mutated protein family (ATM), which in humans regulates cellular response to oxidative stress (Guo et al., 2010) (see supplementary Table S9 for other p53 target genes). Regarding inflammatory response and oxidative stress in the gastro-intestinal system, annotations were also obtained for a set of important genes: oxidative stress-sensitive transcription factor NFkB, prostaglandin-endoperoxide synthase 2 (COX2, regulated by NFkB), myeloperoxidase (MPO) and inducible nitric oxide synthase (iNOS). Moreover, these three enzymes have been shown to be affected by diquat (Anton et al. 2007). Inhibitors of NFkB (IKBKA, Nemo-like kinase 92 NLK) were also identified. With respect to the mitogen-activated protein kinase (MAPK) cascade triggered by the accumulation of ROS (Son et al., 2011), important genes were annotated such as Upf1, a regulator of non-sense transcript which has been shown to control gene expression in response to oxidative stress . Several contigs significantly matched with the ROS receptor KEAP1 NRF2-associated protein and with cullins (see KEAP1-NRF2 pathway functions in oxidative and environmental stress tolerance (D’Autréaux and Toledano 2007). Nrf2 (which is bound to KEAP1) has been shown to induce a number of enzymes involved in ROS metabolism, in mice exposed to diquat (Osburn et al., 2006; Sun et al., 2011). In the MAP kinase signaling pathway, matches with extracellular signal-regulated kinase (ERK), p38 Map kinase (P38), TGF-beta receptor (TGFBR1) and related enzymes were identified, with more than 50 annotated genes involved in this pathway (supplementary Table S6). We also identified significant hits with other various genes of which expression was previously shown to be affected by diquat: crystallin (CRYAB), calmodulin (CALM), interleukin1 receptor (Waring et al., 2001). Finally, Pondsnail-Contigs_V1 had significant hits with 12 genes involved in the metabolism of xenobiotics by cytochrome P450 (KEGG pathway ko00980; supplementary Table S7). Globally, the new database provides access to the sequence of a number of new candidate genes involved in L. stagnalis response to stress. Differential expression under diquat exposure Differential expression was estimated by comparing the composition of non-singlet contigs, in terms of number of reads (RNAseq) from the two libraries (control and exposure to the herbicide diquat), and using Fisher’s exact test. Excluding singlets, 49.3% of the contigs were differently expressed among the two libraries. Within these contigs, 46.4% were overexpressed in snails exposed to diquat (53.6% under-expressed). The percentage of annotated sequences in the two categories was 32.7% and 27.6%, respectively. GOslim terms were compared among three categories of annotated contigs, i.e., overexpressed under diquat exposure, under-expressed under diquat exposure, equally expressed among control and exposure conditions. Results were plotted for the main categories using WeGo plotting tool (Fig. 4). Quantitatively, the various GO categories were evenly represented among the three groups of contigs, except for organelle part, auxiliary transport protein, and rhythmic processes (not represented in over-expressed contigs), virion part and 93 synapse part (only represented in under-expressed contigs), and nutrient reservoir and protein tag (exclusively represented in over-expressed contigs). However, all these categories were very weakly represented, which might be largely responsible for the observed patterns. More detailed annotations are provided, including statistical testing, for cellular components, molecular functions, and biological processes, respectively, as additional files (supplementary Tables S14, S15, S16). Figure 4. Comparison of the distribution of GO terms among three groups of contigs from Pondsnail_Contigs_V1. The X-axis shows subgroups of the three top categories of GO. The Y-axis shows the percentage (log-scale) of matched sequences in three groups of annotated contigs having at least one GO hit: non-differentially expressed among C and D libraries, overexpressed in D library, and underexpressed in D Library. Analysis of contigs exhibiting |Log2FoldChange| >2 revealed a subset of 94 annotations specific to these contigs. From this set, KEGG annotation identified various potentially affected pathways, which may be used to elaborate a signature of diquat effect on transcriptomic expression (Table 4). Several other contigs were excluded from this list, due to the fact that they shared the same best hit gene with contigs with a Log2FoldChange within [2; 2]. 94 Table 4. List of gene hits (identity > 50%) matching exclusively with contigs for which Log2FoldChange is either less than - 2 or higher than + 2 between diquat and control conditions (D<C; D>C), or with contigs with no read under one condition and at least 4 reads in the other condition. KEGG Process Cellular Processes Cell Communication Cell Growth & Death Transport & Catabolism Environmental Information Processing Membrane Transport Signal Transduction Signaing Molecules & interaction KEGG Pathway D<C Tight junction [PATH:ko04530] Apoptosis [PATH:ko04210] Cell cycle [PATH:ko04110] Endocytosis [PATH:ko04144] Lysosome [PATH:ko04142] Peroxisome [PATH:ko04146] Phagosome [PATH:ko04145] ABC transporters [PATH:ko02010] Solute carrier family [BR:ko02001] Transporters [BR:ko02000] MAPK signaling pathway [PATH:ko04010] Cell adhesion molecules (CAMs) [PATH:ko04514] Cellular antigens [BR:ko04090] Glycan binding proteins [BR:ko04091] GTP-binding proteins [BR:ko04031] Genetic Information Processing Chaperones and folding catalysts [BR:ko03110] Folding, Sorting & a Degradation Protein folding and associated processing Proteasome [BR:ko03051] SNARE interactions in vesicular transport [PATH:ko04130] Ubiquitin mediated proteolysis [PATH:ko04120] Ubiquitin system [BR:ko04121] Replication & Repair Chromosome [BR:ko03036] DNA replication proteins [BR:ko03032] Transcription Basal transcription factors [PATH:ko03022] Spliceosome [BR:ko03041], [PATH:ko03040] Translation Ribosome [PATH:ko03010], [BR:ko03009], [PATH:ko03008] RNA transport [PATH:ko03013] Transfer RNA biogenesis [BR:ko03016] NFKBIA ORC4 GM2A MVK hcaT PAK1, PPP3R L1CAM CD109 Carbohydrate Energy 95 RAB11A AP3D1 FAR DYNC1H pstS SLC28, SLC25A46 SLC37A3 MAPT, MP1, PP3R LGALS9 FKBP2, PIN4 pcm PSMD9 YKT6 KLHL10 TFIIB RBMX2, U2AF2 NHP2 a Alanine, aspartate & glutamate metabolism [PATH:ko00250] Amino acid related enzymes [BR:ko01007] Arginine and proline metabolism [PATH:ko00330] Glycine, serine & threonine metabolism [PATH:ko00260] Phenylalanine metabolism [PATH:ko00360] Ascorbate & aldarate metabolism [PATH:ko00053] Citrate cycle (TCA cycle) [PATH:ko00020] Inositol phosphate metabolism [PATH:ko00562] Nitrogen metabolism [PATH:ko00910] Oxidative phosphorylation [PATH:ko00190] RAB3B ENDOG RHOU Translation proteins Metabolism Amino Acid D>C NEDD4 KLHL10 (2) SIRT5 GINS2 DDX18, PRPF4, TXNL4A, RP-L2, PWP1, NIP7, NOP2, cca, NUP62 truA PUA domain protein GOT1 tdh PRDX6 QARS, GARS, NARS DNOS serA MIOX fumA NDUFS6, NDUFA4 PTEN fixA ATPeVAC39 Table 4. continued. KEGG Process Enzyme Families Glycan KEGG Pathway Peptidases [BR:ko01002] Protein kinases [BR:ko01001] Glycan Biosynthesis & N-Glycan biosynthesis a [PATH:ko00510] Others Lipid Biosynthesis of unsaturated fatty acids [PATH:ko01040] Fatty acid metabolism [PATH:ko00071] Sphingolipid metabolism [PATH:ko00600] Synthesis & degradation of ketone bodies [PATH:ko00072] Cofactors & Vitamins Folate biosynthesis [PATH:ko00790] Lipoic acid metabolism [PATH:ko00785] Riboflavin metabolism [PATH:ko00740] Glutathione metabolism [PATH:ko00480] Terpenoids & Polyketides Terpenoid backbone biosynthesis [PATH:ko00900] Nucleotide Purine [PATH:ko00230] & pyrimidine metabolism [PATH:ko00240] Xenobiotics Biodegradation [PATH:ko00627], [PATH:ko00643] & Metabolism Organismal Systems Immune System Fc gamma R-mediated phagocytosis [PATH:ko04666] Nervous System Synaptic vesicle cycle [PATH:ko04721] D<C REXO4, METTL3 D>C ENPEP PTK9 DPM3 PECR ACADS B4GALT6 bdh folA lipA dut acyP ACP1 CARP ispD RPB9, RPA12, RPB2, carB GSTZ1 (2) ARPC2 NAPA This might result from the occurrence of several isoforms associated with alternative splicing events or subfunctionalization within gene families. However, such hypotheses need further investigation to be confirmed. To this end, other sequencing methods, which produce a dramatically higher number of reads (e.g., RNAseq using HiSeq Illumina technology) will be applied, using the present database as reference transcriptome. The primary objective was to obtain a set of genomic resources in L. stagnalis with a purpose of annotation, to which 454pyrosequencing was most appropriate, due to the read length produced. The use of two contrasted conditions, with regard to oxidative stress, allowed broadening the range of expressed transcripts, i.e., in a qualitative manner (for the same reason, snails from different original populations were used, and various tissues were pooled). As a preliminary analysis, we investigated differential expression among the two conditions, however, results need to be interpreted with caution, in large part because the two conditions were not replicated. On the other hand, this strategy allowed to detect many genes involved in various stress related pathways, some of which being detected only under diquat exposure condition. These annotations provide tools that may thus be particularly useful to further studies focusing on the molecular basis of stress response in L. stagnalis. 96 SNP detection Putative SNPs were identified among 1,362 contigs, resulting in 3,708 sites. Transition type SNPs were slightly predominant (57.23 %), transversions represented 42.45 %, and 0.32% of the SNPs exhibited three different alleles. Conclusion The present paper reports on the generation of 141,999 EST contigs in L. stagnalis, based on 280,912 new reads and other previously published sequences. Similarity search against various databases produced significant matches for 34.2% of these contigs. This new genomic resource is made publically accessible, and provides a unique tool to discover genes of interest and develop new genetic markers, in an invertebrate species which is a “multidisciplinary” model for the scientific community, and also a model for future regulatory procedures to be implemented in ecological risk assessment (toxicogenomics, standardized tests). Based on functional annotation, we identified more than 400 putative genes of importance for the study of oxidative stress and cellular stress response. These newly identified homologies are expected to be valuable for the study of molecular mechanisms which underlie the response to chemicals, as exemplified here with a redox-cycling pesticide and a non-target organism. Oxidative stress was targeted in the present investigation, because it is indirectly involved in the modulation of various important life history and fitness-related traits, and may thus affect population evolutionary potential and long-term ability to respond to environmental contaminants. Sequence polymorphism was detected, providing a number of new genetic markers suited to genotyping. More generally, the new genomic resource obtained in L. stagnalis is expected to be a relevant tool for any genomic approach aimed at understanding the molecular basis of integrative physiological functions. Finally, this new collection of ESTs constitutes also a fundamental resource for the L. stagnalis Genome sequencing project . 97 Acknowledgments The project has been carried out with INRA financial support (EFPA Projet Innovant 2010; AIP Bioressources 2010). AB is granted by the INRA (PhD, Contrat Jeune Scientifique). The authors thank Christophe Plomion for advices and insightful comments on the project, and Marc Collinet and the INRA U3E staff for technical assistance. Supplementary Tables Table S1 Tentative estimates of EC50s for diquat, using data from Coutellec et al. 2008 (Chemosphere 73:326-336). Average values are given with their bootstrapped 95%CIs, as estimated under a Hill model, using the EXCELTM macro REGTOX (http://www.normalesup.org/~vindimian/en_index.html). Trait significantly affected by diquat at concentration 222.2µg/L EC50 average (µg/L) CI 95% (µg/L) Adult growth 31.89 [23.12 ; 41.72] Progeny minimum development time 143.47 [118.17 ; 165.37] Clutch hatching rate 194.48 [157.87 ; 211.11] Table S2. Tissue volume / mass per condition (C = control, D = diquat exposure) and sample, and corresponding quantity of extracted total RNAs. GDC holds for gonado-digestive complex, BAP for body anterior part, and BPP for body posterior part. Tissue : Haemolymph GDC BAP BPP Total RNA: Haemolymph GDC BAP BAP 98 C D x ml 600 mg 1040 mg 1019 mg 32.7 µg 2417 µg 514 µg 1062 µg x ml 609 mg 968 mg 1020 mg 24 µg 2067 µg 852 µg 829 µg Table S3. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in alanine, aspartate and glutamate metabolism pathway (Ko00250). Gene name (enzyme code) Gene code KEGG 4-aminobutyrate aminotransferase (EC 2.6.1.19) 4-amino-butyrate aminotransferase/(S) 3-amino-2-methylpropionate transaminase (2.6.1.19, 2.6.1.22) puuE ABAT K00823 K13524 Adenylosuccinate lyase (EC 4.3.2.2) Adelynosuccinate synthase (EC 6.3.4.4) Argininosuccinate lyase (EC 4.3.2.1) purB purA argH, ASL K01756 K01939 K01755 Argininosuccinate synthase (EC 6.3.4.5) Alanine dehydrogenase (EC 1.4.1.1) Alanine glyoxylate transaminase / (R)-3-amino-2-methylpropionate-pyruvate transaminase (2.6.1.44, 2.6.1.40) argG ald AGXT2 K01940 K00259 K00827 Alanine transaminase (EC 2.6.1.2) Aspartate aminotransferase, cytoplasmique (EC 2.6.1.1) GPT, ALT GOT1 K00814 K14454 Aspartate aminotransferase, mitochondrial (EC 2.6.1.1) Aspartate carbamoyltransferase catalytic subunit (EC 2.1.3.2) GOT2 pyrB, PYR2 K14455 K00609 Carbamoyl-phosphate synthase (ammonia) (EC 6.3.4.16) Carbamoyl-phosphate synthase/aspartate carbamoyltransferase/dihydroorotase (EC 6.3.5.5., 2.1.3.2, 3.5.2.3) Carbamoyl-phosphate synthase large subunit (EC 6.3.5.5) CPS1 CAD carB, CPA2 K01948 K11540 K01955 D-aspartate oxidase (EC 1.4.3.1) Glucosamine—fructose-6-phosphate aminotransferase (isomerizing) (EC 2.6.1.16) DDO glmS K00272 K00820 Glutamate decarboxylase (EC 4.1.1.15) Glutamate dehydrogenase (NAD(P)+) (EC 1.4.1.3) Glutamate synthase (NADPH/NADH) (EC 1.4.1.13, 1.4.1.14) gadB, gadA; GAD 1.4.1.3 GLT1 K01580 K00261 K00026 Glutamine synthetase (EC 6.3.1.2) Omega-amidase (EC 3.5.1.3) glna NIT2 K01915 K13566 Succinate-semialdehyde dehydrogenase (EC 1.2.1.24) Succinate-semialdehyde dehydrogenase (NADP+) (EC 1.2.1.16) 1.2.1.24 gabD K00139 K00135 99 Table S4. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in Ascorbate and aldarate metabolism (KEGG ko00053). Gene name (enzyme code) Gene code KEGG Aldehyde dehydrogenase (NAD+) (EC 1.2.1.3) 1.2.1.3 K00128 Aldehyde dehydrogenase family 7 member A1 (EC 1.2.1.31, 1.2.1.8, 1.2.1.3) Aldehyde dehydrogenase family 9 member A1 (EC 1.2.1.47, 1.2.1.3) Gluconolactonase (EC3.1.1.17) ALDH7A1 ALDH9A1 3.1.1.17 K14085 K00149 K01053 Glucuronosyltransferase (EC 2.4.1.17) Inositol oxygenase (EC 1.13.99.1) UGT MIOX K00699 K00469 L-ascorbate oxidase (EC 1.10.3.3) 1.10.3.3 K0423 UDPglucose 6-dehydrogenase (EC 1.1.1.22) UGDH, ugd K00012 Table S5. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in cystein and methionine metabolism pathway (ko00270). Gene name ( enzyme code) Gene code KEGG 1,2-dihydroxy-3-keto-5-methylthionpentene dioxygenase (EC 1.13.11.53, 1.13.11.54) mtnD, mtnZ, ADI1 K08967 5’-methylthioadenosine phosphorylase (EC 2.4.2.28) mtaP K00772 Adenosylhomocysteinase (EC 3.3.1.1) Aspartate aminotransferase, cytoplasmic (EC 2.6.1.1) ahcY GOT1 K01251 K14454 Aspartate aminotransferase, mitochondrial (EC 2.6.1.1) GOT2 K14455 Betaine-homocysteine S-methyltransferase (EC 2.1.1.5) Cystathionine beta-synthase (EC 4.2.1.22) BHMT CBS K00544 K01697 Cystathionine gamma-lyase (EC 4.4.1.1) Cysteine dioxygenase (EC 1.13.11.20) 4.4.1.1 CDO1 K01758 K00456 Cysteine synthase A (EC 2.5.1.47) DNA(cytosine-5-)-methyltransferase (EC 2.1.1.37) cysK DNMT, dcm K01738 K00558 Enolase-phosphatase E1 (EC 3.1.3.77) mtnC K09880 L-serine dehydratase (EC 4.3.1.17) Methylthioribose-1-phosphate isomerase (EC 5.3.1.23) sdaA mtnA K01752 K08963 O-succinylhomoserine sulfhydrase (EC 2.5.1.-) S-adenosylmethionine decarboxylase (EC 4.1.1.50) metZ speD K10764 K01611 S-adenosylmethionine synthetase (EC 2.5.1.6) Spermidine synthase (EC 2.5.1.16) metK SRM, speE K00789 K00797 Thiosulfate/3-mercaptopyruvate sulfurtransferase (EC 2.8.1.1, 2.8.1.2) TST, MPST K01011 Tyrosine aminotransferase (EC 2.6.1.5) TAT K00815 100 Table S6. Genes with least one significant match (best-hit annotation) in LsContigV1, and involved in glutathione metabolism pathway (KEGG: ko00480). Gene name ( enzyme code) Gene code KEGG 6 Phosphogluconate dehydrogenase (EC 1.1.1.44) PGD, gnd K00033 Aminopeptidase N (EC 3.4.11.2) Cytosol Leucine aminopeptidase (EC 3.4.11.1) ANPEP, pepN LAP3 K11140, K01256 K11142 Isocitrate dehydrogenase (NADP) (EC 1.1.1.42) IDH1, IDH2 K00031 Gamma-glutamylcyclotransferase (EC 2.3.2.4) Gamma-glutamyltranspeptidase (EC 2.3.2.2) GGCT ggt K00682 K00681 Glucose-6-phosphate 1 dehydrogenase (EC 1.1.1.49) G6PD, zwf K00036 Glutamate-cysteine ligase (EC 6.3.2.2) Glutamate-cysteine ligase catalytic subunit GSH1 GCLC K01919 K11204 Glutamate-cysteine ligase regulatory subunit GCLM K11205 Glutathione peroxidase 4b (EC 1.11.1.9)) GPX4 K00432 Glutathione peroxidase 7 Glutathione reductase (NADPH) (EC 1.8.1.7) GPX7 GSR, gor K00432 K00383 Glutathione reductase, mitochondrial GSHR K00383 Glutathione S-transferase (EC 2.5.1.18) Glutathione S-transferase alpha-4 Gst GSTA4 K00799 K00799 Glutathione S-transferase kappa 1 Glutathione S-transferase class omega GSTK1 GTSO1 K13299 K00799 Glutathione S-transferase class pi GSTP1 K00799 Glutathione S-transferase class mu Glutathione S-transferase class sigma GTSM1 gst-7 K00799 K00799 Glutathione S-transferase microsomal 1 Glutathione synthase (EC 6.3.2.3) Leucyl aminopeptidase (EC 3.4.1.11) MGST1 gshB pepA, CARP K00799 K01920 K01255 Ornithine decarboxylase (EC 4.1.1.17) Ribonucleoside-diphosphate reductase subunit M2 (EC 1.17.4.1) Protein disulfide reductase (glutathione) (thioredoxine domaincontaining protein) (EC 1.8.4.2) ODC1 RRM2 K01581 K10808 TXNDC12 K05360 Pyrimidodiazepine synthase (EC 1.5.4.1) 1.5.4.1 K00310 Spermidine synthase (EC 2.5.1.16) SRM, spee K00797 101 Table S7. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in MAPk signaling pathway (KEGG ko0410). Gene name (enzyme code) Gene code KEGG Activating transcription factor 4 Activating transcription factor 6 Alpha 1,3-glucosidase (EC 3.2.1.84) CREB2, ATF4 ATF6 GANAB K04374 K09054 K05546 Apoptosis regulator BAX Apoptosis regulator BCL-2 BAX BCL2 K02159 K02161 Ataxin-3 B-cell receptor-associated protein 31 ATXN3, MJD BAP31, BCAP31 K11863 K14009 Calnexin Calreticulin CANX CALR K08054 K08057 Crystallin, alpha B Cullin 1 DnaJ homolog subfamily A member 1 CRYAB CUL1, CDC53 DNAJA1 K09542 K03347 K09502 DnaJ homolog subfamily A member 2 DnaJ homolog subfamily C member 1 DnaJ homolog subfamily C member 3 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase (EC 2.4.1.119) E3 ubiquitin-protein ligase synoviolin (EC 6.3.2.19) DNAJA2 DNAJC1 DNAJC3 K09503 K09521 K09523 STT3 K07151 SYVN1, HRD1 K10601 Endoplasmic reticulum lectin 1 Endoplasmic reticulum protein 29 ERLEC1, XTP3B ERP29 K14008 K09586 Eukaryotic translation initiation factor 2-alpha kinase (EC 2.7.11.1) GTP-binding protein SAR1 (EC 3.6.5.-) EIF2AK SAR1 K08860 K07953 Heat shock protein 70kDa 1/8 Heat shock protein 110 kDa HSPA1_8 HSP110 K03283 K09485 Homology and U-box containing protein 1 Hsp70-interacting protein STUB1, CHIP, STIP1 HSPBP1 K09561 K09562 Hypoxia upregulated 1 Lectin, mannose-binding 2 HYOU1 LMAN2, VIP36 K09486 K10082 Mannosyl-oligosaccharide alpha-1,2-mannosidase (EC 3.2.1.113) Mitogen-activated protein kinase5 MAN1 MPA3K5, ASK1 K01230 K04426 Molecular chaperone HtpG Nuclear protein localization protein 4 homolog htpG, HSP90A NPLOC4, NPL4 K04079 K14015 Oligosaccharyltransferase complex subunit alpha (ribophorin I) Oligosaccharyltransferase complex subunit beta OST1, RPN1 WBP1 K12666 K12670 Oligosaccharyltransferase complex subunit delta (ribophorin II) Oligosaccharyltransferase complex subunit epsilon SWP1, RPN2 OST1, DAD1 K12667 K12668 Oligosaccharyltransferase complex subunit gamma Parkin OST3, OST6 PARK2 K12669 K04556 102 Table S7. continued (KEGG ko0410). Gene name (enzyme code) Gene code KEGG P21-activated kinase 2 (EC 2.7.11.1) PAK2 K04410 P38 MAP kinase (E 2.7.11.24) P90 ribosomal S6 kinase (EC 2.7.11.1) P38 RPS6KA, RSK2 K04441 K04373 Protein kinase A (E C 2.7.11.11) Protein phosphatas e 1A (EC 3.1.3.16) PKA PPM1A, PP2CA K04345 K04457 Protein phosphatas e 3, catalytic subunit (EC 3.1.3.16) PPP3C K04348 Protein phosphatas e 3, regulatory subunit Protein phosphatas e 5 (EC 3.1.3.16) PPP3R, CNB PPP5C K06268 K04460 Proto-oncogene C-crk RAC serine/threonine-protein kinase (EC 2.7.11.1) CRK, CRKII AKT K04438 K04456 Rap guanine nucleotide exchange factor (GEF)2 RAPGEF2, PDZGEF1 K08018 Ras-related botulinum toxin substrate 1 Ras-related protein M-Ras RAC1 MRAS K04392 K07831 Ras-related protein Rap-1A RAP1A K04353 Ras-specific guanine nucleotide-releasing factor 1 Stathmin RASGRF1 STMN1 K04349 K04381 TAK1-binding protein 1 TGF-beta receptor type-1 (EC 2.7.11.30) MAP3K7IP1, TAB1 TGFBR1 K04403 K04674 TNF receptor-associated factor 6 TRAF6 K03175 Voltage-dependent calcium channel beta-2 Voltage-dependent calcium channel L type alpha-1, invertebrate CACNB2 CACNA1N K04863 K05315 Voltage-dependent calcium channel L type alpha-1C CACNA1C K04850 Table S8. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in metabolism of xenobiotics by cytochrome P450 (ko00980). Gene name (enzyme code) Gene code KEGG Aldehyde dehydrogenase NAD(P)+ E.1.2.1.5 K00129 S-(hydroxymethyl)glutathione dehydrogenase/ alcohol dehydrogenase Carbonyl reductase frmA, ADH5, adhC CBR1 K00121 K00079 Cytochrome P450, family 1, subfamily A, polypeptide 1 Cytochrome P450, family 2, subfamily B Cytochrome P450, family 2, subfamily C CYP1A1 CYP2B CYP2C K07408 K07412 K07413 Cytochrome P450, family 2, subfamily D Cytochrome P450, family 2, subfamily F Cytochrome P450, family 3, subfamily A (EC 1.14.14.1) CYP2D CYP2F CYP3A K07414 K07416 K07424 Duhydrodiol dehydrogenase/D-xylose 1 dehydrogenase (NADP) EC 1.3.1.20.,1.1.1.179 Glutathione S-transferase DHDH gst K00078 K00799 Glucuronyl transferase UGT K00699 103 Table S9. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in oxidative phosphorylation pathway (KEGG Ko00190). Gene name (enzyme code) Gene code KEGG Cytochrome c oxidase assembly protein subunit 15 Cytochrome c oxidase subunit 1 (EC 1.9.3.1) COX15 COX1 K02259 K02256 Cytochrome c oxidase subunit 2 COX2 K02261 Cytochrome c oxidase subunit 3 Cytochrome c oxidase subunit 4 COX3 COX4 K02262 K02263 Cytochrome c oxidase subunit 5a COX5A K02264 Cytochrome c oxidase subunit 5b COX5B K02265 Cytochrome c oxidase subunit 6a Cytochrome c oxidase subunit 6b COX6A COX6B K02266 K02267 F-type H+-transporting ATPase 54 kD subunit (EC 3.6.3.14) F-type H+-transporting ATPase Oligomycin sensitivity conferral protein F-type H+-transporting ATPase subunit 6 ATPeV54kD, V-type K02144 ATPeF1O, ATP5O K02137 ATPeF0F6, ATP5J K02131 F-type H+-transporting ATPase subunit a ATPeF0A, MTATP6 K02126 F-type H+-transporting ATPase subunit AC39b F-type H+-transporting ATPase subunit alpha ATPeAC39, ATP6D ATPeF1A, ATP5A1 K02146 K02132 F-type H+-transporting ATPase subunit b ATPeF0B, ATP5F1 K02127 F-type H+-transporting ATPase subunit beta ATPeF1B, ATP5B K02133 F-type H+-transporting ATPase subunit c ATP2F0C, ATP5G K02128 F-type H+-transporting ATPase subunit d F-type H+-transporting ATPase subunit delta ATPeFD, ATP5H ATPeF1D, ATP5D K02138 K02134 F-type H+-transporting ATPase subunit f ATPeF0F, ATP5J2 K02130 F-type H+-transporting ATPase subunit g ATPeFG, ATP5L K02140 F-type H+-transporting ATPase subunit gamma ATPeF1G, ATP5C1 K02136 Inorganic pyrophosphatase (EC 3.6.1.1) NADH-quinone oxi doreductase subunit H (EC 1.6.5.3) ppa nuoH K01507 K00337 NADH dehydrogenase (1.6.99.3) ndh K03885 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4 NDUFA4 K03948 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 6 NDUFA6 K03950 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 7 NDUFA7 K03951 NADH-dehydrogenase (ubiquinone) 1 alpha subcomplex 11 NADH-dehydrogenase (ubiquinone) 1 alpha subcomplex 13 NDUFB11 NDUFA13 K11351 K11353 NADH dehydrogenase (ubiquinone) 1 alpha/beta subcomplex 1 NDUFAB1 K03955 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 2 NDUFB2 K03958 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 5 NDUFB5 K03961 NADH dehydrogenase (ubiquinone) Fe-S protein 1 NADH dehydrogenase (ubiquinone) Fe-S protein 2 NDUFS1 NDUFS2 K03934 K03935 104 Table S9. continued (KEGG Ko00190). Gene name (enzyme code) Gene code KEGG NADH dehydrogenase (ubiquinone) Fe-S protein 3 NDUFS3 K03936 NADH dehydrogenase (ubiquinone) Fe-S protein 4 NADH dehydrogenase (ubiquinone) Fe-S protein 8 NDUFS4 NDUFS8 K03937 K03941 NADH dehydrogenase (ubiquinone) Fe-S protein 6 NDUFV2 K03943 NADH-ubiquinone oxidoreductase chain 1 (EC 1.6.5.3) ND1 K03878 NADH-ubiquinone oxidoreductase chain 2 ND2 K03879 NADH-ubiquinone oxidoreductase chain 4 NADH-ubiquinone oxidoreductase chain 5 Succinate dehydrogenase (ubiquinone) flavoprotein subunit (EC 1.3.5.1) Succinate dehydrogenase (ubiquinone) iron-sulfur subunit Ubiquinol-cytochrome c reductase core subunit 2 ND4 ND5 K03881 K03883 SDH1, SDHA K00234 SDHB, SDH2 QCR2, UQCRC2 K00235 K00415 Ubiquinol-cytochrome c reductase cytochrome b subunit CYTB, petB K00412 Ubiquinol-cytochrome c reductase subunit 6 QCR6, UQCRH K00416 Ubiquinol-cytochrome c reductase subunit 7 QCR7, UQCRB K00417 V-type H+- transporting ATPase subunit A (3.6.3.14) V-type H+- transporting ATPase subunit B ATPeVA,ATP6A1 ATPeVB,ATP6B1 K02145 K02147 V-type H+- transporting ATPase subunit C ATPeVC, ATP6C K02148 V-type H+- transporting ATPase subunit D ATPeVD, ATP6M K02149 V-type H+- transporting ATPase subunit E ATPeVE, ATP6E K02150 V-type H+- transporting ATPase subunit F V-type H+- transporting ATPase subunit G ATPeVF,ATP6S14 ATPEVG, ATP6G1 K02151 K02152 V-type H+- transporting ATPase subunit H ATPeVH,ATP6H K02153 V-type H+- transporting ATPase subunit I ATPeVI,ATP6NA1 K02154 V-type H+- transporting ATPase 16kDa proteolipid subunit ATPeVL,ATP6L K02155 V-type H+- transporting ATPase 21kDa proteolipid subunit V-type H+- transporting ATPase S1 subunit ATPeVPF, ATP6F ATPeVS1,ATP6S1 K03661 K03662 105 Table S10. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in in p53 signaling pathway (KEGG Ko04115). Gene name (enzyme code) Gene code KEGG Apoptosis regulator Ataxia telangectasia mutated family protein (EC 2.7.11.1) Caspase 8 (EC 3.4.22.61) BAX ATM, TEL1 CASP8 K02159 K04728 K04398 Cyclin B Cyclin D2 CCNB CCND2 K05868 K10151 Cyclin G1 Cyclin-dependant kinase 4 (EC 2.7.11.1) CCNG1 CDK4 K10145 K02089 Cyclin-dependant kinase 6 (EC 2.7.11.1) Cytochrome C CDK6 CYC K02091 K08738 Growth arrest and DNA damage inducible protein GADD45 K04402 Leucin-rich repeats and death domain containing protein Phosphatidylinositol-3,4,5-triphosphate3-phosphatase (EC 3.1.3.67) LRDD, PIDD PTEN K10130 K01110 Plasminogen activator inhibitor-1 Ribonucleoside diphosphate reductase subunit M2 (EC 1.17.4.1) Ring finger and CHY zinc finger domain-containing protein 1 SERPINE1, PAI1 K03982 RRM2 (p53R2) K10808 PIRH2, RCHY1 K10144 Serine/threonine protein kinase ChK2 (EC 2.7.11.1) Sestrin CHK2 SESN K06641 K10141 Tuberous sclerosis 2 protein (tuberin, tumor growth suppressor) TSC2 K07207 Tumor protein p53-inducible protein 3 (EC 1.-.-.-) TP53I3, PIGs K10133 106 Table S11. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in peroxisome pathway (KEGG ko04146). Gene name (enzyme code) Gene code KEGG 2-hydroxyacyl-CoA lyase 1 (EC 4.1.-.-) HACL1 K12261 HSD17B4 K12405 3-hydroxyacyl-CoA dehydrogenase / 3a, 7a, 12ª-trihydroxy-5b-cholest-24-enoyl-CoA hydratase (EC 1.1.1.35, 4.2.1.107) Acetyl-CoA acyltransferase 1 (EC 2.3.1.16) ACAA1 K07513 AcylCoA oxidase (EC 1.3.3.6) Alanine-glyoxylate transaminase/serine-glyoxylate transaminase/serine-pyruvate transaminase (EC 2.6.1.44, 2.6.1.45, 2.6.1.51) Alpha-methylacyl-CoA racemase (EC 5.1.99.4) ACOX1, ACOX3 K00232 AGXT K00830 AMACR K01796 ATP-binding cassette, subfamily D (ALD) member 2 ABCD2, ALDL1 K05676 ATP-binding cassette, subfamily D (ALD) member 3 ABCD3, PMP70 K05677 Bile acid-CoA: amino acid N-acetyltransferase (EC 2.3.1.65, 3.1.2.2) Carnitine O-acyltransferase (EC 2.3.1.7) BAAT 2.3.1.7 K00659 K00624 Carnitine O-octanoyltransferase (EC 2.3.1.137) CROT K05940 Catalase (EC 1.11.1.6) katE, CAT K03781 Cu/Zn superoxide dismutase (EC 1.15.1.1) sodC, SOD1 K04565 D-aspartate oxidase (EC 1.4.3.1) DDO K00272 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase (EC 5.3.3.-) D-amino-acid oxidase (EC 1.4.3.3) ECH1 DAO K12663 K00273 Dehydrogenase/reductase SDR family member 4 (EC 1.1.-.-) Enoyl-CoA hydratase/3 hydroxyacyl-CoA dehydrogenase/3,2-trans-enoyl(CoA isomerase (EC 4.2.1.17, 1.1.1.35, 5.3.3.8) Fatty-acyl CoA reductase (EC 1.2.1.-) DHRS4 K11147 EHHADH K07514 FAR K13356 Glutathione S-transferase kappa 1 (2.5.1.18) GSTK1 K13299 Glyceronephosphate O-acyltransferase (EC 2.3.1.42) GNPAT K00649 Isocitrate dehydrogenase (EC 1.1.1.42) IDH1, IDH2, icd K00031 Long-chain acyl-CoA synthetase (EC 6.2.1.3) ACSL, fadD K01897 Mevalonate kinase (EC 2.71.36) MVK, mvaK1 K00869 N1-acetylpolyamine oxidase (EC 1.5.3.13) NAD+ diphosphatase (EC 3.6.1.22) PAOX NUDT12, nudC K00308 K03426 Nitric-oxide synthase, inducible (EC 1.14.13.39) NOS2 K13241 Nucleoside diphosphate-linked moiety X motif19, mitochondrial (EC 3.6.1.-) NUDT19 K13355 Peroxin10 PEX10 K13346 Peroxin 11B PEX11B K13352 Peroxin-13 Peroxin-14 PEX13 PEX14 K13344 K13343 Peroxin-26 Peroxiredoxin1 (EC 1.11.1.15) Peroxiredoxin 5, atypical 2-Cys peroxiredoxin (EC 1.11.1.15) PEX26 PRDX1 PRDX5 K13340 K13279 K11187 Peroxisomal 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) PECI K13239 Peroxisomal membrane protein 2 Peroxisomal trans-2-enoyl-CoA reductase (EC 1.3.1.38) PXMP2, PMP22 PECR K13347 K07753 Phosphomevalonate kinase (EC 2.7.4.2) PMVK K13273 Phytanoyl-CoA hydroxylase (EC1.14.11.18) Sarcosine oxidase / L-pipecolate oxidase (EC 1.5.3.1, 1.5.3.7) K00477 K00306 Sterol carrier protein 2 (EC 2.3.1.176) PHYH PIPOX SLC27A2, FACVL1, FATP2 SCP2, SCPX Superoxide dismutase, Fe-Mn family (EC 1.15.1.1) sodA, sodB, SOD2 K04564 Xanthine dehydrogenase/oxidase (EC 1.17.1.4, 1.17.3.2) XDH K00106 Solute carrier family 27 (fatty acid transporter), member 2 (EC 6.2.1.-, 6.2.1.3) 107 K08746 K08764 Table S12. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in porphyrin and chlorophyll metabolism (KEGG pathway Ko00860). Gene name (enzyme code) Gene code KEGG 5-aminolevulinate synthase (EC 2.3.1.37) ALAS K00643 Adenosylcobionamide-phosphate synthase (EC 6.2.1.10) cbiB, cobD K02227 Beta-glucuronidase (EC 3.2.1.31) Bifunctional glutamyl/prolyl-tRNA synthetase (EC 6.1.1.17, 6.1.1.15) GUSB EPRS K01195 K14163 Biliverdin reductase/flavin reductase (EC 1.3.1.24, 1.5.1.30) BLVRB K05901 Cob(l)alamin adenosyltransferase (EC 2.5.1.17) cobO, btuR K00798 Cytochrome c heme-lyase (EC 4.4.1.17) 4.4.1.17 K01764 Cytochrome oxidase assembly protein subunit 15 COX15 K02259 Ferritin heavy chain (EC 1.16.3.1) Ferrochelatase (EC 4.99.1.1) FTH1 hemH, FECH K00522 K01772 Glucuronyltransferase (EC 2.4.1.17) UGT K00699 Glutamyl-tRNA synthetase (EC 6.1.1.17) EARS, gltX K01885 Hydroxymethylbilane synthase (EC 2.5.1.61) hemC, HMBS K07149 Porphobilinogen synthase (EC 4.2.1.24) Uroporphyrin-III C-methyltransferase (EC 2.1.1.107) hemB, ALAD cobA K01698 K02303 Uroporphyrinogen decarboxylase (EC 4.1.1.37) hemE, UROD K01599 Uroporphyrinogen-III synthase (EC4.2.1.75) hemD, UROS K01719 108 Table S13. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in protein processing in endoplasmic reticulum (KEGG pathway ko04141). Gene name (enzyme code) Gene code KEGG Activating transcription factor 4 Activating transcription factor 6 CREB2, ATF4 ATF6 K04374 K09054 Alpha 1,3-glucosidase (EC 3.2.1.84) Apoptosis regulator BAX Apoptosis regulator BCL-2 GANAB BAX BCL2 K05546 K02159 K02161 Ataxin-3 B-cell receptor-associated protein 31 Calnexin Calreticulin ATXN3, MJD BAP31, BCAP31 CANX CALR K11863 K14009 K08054 K08057 Crystallin, alpha B Cullin 1 DnaJ homolog subfamily A member 1 CRYAB CUL1, CDC53 DNAJA1 K09542 K03347 K09502 DnaJ homolog subfamily A member 2 DnaJ homolog subfamily C member 1 DnaJ homolog subfamily C member 3 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase (EC 2.4.1.119) E3 ubiquitin-protein ligase synoviolin (EC 6.3.2.19) Endoplasmic reticulum lectin 1 Endoplasmic reticulum protein 29 DNAJA2 DNAJC1 DNAJC3 K09503 K09521 K09523 STT3 K07151 SYVN1, HRD1 ERLEC1, XTP3B ERP29 K10601 K14008 K09586 Eukaryotic translation initiation factor 2-alpha kinase (EC 2.7.11.1) GTP-binding protein SAR1 (EC 3.6.5.-) Heat shock protein 70kDa 1/8 EIF2AK SAR1 HSPA1_8 K08860 K07953 K03283 Heat shock protein 110 kDa Homology and U-box containing protein 1 Hsp70-interacting protein HSP110 STUB1, CHIP, STIP1 HSPBP1 K09485 K09561 K09562 Hypoxia upregulated 1 Lectin, mannose-binding 2 Mannosyl-oligosaccharide alpha-1,2-mannosidase (EC 3.2.1.113) HYOU1 LMAN2, VIP36 MAN1 K09486 K10082 K01230 Mitogen-activated protein kinase5 Molecular chaperone HtpG Nuclear protein localization protein 4 homolog MPA3K5, ASK1 htpG, HSP90A NPLOC4, NPL4 K04426 K04079 K14015 Oligosaccharyltransferase complex subunit alpha (ribophorin I) Oligosaccharyltransferase complex subunit beta Oligosaccharyltransferase complex subunit delta (ribophorin II) OST1, RPN1 WBP1 SWP1, RPN2 K12666 K12670 K12667 Oligosaccharyltransferase complex subunit epsilon Oligosaccharyltransferase complex subunit gamma Parkin OST1, DAD1 OST3, OST6 PARK2 K12668 K12669 K04556 109 Table S13. continued (KEGG pathway ko04141). Gene name (enzyme code) Gene code KEGG Phospholipase A-2-activating protein Phospholipase A-2-activating protein Prolactin regulatory element-binding protein PLAA, DOA1, UFD3 PLAA, DOA1, UFD3 PREB, SEC12 K14018 K14018 K14003 Protein transport protein SEC61 subunit gamma and related proteins Protein disulfide isomerase A1 (EC 5.3.4.1) Protein disulfide isomerase A4 SEC61G, SSS1, secE PDIA1, P4HB PDIA4, ERP72 K07342 K09580 K09582 Protein disulfide isomerase A6 Protein disulfide isomerase family A, member 3 (EC 5.3.4.1) Protein kinase C substrate 80K-H PDIA6, TXNDC7 PDIA3, GRP58 PRKCSH K09584 K08056 K08288 Protein transport protein SEC61 subunit alpha Protein transport protein SEC13 Protein transport protein SEC31 SEC61A SEC13 SEC31 K10956 K14004 K14005 Protein transport protein SEC23 SEC23 K14006 Protein transport protein SEC24 Protein transport protein SEC61 subunit beta SEC24 SEC61B, SBH2 K14007 K09481 RING-box protein 1 RBX1, ROC1 K03868 SEL1 protein S-phase kinase-associated protein 1 Translation initiation factor 2 subunit 1 SEL1 SKP1, CBFD EIF2S1 K14026 K03094 K03237 Translocation protein Translocation protein SEC62 Translocon-associated protein subunit delta SEC63 SEC62 SSR4 K09540 K12275 K04571 Ubiquilin Ubiquitin-conjugating enzyme E2 D/E (EC 6.3.2.19) Ubiquitin-conjugating enzyme E2 G1 UBQLN, DSK2 K04523 UBE2D_E, UBC4, UBC5 K06689 UBE2G1, UBC7 K10575 Ubiquitin-conjugating enzyme E2 G2 Ubiquitin fusion degradation protein 1 Ubiquitin-protein ligase RNF5 UBX domain-containing protein 1 UBE2G2, UBC7 UBE2J1, NCUBE1, UBC6 UBE2J2, NCUBE2, UBC6 UFD1 RNF5 SHP1, UBX1, NSFL1C K14016 K10666 K14012 UDP-glucose:glycoprotein glucosyltransferase (EC 2.4.1-) UV excision repair protein RAD23 Translocon-associated protein subunit alpha HUGT RAD23, HR23 SSR1 K11718 K10839 K13249 Translocon-associated protein subunit beta Translocon-associated protein subunit gamma Transitional endoplasmic reticulum ATPase SSR2 SSR3 VCP, CDC48 K13250 K13251 K13525 Wolfamin X box-binding protein 1 WFS1 XBP1 K14020 K09027 Ubiquitin-conjugating enzyme E2 J1 (EC 6.3.2.19) Ubiquitin-conjugating enzyme E2 J2 110 K04555 K10578 K04554 Table S14. Genes with at least one significant match (best-hit annotation) in LsContigV1, and involved in retinol metabolism pathway (KEGG pathway ko00830). Gene name (enzyme code) Gene code KEGG All-trans-retinol 13,14 reductase (EC 1.3.99.23) Cytochrome P450 family 1, subfamily A, polypeptide 1 (EC 1.14.14.1) RETSAT CYP1A1 K09516 K07408 Cytochrome P450 family 2, subfamily B CYP2B K07412 Cytochrome P450 family 2, subfamily C Cytochrome P450 family 3, subfamily A CYP2C CYP3A K07413 K07424 Cytochrome P450 family 4, subfamily A Cytochrome P450 family 26, subfamily A CYP4A CYP26A K07425 K07437 Dehydrogenase / reductase SDR family member 9 (EC 1.1.-.-) Glucuronosyltransf erase (EC 2.4.1.17) DHRS9 UGT K11149 K00699 Retinol dehydrogenase 10 (EC 1.1.1.-) RDH10 K11151 Retinol dehydrogenase 16 Retinol dehydrogenase R RDH16 RDH5 K11154 K00061 Retinol dehydrogenase 11 Retinol dehydrogenase (hydroxysteroid dehydrogenase) (EC 1.1.1.105) S-(hydroxymethyl) glutathione dehydrogenase/alcohol dehydrogenase (EC 1.1.1.284, 1.1.1.1) RDH11 HSD17B6 ADH5, fmrA, adhC K11152 K13369 K00121 Table S15-S16-S17-18 Available on line (http://link.springer.com/article/10.1007/s10646-012-0977-1) Table S15. Summary of GO annotation statistics in “Cellular Component” GO category, as provided by WEGO. Columns 1 and 2: first value refers to non-differentially expressed genes (1), second and third values (2 and 3) to over and under-expressed genes, respectively. Column 3: P-values are given for Pearson Chi-square pairwise tests, ordered as 1:2,1:3, 2:3. Ml holds for “meaningless” (count<5), Na for “not available”. Dataset = Pondsnail_Contigs_V1. Table S16. Summary of GO annotation statistics in “Molecular Function” GO category, as provided by WEGO. Columns 1 and 2: first value refers to non-differentially expressed genes (1), second and third values (2 and 3) to over and under-expressed genes, respectively. Column 3: P-values are given for Pearson Chi-square pairwise tests, ordered as 1:2,1:3, 2:3. Ml holds for “meaningless” (count <5), Na for “not available”. Dataset = Pondsnail_Contigs_V1 Table S17. Summary of GO annotation statistics in “Biological Process” GO category, as provided by WEGO. Columns 1 and 2: first value refers to non-differentially expressed genes (1), second and third values (2 and 3) to over and under-expressed genes, respectively. Column 3: P-values are given for Pearson Chi-square pairwise tests, ordered as 1:2,1:3, 2:3. Ml holds for “meaningless” (count <5), Na for “not available”. Dataset = Pondsnail_Contigs_V1 Table S18. KEGG code, abbreviation and name of genes identified in L. stagnalis transcriptome as putatively regulated by diquat (see Table 4) 111 Primer note - Isolation and characterization of three new multiplex sets of microsatellite markers in the hermaphroditic freshwater snail Lymnaea stagnalis (Mollusca, Gastropoda, Heterobranchia, Panpulmonata, Hygrophila) using 454-pyrosequencing technology Anne-Laure Besnard1, Anthony Bouétard1, Didier Azam2 and Marie-Agnès Coutellec1 1 INRA, UMR0985 Ecologie et Santé des Ecosystèmes, INRA/Agrocampus-Ouest, Equipe EQMA, 65 rue de Saint-Brieuc. 35042 Rennes Cedex, France 2 INRA, U3E, Unité Expérimentale d’Ecologie et Ecotoxicologie Aquatique, 65 rue de SaintBrieuc. 35042 Rennes Cedex, France Correspondence: Marie-Agnès Coutellec, INRA, UMR0985 Ecologie et Santé des Ecosystèmes, INRA/Agrocampus-Ouest, Equipe EQMA, 65 rue de Saint-Brieuc. 35042 Rennes Cedex, France Fax : +33(0)223485248 E-mail : [email protected] Keywords: Lymnaea stagnalis, microsatellites, pyrosequencing, evolutionary ecotoxicology, mating system Running title: nine new microsatellite loci in L. stagnalis Abstract A new set of microsatellite loci was isolated in the pondsnail Lymnaea stagnalis, using 454FLX Titanium pyrosequencing technology. Of these, 174 loci were perfect motifs. Experimental conditions are described for amplification and multiplex fragment analysis of nine validated loci. Allelic variation is described in three laboratory cultures and two natural populations. Genetic variation was low to moderate regardless of sample origin, with four to eight polymorphic loci per population, whereas genetic differentiation was very high. This new set of microsatellites will be useful to eco-evolutionary and genetic studies involving L. stagnalis. 112 Introduction The freshwater pulmonate gastropod Lymnaea stagnalis is a model species used in various research fields, including behavioural ecology, evolutionary biology, parasitology, aquatic ecotoxicology, and neurophysiology (Adema et al., 1994; Carter et al., 2006; Coutellec and Caquet, 2011; Byzitter et al., 2012; Hoffer et al., 2012). With regard to the mating system, it belongs to the main group of self-fertile animals, suborder Basommatophora (Escobar et al., 2011). Although demonstrated as a preferential outcrosser, L. stagnalis shows very low inbreeding depression (Puurtinen et al., 2007; Coutellec and Caquet, 2011), in opposition with theoretical expectations (Charlesworth and Charlesworth, 1987). These characteristics make L. stagnalis a good model to test alternative hypotheses on mating system evolution, within basommatophorans. Ecologically, L. stagnalis is representative of freshwater lentic environments and of the herbivorous macroinvertebrate community. Freshwater snails may represent up to 20—60% of the total abundance and biomass of macroinvertebrates in some freshwater ecosystems (Habdija et al., 1995) where they play a major role in the transfer of energy and material across food webs. In this context, L. stagnalis is widely used for environmental issues and ecological applications (Coutellec et al., 2011). Finally, transcriptomic resources (Davison and Blaxter, 2005; Feng et al., 2009) have been recently updated in this species using 454 pyrosequencing (Bouétard et al., 2012). A total of 15 microsatellite loci were previously available in this species (Knott et al. 2003; Kopp and Wolf 2007, Genbank accessions [EF208747-EF208522]). However, due to low polymorphism in some populations, most of these loci are not suitable for high-resolution population genetics studies (e.g., natural estimation of heritability, Ritland, 2000) or parentage analysis. In order to circumvent this drawback, we isolated new microsatellite markers in L. stagnalis using pyrosequencing, and present here a set of characterized loci, which can be amplified and assessed under three multiplexes. The present study also aimed to characterize the genetic diversity of three laboratory cultures at these loci, and compared it to that of two natural populations, in order to assess whether culturing reduced variation. This information may indeed be useful to take into account in experiments designed for eco-evolutionary and ecotoxicological issues. 113 Materials and method Biological material Snails originated from three cultures maintained for several years by the INRA Experimental Unit of Aquatic Ecology and Ecotoxicology (INRA U3E, Rennes, France): REN (Renilys® strain, first established in 2000 from Le Rheu ponds) stems from a local population (Le Rheu, INRA, France), AMS was initiated in 2007 with clutches from a culture of the Ecology Laboratory of Amsterdam University (V.U., Amsterdam, The Netherlands), and SAN was settled from a sample of adults and clutches collected in Spring 2010 in Sønderborg (Sandbjerg Estate, Aarhus Univ. Conference Centre, Denmark). These cultures have previously been used for transcriptome pyrosequencing (Bouétard et al., 2012; [SRA049626]). Samples from two natural populations were also used: CAS (Castricum, 52.548°N, 4.618°E) and KUI (Kuinre, 52.794°N, 5.795 °E), collected as adults in July 2011 (see location on Fig.1). DNA was chelex extracted for fragment analysis using non-invasive sampling of haemolymph tissue, as described earlier (Adema et al., 1994). SANDBJERG DK AMSTERDAM NL CASTRICUM NL KUINRE NL RENNES FR Figure 1. Geographic origin of Lymnaea stagnalis natural populations (Castricum and Kuinre, NL) and INRA U3E laboratory cultures (Le Rheu FR, Amsterdam NL, and Sandbjerg DK) used to describe genetic variability at 9 new microsatellites. Upper-left icon shows the UPGMA clustering of samples based on pairwise Fst-values. 114 DNA isolation Genomic DNA was extracted from 25 mg of foot fresh tissue, using the DNeasy blood and tissue Qiagen Kit. DNA quality was assessed on Nanodrop 2000 (Thermo scientific). Absorbance ratios were 1.90-2.06 at 260 / 280nm and 1.50-2.00 at 260 / 230nm and quality was estimated on agarose gel 1% with a 1kb SmartLadder. Library enrichment was performed as described in Malausa et al. (2011), using an optimization of classical biotin-enrichment methods (Kijas et al., 1994). Total DNA was enriched for the following motifs: (AG)10, (AC)10, (AAC)8, (AGG)8, (ACG)8, (AAG)8, (ACAT)6 and(ATCT)6. Each purified library was then pyrosequenced, using the 454 FLX Titanium Genome Analyser (Roche Applied Science), as described in Malausa et al. (2011). Sequences were sorted and selected with the software QDD (Meglécz et al., 2010). A total of 1515 valid microsatellite sequences were identified. From these, a subset of 248 loci longer than 100 bp, containing motifs with at least five repeats, and with satisfying primers (no tandem-repetition) was obtained, among which 174 loci were pure motif microsatellites (127 di-, 35 tri-, 10 tetra-, and 2 hexanucleotides). Amplification was tested on 48 of these 174 loci, which were selected according to the motif type (preference for dinucleotide motifs), amplicon size and annealing temperature. These markers were tested on individual DNA samples from each laboratory culture (REN, AMS and SAN). Genomic DNA was chelex extracted from haemolymph, with a proteinase K solution (10mg/ml), and was heated during 2 hrs at 55°C, then 10 min at 100°C. Multiplex optimization Fragment amplification was tested for each locus separately, on a capillary sequencer (ABI 3130xl) using a nested PCR, with the following set of primers: (1) sequence-specific forward primer with M13 at the 5’ end, (2) sequence-specific reverse primer, (3) universal fluorescent-labelled M13 primer. This method allows laser detection of amplification products without the need to directly label one of the sequence-specific primer (Schuelke, 2000). On the other hand, only post-PCR multiplex is possible under this design. PCR were performed in 6 µL of reaction volume, containing 0.06U Taq DNA polymerase and PCR buffer (GoTaq, Promega), 208µM each dNTP’s, 2.17 mM MgCl2, 0.055 µM, 0.055 µM sequence-specific forward primer with M13 at the 5’ end, 0.55 µM sequence-specific reverse primer and 0.57 µM universal fluorescent-labelled M13 primer. Touch-down PCR procedure was applied as follows: initial denaturation at 95°C for 4 min, 20 cycles consisting of a 115 denaturing step at 94 °C for 30 s, a touch-down annealing step from 65°C to 55°C for 30 s, and an extension step at 72 °C for1 min, then 10 cycles consisting of a denaturing step at 94 °C for 30 s, an annealing step at 55°C for 30 s, and an extension step at 72 °C for 1 min. A final extension step at 72°C was performed for 5 min. Each locus was first tested separately, using 6-FAM label. Non amplified loci and loci for which allele scoring was ambiguous or difficult were eliminated. For validated loci, a second step was performed, in which loci and dyes were combined in post-PCR multiplexes, according to size range and amplification signal (peak height) (Tab. 1). Table 1. Sequence and multiplex characteristics of 9 microsatellites loci isolated in L. stagnalis. Locus Motif Primer sequences (5'-3') Size (bp) Multiplex Dye set GenBank Accession EMLS04 (CG)7 GATGAACCCAACCTCGTCAC CATCCGGGAATGAGAACATC 100-116 EM1 NED JX287524 EMLS10 (CA)6 GTTCCGACGGTAGGCAGTAA 169-177 TAAGGAAAGGTAGGGGTGGG EM1 NED JX287525 EMLS13 (AT)5 TGAAGGGTGACAGCATGGTA GGTGACGCTCTAAATGGGAA 221-225 EM1 6FAM JX287526 EMLS05 (GT)7 TTAGGCCAGCTGCAGAGATT TGAGGCGAATATAGGGTTGG 123-127 EM2 6FAM JX287527 EMLS21 (TC) 5 CTTAACACGCTTCATTGCAGA 120-122 GGGGGAGAGGAGCAGAGA EM2 PET JX287528 EMLS26 (CT) 12 GTCTTCAAGAAGTGCGAGGG CTACTTTGCCGGTTGGTTTC 98-110 EM3 VIC JX287529 EMLS29 (CA)10 GGAACTATAGCCGCCCACTC CGTACACGGAGCCTTGAGTT 120-128 EM3 6FAM JX287530 EMLS41 (GA)11 TTATCGTTTTTGCTCCCTGC GCCAGGCTATCTGTCTCCAG 186-198 EM3 NED JX287531 EMLS45 (AG)7 ACGTGTTATCAACGCCTTCC 215-219 CGTAAAAGACCACGATGTAGT EM3 6FAM JX287532 116 Microsatellite scoring and diversity analysis Allele peaks were scored using GENEMAPPER (Applied Biosystems). The presence of null alleles was tested with MICROCHECKER (van Oosterhout et al., 2004). Allelic richness, expected and observed heterozygosities and FIS values were estimated per locus and sample using the softwares GENEPOP (Rousset, 2008) and GENETIX (Belkhir et al., 2004). Departures from HWE (heterozygote excess or deficiency) were tested using GENEPOP. Genotypic linkage disequilibrium was tested using the log-likelihood ratio option in GENEPOP. Population genetic differentiation (FST) was tested using FSTAT (Goudet, 1995). Results and Discussion The presence of null alleles was indicated in 4 loci, all of which were in the SAN sample (EMLS21, EMLS26, EMLS41, EMLS45, despite the lack of missing data in EMLS26 and EMLS41). Overall, the observed number of alleles varied from two to six across loci, and mean allelic richness ranged from 2 to 5.789 (A, Tab. 2), which is rather low for a category of markers deemed to be hypervariable. Genetic diversity per locus per sample varied from 0 to 0.692. Significant genotypic linkage disequilibrium was observed in 12 out of 91 comparisons (tests were performed within each sample separately). However, after Bonferroni correction, only 3 cases remained significant, reflecting a link between EMLS10, EMLS21 and EMLS41 in AMS sample. FIS-values varied widely across loci, and among samples within loci, ranging from -0.249 (EMSL45 in CAS) to 1.000 (EMLS21 in SAN) (Tab. 2). Genetic parameters estimated per sample over all nine loci reflected strong discrepancies between samples (Tab. 3). Within laboratory cultures, the number of polymorphic loci, mean allelic richness and genetic diversity increased as follows: REN< SAN < AMS. Furthermore, genetic variability was even higher in AMS than in the two natural populations CAS and KUI, whereas lower levels were observed in REN and SAN. As a consequence, genetic diversity was not significantly lower in the group of laboratory strains relative than in the group of natural populations (allelic richness: 2.108 against 2.434, P = 0.383, expected heterozygosity: 0.290 against 0.349, p = 0.585; test based on 1000 permutations). Observed heterozygosity and Fis values indicated no departure from HardyWeinberg expectations in REN and AMS. However, a surprising significant deficit was 117 indicated at locus EMLS04 in AMS sample, in spite of very similar Ho and He values (Tab.2). Table 2. Polymorphism statistics for nine microsatellites loci in L. stagnalis. NA is the total number of alleles, A allelic richness, n number of individuals, nA number of observed alleles per locus per population, Ho observed heterozygosity, He expected heterozygosity (Nei 1978). Bolded characters indicate significant departures from HWE, asterisks the presence of null alleles. FIS FIS (W&C) (H&R) 0.419 0.649 0.150 0.396 0.633 0.000 0.413 0.507 0.444 0.455 0.045 -0.012 -0.024 0.133 0.048 -0.080 0.024 -0.040 0.039 0.172 0.277 0.202 0.184 0.167 0.046 0.400 -0.025 0.135 0.002 0.081 -0.081 -0.013 0.043 0.161 0.283 0.206 0.190 0.171 0.000 0.000* 0.065 0.000 0.000 0.000 0.189 0.064 0.000 0.000 1.000 -0.017 - 1.036 -0.035 - 3 3 3 2 4 1 1 3 2 1 0.613 0.133* 0.375 0.364 0.546 0.000 0.000 0.719 0.136 0.000 0.573 0.296 0.319 0.359 0.652 0.000 0.000 0.659 0.511 0.000 -0.070 0.554 -0.177 -0.012 0.167 -0.092 0.737 - -0.084 0.485 -0.101 -0.012 0.254 -0.024 0.768 - 32 30 32 22 22 2 2 4 3 4 0.406 0.033* 0.531 0.409 0.636 0.396 0.155 0.571 0.540 0.692 -0.025 0.788 0.071 0.247 0.083 -0.026 0.813 0.014 0.251 0.024 29 25 32 22 22 1 3 3 3 4 0.000 0.080* 0.719 0.636 0.409 0.000 0.346 0.657 0.513 0.468 0.773 -0.096 -0.248 0.129 0.846 -0.100 -0.131 0.076 Locus NA A Origin n nA Ho He EMLS04 4 3.401 EMLS05 4 2.526 REN SAN AMS CAS KUI REN SAN AMS CAS KUI 30 30 32 22 22 30 30 24 21 19 1 2 3 1 2 2 1 1 3 2 0.000 0.467 0.531 0.000 0.091 0.300 0.000 0.000 0.429 0.053 0.000 0.488 0.525 0.000 0.089 0.345 0.000 0.000 0.450 0.053 EMLS10 5 4.346 EMLS13 2 2.000 REN SAN AMS CAS KUI REN SAN AMS CAS KUI 31 30 32 21 19 32 30 32 22 21 2 3 4 3 4 1 2 2 2 2 0.452 0.633 0.156 0.381 0.526 0.000 0.300 0.406 0.364 0.381 EMLS21 2 2.000 REN SAN AMS CAS KUI 32 29 31 22 22 1 2 2 1 1 EMLS26 6 5.789 EMLS29 3 2.898 REN SAN AMS CAS KUI REN SAN AMS CAS KUI 31 30 32 22 22 32 30 32 22 22 EMLS41 4 3.779 REN SAN AMS CAS KUI EMLS45 5 4.231 REN SAN AMS CAS KUI 118 This pattern was presumably related to the occurrence of one of the three alleles in homozygous state only (2 genotypes), whereas the two others were close to expectations (see also the discrepancy between the two estimates of FIS, Tab. 2). SAN exhibited overall significant heterozygote deficiency (Tab. 3). Table 3. Genetic diversity and correlation parameters estimated per population. Hexp = Expected heterozygosity, unbiased estimate. HWE p-values: p-value of the Hardy-Weinberg test with H1 = heterozygote deficiency (HD), or with H1 = heterozygote excess (HE), significant value in bold. Origin Parameter REN SAN AMS CAS KUI 4 7 8 7 7 Mean allelic richness 1.556 2.111 2.778 2.222 2.667 Hexp mean Hexp SD 0.193 0.236 0.282 0.219 0.387 0.253 0.357 0.210 0.338 0.299 Ho mean Ho SD 0.197 0.247 0.183 0.233 0.393 0.262 0.302 0.213 0.294 0.257 FIS -0.023 0.343 -0.015 0.158 0.134 HWE p-value HD 0.621 0.000 0.191 0.033 0.023 HWE p-value HE 0.374 1.000 0.808 0.967 0.978 Number of polymorphic loci Table 2 showed that this deficiency concerned 4 loci (EMLS21, -26, -41 and -45), for which MICROCHECKER also detected null alleles. Therefore, inbreeding and / or the presence of null alleles might be responsible of the pattern observed in SAN. Since this strain originated from only 2 adults and 3 clutches (about 100 eggs each), the apparent fixation may well result from mating among relatives since the culture was set (2010, i.e., few generations back). The potential contribution of self-fertilization could not be ruled out, but further investigation is clearly needed to confirm any hypothesis. Natural populations showed overall significant heterozygote deficiency, which was due to a single locus in each case (LS29 in CAS, p<0.001; LS26 in KUI, p = 0.032). Such a pattern is not expected to result from inbreeding. With regard to the mating system, the general absence of inbreeding is consistent with the “preferential outcrosser” status of L. stagnalis (Escobar et al., 2011). Population differentiation was generally strong (mean FST-value = 0.416, 95% CI [0.344; 0.509]), as also 119 reflected by pairwise estimates, which were all highly significant (p < 0.001). Nevertheless, the UPGMA tree built from these pairwise estimates reflected closer relationships among three Dutch samples (Fig. 1). To summarize, the set of markers reported here provide new tools that should be useful for performing population genetics in L. stagnalis. Strains and populations used in this study exhibited low variation and high differentiation. This suggests that the loci may be also suited to parentage analysis, and the use of individuals from different populations may be advocated. Genetic variability was particularly reduced in two out of three laboratory cultures, as compared to natural populations. This information is relevant for experimental designs aimed at testing the influence of genetic variability on other biological performances, such as the response to environmental pressures. Inbreeding was not detected except in one culture. Overall, the observed pattern is consistent with the low dispersal ability of the species, its propensity to occupy small and isolated habitats, and its preference for outcrossing. 120 Chapitre IV - Impact évolutif des activités agricoles et anthropiques chez L. stagnalis : étude de 14 populations naturelles 121 A partir de ce chapitre, nous entrons vraiment dans la problématique évolutive de la thèse. Nous avons cherché à savoir ici, si des expositions répétées aux pesticides sur le long terme pouvaient induire des processus de divergence adaptative entre populations naturelles de L. stagnalis. Un ensemble de 14 populations naturelles ont ainsi été échantillonnées au mois de juillet 2011 dans le Nord-Ouest de l’Europe, de Bruxelles à Hambourg, en passant par Amsterdam, dans des étangs, fossés et canaux d’irrigations contrastés du point de vue de leur pression pesticide. Le niveau d’exposition de ces populations a alors été caractérisé à partir d’une estimation du pourcentage de la surface occupée par différents types de paysages, i.e., landes/forêt, pâture/friche, culture et zone urbaine/résidentielle, dans un rayon de 100m autour des sites échantillonnés. Nous avons ainsi déterminé deux niveaux d’anthropisation (AL1 < AL2) et deux niveaux d’exposition aux pesticides (PR1 < PR2), nous permettant de classer les 14 populations dans trois niveaux d’exposition anthropique (ER0 < ER1 < ER2). L’hypothèse de divergence génétique adaptative a été testée grâce à une approche QST -FST, basée sur la comparaison entre le niveau de différenciation génétique neutre estimé à partir de marqueurs neutres (indice FST ; Wright 1952) et la variation génétique estimée pour des traits quantitatifs (QST ; Spitze 1993). La diversité génétique neutre des populations a été estimée par le génotypage de 399 adultes capturés (G0) à 12 loci microsatellites. Ces individus ont été suivis au laboratoire afin d’élever leur progéniture en common garden (Fig. 8) et ainsi étudier, de l’éclosion à l’âge adulte, 11 traits d’histoire de vie (THV) relatifs à la croissance (n = 1154 individus de G1) et à la reproduction (492 individus de G1), pour lesquels la variance génétique a été estimée au sein et entre les populations (QST). Cette étude repose sur un élevage de lignées réalisé au cours du deuxième semestre 2011, et basé sur environ 15000 individus durant les trois premiers mois, 2828 individus de l’âge de 3 à 6 mois, et enfin 1680 individus marqués individuellement et suivis jusqu’à l’âge de neuf mois. Par ailleurs, 504 individus représentatifs de l’ensemble des lignées ont été exposés pendant 5h à 0 ou 222,2 µg/L de diquat pour l’étude quantitative à l’échelle transcriptomique (RNAseq, objet du prochain chapitre). Globalement, les traits d’histoire de vie étudiés ont révélé des patrons de divergence compatibles avec la sélection divergente (QST > FST ; i.e., taille à l’âge adulte, aptitude à pondre, délai d’oviposition post-isolement, nombre de pontes pendant les 15 jours de suivie de fécondité), homogénéisante (QST < FST ; taille à l’éclosion, taux de croissance, survie à 122 l’éclosion), ou avec l’hypothèse neutre (QST = FST ; fécondité totale, taille des pontes). Bien que les cas de sélection divergente constatés semblent principalement influencés par les différents types d'habitat et le degré d’isolement génétique des populations, nos résultats suggèrent qu’une fécondité accrue ait été sélectionnée en réponse à la survie précoce réduite chez les populations soumises aux pressions anthropiques. En outre, d’après nos résultats, le niveau de consanguinité des populations apparaît négativement corrélé avec la fécondité et le taux d'éclosion, ce qui suggère l’existence d’une dépression de consanguinité plus forte que précédemment estimée chez L. stagnalis. La grande divergence phénotypique et génétique observée entre populations confirme la pertinence de prendre en considération la diversité génétique des populations ainsi que l’impact évolutif potentiel des polluants dans les procédures d'évaluation du risque écologique. Cette étude sera valorisée sous la forme d’un article en préparation (présenté ciaprès) à soumettre à la revue Evolutionary Applications. Figure 8. Photos du dispositif d’élevage des lignées G1 123 Article 3 - Do pesticides influence evolutionary processes in natural populations of non-target species? A study in the freshwater snail, Lymnaea stagnalis Anthony Bouétard, Anne-Laure Besnard, Marc Collinet and Marie-Agnès Coutellec INRA, UMR 0985 ESE, Ecotoxicology and Quality of Aquatic Environments, 65 rue de Saint-Brieuc, CS84215, 35042 Rennes Cedex, France E-mail contact: [email protected] (To be submitted in Evolutionary Applications) Keywords: Historical pesticide exposure, Life history traits, Population genetic variation, Evolutionary impact, Qst-Fst comparison, Inbreeding depression, Great pond snail. 124 Abstract Pollutants present in the environment may affect the evolution of natural populations in several ways. Fitness reduction can result from direct effects on the germ-line (mutagenic compounds), or it may be the consequence of a negative impact on genetic diversity, through directional selection (when the population becomes locally adapted) or through amplification of random genetic drift (when local demography and dispersal patterns are impaired). Pollutants may thus affect the evolution of genes under selection as well as neutral regions of the genome. The issue of evolutionary impact is therefore conceptually important for ecotoxicologists and also for ecological risk assessment and management of chemicals. With respect to human-induced pollutions, some conditions are expected to increase the risk of genetic change in natural populations. Among such conditions, freshwater lentic habitats located within agricultural landscapes are likely to be exposed to recurrent contamination by pesticides, through various modes of transfer from treated fields. Non-target species in these habitats are thus exposed to a high risk of evolutionary impact, especially when they have low dispersal ability (e.g., when the whole life cycle is aquatic) or opportunity (weak connectivity between aquatic ecosystems, e.g., marshes or ditches). In such a context, the effects of historical exposure to pesticides on population genetics patterns have been investigated in the freshwater gastropod Lymnaea stagnalis. A set of 14 populations was sampled from contrasted types of landscape in North-Western Europe, expected to differ in terms of pesticide pressure, i.e., sites within areas of intensive agricultural activity and sites distant from such areas. Neutral genetic diversity was estimated among 12 microsatellites loci and additive genetic variances were assessed among 11 lifehistory traits related to growth and fecundity, from early stage to adulthood. A QST-FST approach was used to identify the different selection patterns. Although divergent selection patterns among populations were found to be mainly influenced by the types of habitat and their respective gene flow potentials, our results suggest that pesticide pressure may induce evolutionary processes enhancing the ability of snails to reproduce in order to overcome reduced hatching success. Furthermore, inbreeding was shown to be negatively correlated with the fecundity and hatching success, suggesting that inbreeding depression in L. stagnalis might be stronger than previously estimated. Anyway, the high genetic and phenotypic differences observed within and among populations in this study, confirm the relevance of 125 taking into account population genetics and trans-generational endpoints for ecological risk assessment. 126 Introduction Understanding the causes of population divergence is a central goal in evolutionary biology. This is also becoming a question of importance in environmental sciences, since the consideration of evolutionary principles is relevant to improve the management of populations and biological resources (Hendry et al., 2011). Basically, population genetic divergence may result from both directed and random processes, and from the balance thereof. Rapid adaptive responses have been demonstrated under particular situations, such as heterogeneous environment with a metapopulation structure or colonization of new habitats (Reznick and Ghalambor, 2001). Human activities may lead to such situations, e.g., through habitat fragmentation or degradation, due to physical, chemical and biological stressors. Moreover, the natural rate of evolution can itself be modified by human activities (Hendry et al., 2008). Among them, pollutants represent a source of environmental stress which may have the capacity to reduce population fitness and genetic variability, through microevolutionary processes that may involve both random genetic drift and local adaptation (Medina et al., 2007). Pollutants may also have effects that are passed on to subsequent generations without being genetically inherited, yet with some influence on offspring phenotype (Bonduriansky and Day, 2009). A substantial loss of biodiversity has been shown to be associated with the intensification of arable agriculture over the last 5 decades (Memmott, 2009). Agriculture, combined with industrial and domestic activities, uses more than one-third of the Earth’s accessible renewable freshwater (i.e., approximately 4,430 km3 / year in 2006), and this intensive consumption is often leading to water contamination (Schwarzenbach et al., 2010). About 140 million tons of fertilizers and several million tons of pesticides are applied each year (Schwarzenbach et al., 2006). Natural populations are thus exposed to a variety of spatially and temporarily variable pressures. For these reasons, the evolutionary impact is becoming a new challenge for ecological risk assessment of chemicals (Breitholtz et al., 2006; Bickham, 2011; Coutellec and Barata, 2011). A number of studies have reported cases of evolved tolerance to metals (Reznick and Ghalambor, 2001; Morgan et al., 2007; Bourret et al., 2008) or pesticides (Brausch and Smith, 2009; Coors et al., 2009) in natural populations chronically exposed to industrial or agro-chemical pollutants. 127 These responses may be correlated with a loss of genetic diversity, which may further impair population adaptive potential to future environmental change (van Straalen and Timmermans, 2002). Also, pesticide resistance may imply costs, as demonstrated for example, in terms of survival under high density in gray treefrog tadpoles tolerant to the insecticide carbaryl (Semlitsch et al., 2000), seed production in glyphosate-tolerant genotypes of the weed Ipomoea purpurea (Baucom and Mauricio, 2004), or pupal mass and development time in pesticide-resistant populations of Choristoneura rosaceana (Carriere et al., 1994). However, the evolution of costly resistance or tolerance is empirically not as supported as expected. Indeed, several studies have opposed results, i.e., cross-resistance or cross-tolerance, such as fairy shrimp populations inhabiting agricultural watersheds showing higher significant tolerance to Methyl Parathion® 4ec, Tempo® SC Ultra, Karmex® DF and DDT than populations from playas surrounded grasslands (Brausch and Smith, 2009). One method now commonly used to test for local adaptation and subsequent divergence among populations, is the QST-FST approach (Spitze, 1993), which compares the genetic variance distribution of phenotypic traits (used as fitness components) to the population genetic structure inferred from neutral marker loci. A quantitative trait is considered to be exposed to random genetic drift only, when both genetic indices overlap in their distribution (FST = QST). In other words, selection processes are not required to explain the observed pattern of population divergence for that trait. Under this model, significant departure from the null hypothesis may take two forms: FST > QST is indicative of homogeneous selection, i.e., towards a unique optimum across populations, while FST < QST reflects divergent selection, and the occurrence of different fitness optima between populations, i.e., local adaptation (Spitze, 1993; O'Hara and Merila, 2005; Whitlock, 2008; Lamy et al., 2012). The approach most often relies on phenotypic measurements made on the laboratoryborn progeny of wild-caught individuals (G1, isofemale lines). Although fitness should be estimated in the real local environment of populations, fitness estimates remain challenging to perform in the field, and suffer from inaccuracy, so to circumvent this difficulty, the fitness performances of individual genotypes or lines are usually measured from life history traits (used as fitness proxies or components) under common environmental conditions (common garden, i.e., controlled conditions identical to all populations). The use of G1 individuals allows limiting the bias in additive genetic variance estimation, that is due to non-additive 128 genetic effects (O'Hara and Merila, 2005), and to direct environmental effects, although more generations would be required to safely eliminate maternal effects and other transgenerational effects. The use of a common environment allows to assume that populations are compared under standard conditions, which supports the idea of an “objective” comparison, although imposed conditions may not be equally similar to (or distant from) local conditions across the studied populations, especially if local adaptation effectively occurs. However, this method has been applied in a number of studies, which provide important documentation on selection patterns (Saint-Laurent et al., 2003; Evanno et al., 2006; Chapuis et al., 2007; Johansson et al., 2007; Eroukhmanoff et al., 2009; Hangartner et al., 2012), and allow evaluating its merits (see meta-analyses; Leinonen et al., 2008; Lamy et al., 2012). With regard to anthropogenic pressure, the QST-FST approach appears promising for the long-term assessment of ecotoxicological effects (Klerks et al., 2011), however, it has still never been applied in this field except a case study of adaptation to metal contamination in Thlaspi caerulescens (Jimenez-Ambriz et al., 2007). With respect to human-induced pollutions, some conditions are expected to increase the risk of genetic change in natural populations. Among such conditions, freshwater lentic habitats located within agricultural landscapes are likely to be exposed to recurrent contamination by pesticides, through various modes of transfer from treated fields, including aerial drift, run-off, and drainage (Brown and van Beinum, 2009). Such changes in environmental conditions can rapidly shift allele frequencies in populations of species having relatively short generation times (Hoffmann and Willi, 2008). Also, freshwater organisms occupying these habitats are exposed to a high risk of evolutionary impact, especially when they have low dispersal ability (entirely aquatic life cycle, e.g., molluscs, crustaceans) or opportunity (weak connectivity among occupied sites, e.g., ponds or ditches) (Coutellec et al., 2011). As non-target organisms, these species are also expected to be good models to test non-intentional evolutionary effects of pesticide exposure. In particular, freshwater snails belong to an ecologically important group, due to their major role in the transfer of energy and material across food webs, and because they can represent up to 20-60% of the total abundance and biomass of macroinvertebrates in some freshwater ecosystems (Habdija et al., 1995). Among them, the pulmonate gastropod Lymnaea stagnalis is a representative species 129 of freshwater lentic environments and of the herbivorous aquatic macroinvertebrate community. In the present study, we tested the hypothesis that pesticide chronic pressure may act as a selective force and lead to adaptive divergence among a set of 14 natural L. stagnalis populations, using the QST-FST methodology. Pesticides were considered as a whole, as contributing to a global, potentially toxic, pressure on non-target organisms (with three levels: low, medium, and high). Thus, under this hypothesis, directional selection involving mechanisms of response to a given pesticide are not specifically focused (searched for), although they obviously contribute to the fitness of populations and genotypes. Rather, we hypothesize that global chronic exposure to various cocktails of pesticides may drive populations to an optimum in terms of ability to respond to temporary but recurrent stressful conditions (including indirect effects at the community level). The study aimed at addressing the following questions: (i) is agricultural pressure able, through pesticide chronic exposure, to trigger adaptive processes in non-target organisms? (ii) what is the relative strength of this pressure type, compared to other environmental components, including natural and other anthropogenic factors? Indeed, as in any field study, because populations classified in a given level of pesticide pressure are not replicates of each other in terms of ecology and evolution, any other relevant environmental factor should be also accounted for. Under this rationale, we characterized populations in terms of “other anthropogenic pressure” (roads, urbanized zones), “global pressure” (a combination of agricultural and non agricultural anthropogenic pressures), and “aquatic system” (pond, ditch, channel, as physical features expected to affect population genetic isolation). 130 Materials and methods Population sampling and characterization Adult snails were collected from 14 natural populations during the reproductive period, in a single campaign (5-12 July 2011) (Fig. 1). Locality information and sampling characteristics are summarized in Table 1. 6 5 7 9 8 4 2 Amsterdam 12 11 10 13 Hamburg 3 14 Brussel 1 Figure 1. Location of the 14 populations studied. The number each population is indicated and the 3 different colours corresponds to the 3 environmental categories (white, grey and black for ER0, ER1 and ER2, respectively). See Table 1 for details. Pesticide and other anthropogenic pressures were estimated from land-use patterns observed in the immediate surroundings of sampled sites. In the present study, we were not interested in an instant environmental concentration of pesticides at the time of sampling. On the contrary, under the tested hypothesis (population adaptive divergence caused by pesticide pressure), we assume that historical (repeated or chronic) contamination is more relevant as a potential selective force driving phenotypic evolution in the studied populations. However, it is very difficult to assess pesticide contamination over a timescale relevant to ecoevolutionary issues, since (1) it would require accurate and long-term monitoring at a local scale, (2) most importantly, chemical analyses are inherently limited to a pre-selected set of molecules to be analysed/dosed (e.g., compounds and their metabolites expected to be present, given some observed agricultural practices or other local environnemental pressures). Thus, even a strong technical effort on monitoring would not prevent from the possibility that the molecule(s) effectively responsible for the observed pattern is (are) would be ignored. Our strategy built on the use of geographic landscape information and agricultural land-use data. These have proved to be relevant tools to predict the likelihood of water bodies 131 contamination by pesticides (Brown et al., 2007) and for ecological risk assessment of pesticides in the field (ditches: De Zwart, 2005; ponds: Coors et al., 2009; Orsini et al., 2012). Moreover, in such aquatic systems, most variation may be explained by close land-use patterns (within a 100 m radius area centred on the sampling site), as demonstrated for water quality and vegetation complexity by Declerck et al. (2006). Consistently, we characterized the environment of each studied population on the following basis: percent coverage by forest or moorland, pasture, crop (including potatoes, corn, orchards, bulb plants), and urban zone (Tab. 1). By crossing observations in the field and satellite views from Google Earth with informations obtained from farmers on their practices, we estimated coverage proportions, using the software ImageJ (http://rsbweb.nih.gov/ij/). 132 Table 1. Geographical and ecological characteristics of the sites of origin of the 14 investigated Lymnaea stagnalis populations and presentation of their respective genetic diversity indices. The classification of populations in two levels of anthropogenic pressure (AL1 < AL2), two levels of pesticide risk (PR1 < PR2) and three levels of environmental risk (ER0 < ER1 < ER2) was based on the percentage of land use categories within a radius of 100 m around the sampled sites. n indicates the number genotyped individuals, N is the number of alleles, AR is allelic richness (based on samples of 12 individuals), HE is the unbiased expected heterozygosity, HO is the observed heterozygosity, and FIS is the inbreeding coefficient (significance is indicated by asterisk). Ne is the effective population size and estimates of self-fertilization rates are also presented. St atist ical f acto rs L o calizati o n G eo g rap hi c coo rd o n ates L and u se R eg io n clu st er H ab itat G en eti c di ver sity in d ices L evel o f A n th ro p izati on P esti cid e En v ir on m en tal L evel R isk R i sk n N AR HE HO FI S S elf in g r ate (R M E S) N e [C I 9 5 % ] 5 .Ca s. C astri cu m ( A lk m aar, N L) 5 2 °3 3 .17 N , 4 °3 7 .22 E 1 00 % m o or W Po n d A L1 P R1 ER 0 32 3 .3 2 .6 0 0 .3 4 1 0 .23 1 0 .3 27 * 0 31 [1 9 ; 5 8 ] 9 .Ku i . K u in re (N o o rd o os tp o ld er, N L) 5 2 °4 7 .67 N , 5 °4 7 .69 E 9 8% fo r es t, 2 % u rb an W D itch A L1 P R1 ER 0 25 3 .8 3 .3 3 0 .4 2 8 0 .34 1 0 .2 07 * 0 25 [1 4 ; 5 2 ] 1 3 .H ed . H eden d o rf (H am b u rg , D ) 5 3 °2 9 .47 N , 9 °3 6 .55 E 9 0% fo r es t, 1 0% u rb an E Po n d A L1 P R1 ER 0 26 2 .8 2 .3 9 0 .3 1 5 0 .23 5 0 .2 58 * 0 32 [1 8 ; 6 6 ] 1 .O u d . O ud -H ev erlee (B ru x elles, B ) 5 0 °4 9 .39 N , 4 °3 9 .29 E 5 5% fo r es t, 4 5% u rb an W Po n d A L1 P R1 ER 0 13 3 .3 3 .2 8 0 .4 1 6 0 .34 5 0 .17 7 40 .6 * 26 [1 3 ; 6 6 ] 7 .S ch . S ch o or ld am ( A lk m aar, N L) 5 2 °4 3 .13 N , 4 °4 2 .2 E 9 5% p astu r e, 5 % u rb an W C h an nel A L2 P R1 ER 1 26 3 .3 2 .8 9 0 .3 2 4 0 .25 2 0 .2 25 * 1 8 .5 24 [1 3 ; 4 7 ] 1 4 .D et. D etselb erg en (G en t, B) 5 1 °0 3 .29 N , 3 °4 9 .35 E 3 0% fo r es t, 3 0% fall o w , 4 0 % u rb an W Po n d A L2 P R1 ER 1 14 2 .5 2 .4 5 0 .3 2 5 0 .21 3 0 .3 53 * 48 .5 * 33 [1 6 ; 1 3 9] 1 0 .Bu x. B u xt ehu d e (H am b u rg , D ) 5 3 °2 9 .63 N , 9 °4 2 .78 E 8 0% fal lo w , 1 5 % cro p, 5 % u rb an E C h an nel A L2 P R1 ER 1 27 3 .2 2 .8 4 0 .3 9 1 0 .35 5 0 .09 4 0 22 [1 2 ; 4 3 ] 4 .B aa . B aarn (U tr echt , N L) 5 2 °1 3 .38 N , 5 °1 8 .53 E 2 5% p astu r e, 2 5 % cro p, 5 0 % u rb an W D itch A L2 P R2 ER 2 22 3 .9 3 .5 4 0 .4 4 8 0 .31 2 0 .3 08 * 12 33 [1 8 ; 7 2 ] 2 .O o s. O ost ein d (B r ed a, N L ) 5 1 °3 8 .87 N , 4 °5 5 .82 E 3 0% p astu r e, 4 0 % cro p, 3 0 % u rb an W C h an nel A L2 P R2 ER 2 32 4 .8 4 .1 8 0 .5 9 0 0 .48 8 0 .1 75 * 0 198 [1 0 5 ; 6 9 8] 3 .B ie. B iezen mo rt el (B red a, N L) 5 1 °3 8 .03 N , 5 °9 .53 E 2 0% fo r es t, 5 % p as tu re, 7 5% cro p W C h an nel A L2 P R2 ER 2 30 4 .4 3 .6 7 0 .4 5 2 0 .37 7 0 .1 68 * 9 .1 109 [6 4 ; 2 5 9] 6 .P ut . P u tt en ( A lk m aar , N L) 5 2 °4 5 .81 N , 4 °3 9 .82 E 3 0% cro p , 7 0% u rb an W D itch AL 2 P R2 ER 2 32 2 .9 2 .6 2 0 .3 7 0 0 .29 1 0 .2 16 * 1 8 .6 37 [2 2 ; 6 7 ] 8 .E m m . E m m elo o rd ( N o or d oo st po l der , N L) 5 2 °4 6 .27 N , 5 °4 8 .26 E 8 0% cro p , 2 0% u rb an W D itch AL 2 P R2 ER 2 24 3 .7 3 .3 2 0 .4 5 6 0 .34 3 0 .2 52 * 0 36 [2 0 ; 8 0 ] 1 1 .Ko e. K o en i gsr eich (H am b ur g, D ) 5 3 °3 1 .6 N , 9 °4 6 .29 E 8 5% cro p , 1 5% u rb an E C h an nel AL 2 P R2 ER 2 27 5 .3 4 .1 7 0 .4 4 4 0 .36 7 0 .1 76 * 9 .5 48 [2 9 ; 9 1 ] 1 2 .Ag a . A gat hen b u rg ( H am bu rg , D ) 5 3 °3 4 .54 N , 9 °3 2 .82 E 1 00 % cro p E D itch AL 2 P R2 ER 2 25 4 .3 3 .6 9 0 .4 9 1 0 .36 3 0 .2 66 * 30 .7 * 29 [1 7 ; 5 3 ] 133 When available, official data on pesticide detection and quantification in surface water near the sampled sites were found to be globally consistent with our classification (http://81.93.58.66/bma_nieuw/begin.html; http://www.milieurapport.be/). Finally, besides geographical location, populations were classified according to four environmental criteria: aquatic system (pond, channel, ditch), pesticide pressure (two levels, low vs high), other anthropogenic pressure (two levels, low vs high), global environmental pressure (three levels, as a combination of pesticide and other anthropogenic pressures). Molecular analyses DNA was chelex extracted from haemolymph or foot tissue from 399 wild-caught adults (14 to 33 snails per population). Neutral genetic variation was described at 12 microsatellite loci, i.e., A2, A112, B117 (Knott et al., 2003), 2k11 and 2k27 (Kopp and Wolf, 2007), and EMLS04, EMLS13, EMLS21, EMLS26, EMLS29, EMLS41, EMLS45, following the protocol described in Besnard et al. (2013). Only individuals with less than three missing genotypes were retained for analysis. Population neutral genetic structure Mean allele number (N), allelic richness (AR), expected heterozygosity HE (Nei, 1978), and observed heterozygosity HO, were calculated with GENETIX 4.05.2 (Belkhir et al., 2004). The distribution of neutral genetic diversity within and among populations was estimated from Weir and Cockerham’s estimators of Wright’s F indices (Weir and Cockerham, 1984) using FSTAT 2.9.3.2 (Goudet, 2001). Departures from HWE (heterozygote excess or deficiency), and linkage disequilibria were tested using GENEPOP version 4.0.10 (Raymond and Rousset, 1995). The selfing rate was estimated per population with RMES (David et al., 2007). Effective population size was estimated using the sibship assignment method, as implemented in the software COLONY 2.0.3.0 (Jones and Wang, 2010) and, assuming inbreeding, male and female polygamic mating systems, and monoecy. The genotypic dataset was not checked for the presence of null alleles (e.g., using MicroChecker; van Oosterhout et al. 2004), since the method requires HWE (see David et al., 2007), a condition that was clearly not met in the studied populations (see results section). Global and pairwise FST-values were computed with FSTAT 2.9.3.2, according to Weir and 134 Cockerham (1984) and the Neighnoor-joining tree was realised with MEGA 5 (Tamura et al., 2011). To estimate the number of genetic clusters in our dataset without taking into account any predefined population, we used STRUCTURE 2.2 (Pritchard et al., 2000). Analyses were performed assuming an admixture model and a number of genetic clusters (k) from 1 to 16 (15 replicates for each k). Each run started with a burn-in period of 50 000 steps followed by 300 000 Markov Chain Monte Carlo (MCMC) replicates. The most likely number of clusters was determined using the ∆k statistic (Evanno et al., 2005) using STRUCTURE HARVESTER (Earl and von Holdt, 2012). We used DISTRUCT to plot Structure output data (Rosenberg, 2004). Common garden experiment Wild-caught adults were brought to the laboratory and reared under standard conditions at the INRA experimental unit U3E (Rennes, France), as previously described (Coutellec and Caquet, 2011). Snails were isolated in plastic vessels filled with 1 L dechlorinated charcoal filtered tapwater. They were fed weekly with 1.5 g of organic salad, at each water renewal. Room temperature was maintained at 20 ± 1°C and the photoperiod was 16L/8D. For a given snail, reproduction was followed during 14 days after the first clutch laid in the laboratory. A total of 228 snails had reproduced after 3 months (15 July – 15 October, 2011). The genetic component of phenotypic variation within and among populations was characterized for various life-history traits (individual growth, reproduction, hatching success) on the laboratory-born progeny (G1) as illustrated in Figure 2. G1 snails were reared at 20 ± 1°C, under a 14L/10D photoperiod. Juvenile growth From hatching to the age of 56 days, 20 individuals per clutch were reared as groups (n = 427 families, i.e. on average two clutches per parent). Individual size (maximum shell length) was measured every two weeks on four randomly chosen juveniles per group, using a stereomicroscope fitted with an ocular micrometer. Hence, for this period, shell size data were mean values per group. At the age of 63 days, all snails were measured, and 14 snails per group were randomly chosen and transferred to 1L plastic vessels in which they were reared until the age of 119 days (roughly corresponding to the end of juvenile growth). 135 SSR analyses (12 loci) 14 natural populations sampled (from contrasted local conditions) Population 1 Population 14 … Oviposition Estimation of neutral genetic diversity Laboratory G1 d0 d14 d28 d42 d56 Mean size (4 individuals on 20 snails / family) d63 d98 d119 Mean size (14 individuals / family) Tank n° 1 Tank n°14 … Measure of quantitative traits Marking and transfer in tank Survey of individual growth Estimation of (84 individuals x additive genetic 14 populations) variance => QST 144 families reared from hatching to adult stage => 1176 snails d2 d2 d1 78 7 individuals x 12 families / tank d1 92 15 da ys f ec un 06 dit 27 Growth modelized with Gomperzt m odel y => 492 snails (3 inds / family) • Number of clutches and eggs • Oviposition time • Ability to lay eggs • Hatching rate September to December 2011 January 2012 Febuary - M arch 2012 => F ST July to August 2011 Field G0 Figure 2. Schematic overview of the common garden experiment (See text for details) Individual size was estimated from maximum shell length after 98 days (373 families) and 119 days (207 families), as measured to the nearest 0.1 mm using a digital calliper. Water was renewed and snails were fed with organic salad every week. Vessels were moved at random to limit spatial effect within the rearing room. The water volume was increased with snail age (75 ml from hatching day -d0- to d63, 750 ml from d63 to d119), as was the weekly amount of organic salad per group (0.5 g from hatching day -d0- to d42, 1 g from d42 to d63, 3 g from d63 to d98, 6 g from d98 to d119). At the age of 119 days, 7 snails from each of the 144 sibships of similar age (i.e., 165 clutches laid between 16 July and 17 August, 2011), were randomly chosen and marked individually with a plastic mark for queen honeybees (model FC075; diameter: 2.3 mm, weight: 1.8 mg; Ickowicz Apiculture, Bollene, France), as described in Coutellec et al. 136 (2011). Marking has been shown not to affect life-history traits in basommatophorans (Henry and Jarne, 2007). A total of 1176 snails were marked, which represented 4 to 12 different maternal families per population. They were transferred to 30 L tanks in which they were fed twice a week with organic salad (0.5 g per snail), and 2/3 of water was renewed weekly. Four supplementary individual sizes were measured at the age of 177.71 days (SD ± 5.41), 191.71 days (SD ± 5.41), 205.7 days (SD ± 5.4) and 226.51 days (SD ± 5.56), to obtain 12 size measurements for a total of 1154 snails for which growths were modelled using the Gompertz’s model. Mean age values reflect the fact that all families were not exactly of the same age (as using only clutches laid on the same date would have considerably reduced the number of usable families). The growth curve is given by the equation: Lt = Ae − be ( −kt) where Lt is the shell length at time t, A is the asymptotic shell length, b is a scaling factor related to the shell length at t = 0, and k reflects the growth rate. Reproduction Once the first clutches started to be observed in aquaria (20 February 2011), three G1 individuals per family (492 snails in total) were isolated in 200 mL plastic vessels to follow reproduction during two weeks. Snails were fed weekly with 1 g of organic salad immediately after water renewal. Several traits were measured: time to first oviposition (egglaying) under isolation (with a censoring limit of 30 days), ability to lay eggs (as the proportion of reproductive snails per family), number of clutches laid, clutch size, and hatching rate. Statistical analyses All traits were analyzed with generalized linear mixed effect models (GLMM, Rpackage lme4) (Pinheiro and Bates, 2002), with appropriate error distribution (Gaussian for normal data, Poisson for count data, and Binomial for proportions). Due to the difficulty to find L. stagnalis in some specific habitats (e.g., contaminated ponds), the study design did not allow crossing or nesting all factors, and we tested their potential effects using additively hypotheses. When necessary, data were log-transformed or BoxCox transformed, and covariates were included in the model. The model structure was: 137 Y ~ factor1 + factor2 + factor 3 + covariate1 + covariate2+...+ (1|population/family) Fixed effects were tested by model simplification and comparison using a log-likelihood ratio test. Fixed factors were: genetic cluster (see STRUCTURE analysis), aquatic system and pesticide pressure, other anthropogenic pressure or global pressure. Family was nested within population, and both were treated as random factors. Depending on the trait, different covariates were also tested, including 15 days fecundity, 15 days growth, age, parental size, clutch size or minimum development time of clutches of wild-caught adults (Tab. S5). All statistical analyses were performed using R version 2.14.0 (The R Foundation for Statistical Computing). QST -FST analysis Observed values of QST - FST were compared with the QST - FST distribution expected under the neutral hypothesis, and calculated on the basis of the mean FST value and variance components (Weir and Cockerham, 1984; Whitlock and Guillaume, 2009). Values were considered as significantly different when their 95% confidence intervals did not overlap. Within- and between-population variance components were estimated for each of the 11 traits using restricted maximum likelihood (REML) methods under a simplified mixed model, i.e. Y~1+ (pop / fam). After sampling, G0 snails were isolated once arrived in the laboratory. Regarding their preferential outcrossing mode of reproduction (Knott et al., 2003; Puurtinen et al., 2007; Coutellec and Caquet, 2011), they were supposed to have stored sperm from previous mating in the field. So, progeny from G0 snails were more likely to be half-sibs than full-sibs. However, as we were not able to certify the mating mode, both possibilities were explored for QST estimations (see also Evanno et al., 2006). QST was computed using the equation (Spitze, 1993; O'Hara and Merila, 2005): QST trait = Vb (V b + 2V w ) where Vb is the between population genetic variance and Vw the within population genetic variance. Vb was obtained directly from the estimated variance component for the population effect and the within population variance (Vw) was estimated using the among family variance component (Vf) multiplied by 2 in the case of full-sib design or by 4 in the case of half-sib design (Lynch and Walsh, 1998). 138 Results Within-population genetic diversity On 399 individual genotypes, 44 were discarded because of missing or unreadable data at more than 4 loci. Overall, the observed number of alleles per locus varied from three to 29, mean allelic richness ranged from 1.1 to 9.6 (AR based on samples of 12 individuals; see Tab. S1), and genetic diversity per locus per sample varied from 0 to 0.86. Significant genotypic linkage disequilibrium was observed in 40 out of 656 comparisons (tests were performed within each sample separately). However, after Bonferroni correction, no case remained significant. FIS-values varied widely across loci, and among samples within loci, ranging from -0.238 (EMSL41 in Bux.) to 1.000 (2k27 and B117 in Det; EMLS13 in Hed.; EMLS21 in Baa.) (Tab. S1). Genetic parameters estimated per sample over all 12 loci reflected discrepancies between populations (Tab. 1). To the exception of Bux. and Oud., in which observed heterozygosities (0.355 and 0.345, respectively) and FIS-values (0.094 and 0.177, respectively) indicated no departure from Hardy-Weinberg equilibrium, other populations were found significantly inbred, as shown by FIS-values. A significant effect on FIS-value was found for habitat (AMOVA, p = 0.016; KruskalWallis test, p = 0.030), suggesting lower inbreeding in channels (mean FIS = 0.168 SD ± 0.05) as compared to ditches and ponds (mean FIS = 0.25 SD ± 0.04 and 0.279 SD ± 0.08, respectively). However, post-hoc p-values were not significant (Tukey, α = 0.05). Inbreeding appeared also negatively correlated with some fitness-related traits, i.e., fecundity measured during 15 days (ρ = - 0.798, p = 0.001, linear regression: r² = 0.710, d.f. = 12, p < 0.001, see Fig. 3), ability to reproduce (ρ = - 0.591, p < 0.05) and clutch hatching rate (ρ = 0.587, p < 0.05). The rate of self-fertilization was found significantly different from zero in three populations (Oud.: 40.6%, Det.: 48.5%, and Aga.: 30.7%). The effective population sizes, Ne, estimated with COLONY, were significantly higher in the most exposed populations (Kruskal-Wallis test: PR2 > PR1, p = 0.010), mostly because of high values in two channel populations (Oos.: 198 and Bie.:109). 139 140 120 100 80 60 Fecundity (eggs / 15 days) 0.10 0.15 0.20 0.25 0.30 0.35 FIS Figure 3. Correlation plot between population inbreeding and 15 days fecundity. Bayesian clustering and neutral divergence among populations Using STRUCTURE, the highest likelihood was obtained for k = 2 clusters, and the differentiation of individual genotypes into 2 clusters was also confirmed by the presence of a single peak with the ∆k statistic (Evanno et al., 2005) (Fig. 4A). The two clusters inferred corresponded to populations from two geographic regions: western (n = 10) and eastern populations (n = 4). For these reasons, a two geographical levels factor was implemented in the statistical analyses of life-history traits (see factor “genetic cluster”, as mentioned above). Population differentiation was generally high (mean FST-value = 0.282, 95% CI [0.24; 0.326]), as also reflected by pairwise estimates, which were all significant (p < 0.01) (Tab. S2), except between the two geographically close populations Kui. and Emm. (East of The Netherlands). The Neighbour-joining tree built from these pairwise estimates reflected closer relationships within the two regions characterised with STRUCTURE (Fig. 4B). Nevertheless, on the basis of the tree representation, the two populations Cas. and Det. from ponds sampled in the western part of Netherlands and Belgium, respectively, were particularly differentiated. More generally, the four pond populations (Cas., Det., Oud. and Hed.) had longer branches, indicating stronger differentiation among populations in each cluster. 140 A. et. ud. os. D . O O 14 1. 2. ie. 3.B a 4.B a. 5.C . as 6.P ut. . . . . . . i. ed oe ux ga ch m m . Ku B K A H . S . . . E . 9 7 10 8. 11 12 13 7.Sch. B. 4.Baa. 5.Cas. 11.Koe. 6.Put. 12.Aga. 0.05 3.Bie. 10.Bux. 2.Oos. 8.Emm. 13.Hed. 9.Kui. 14.Det. 1.Oud. Figure 4. Genetic differentiation among the 14 studied populations. (A) Bayesian individual clustering results with STRUCTURE for k = 2. Coloured bars represent proportions of membership of each individual to each cluster. (B) Unrooted Neighbour-Joining tree based on Weir and Cockerham genetic distances among the 14 populations (see Table S2). Statistical analyses and QST-FST comparisons Congruent selection patterns were obtained between the two sib designs tested (fullvs half-sib), especially for traits related to fecundity. However, as we do not have exact information concerning mating in the field, and as estimates of intra- and inter-populations variance components did not take into account such mating in the model, only results under the full-sib design are presented (Tab. 2). 141 Table 2. Results of the QST-FST comparison for 11 traits studied under a full-sib design. number of G1 snails number of families Vbetween pop Hatching size 427 211 1.46E-03 * Size at 119 days 2855 182 7.09E+00 *** 3.17E+00 Asymptotic size (A) 1154 144 Growth parameter related to initial size (b) 1154 Parameter related to growth rate (k) Expected 95% CI for Q ST-F ST under neutrality p.val left p.val right Observed Q ST - F ST Selection pattern 0.078 0.922 -0.118 Neutrality [ -0.146 ; 0.148 ] 0.998 0.002 *** 0.246 Divergent selection 6.81E-03 *** 4.66E-03 *** [ -0.149 ; 0.166 ] 0.957 0.043 0.140 Neutrality 144 1.06E-03 2.82E-03 *** [ -0.159 ; 0.152 ] 0.062 0.938 -0.124 Neutrality 1154 144 1.25E-07 ** 3.94E-07 *** [ -0.152 ; 0.157 ] 0.026 . 0.974 -0.145 Neutrality Ability to lay eggs 492 144 2.70E+00 ** 9.52E-11 1 0 *** 0.718 Divergent selection Time to oviposition 492 144 2.86E-02 *** 1.67E-02 *** [ -0.147 ; 0.141 ] 0.988 0.012 ** 0.179 Divergent selection 15 days fecundity 492 144 8.22E+02 ** 1.13E+03 *** [ -0.151 ; 0.152 ] 0.481 0.519 -0.015 Neutrality Number of clutches laid during 15 days 492 144 1.10E-01 *** 3.09E-14 1 0 *** 0.718 Divergent selection Number of eggs per clutch 1537 144 2.95E+00 ** 2.94E+00 *** [ -0.149 ; 0.162 ] 0.231 0.769 0.052 Neutrality Hatching rate 1537 144 3.27E-01 ** 1.26E+00 *** [ -0.153 ; 0.159 ] 0.02 ** 0.98 -0.167 Homogenizing selection Traits V within pop 3.73E-03 *** [ -0.155 ; 0.165 ] Significance levels : .P < 0.1, *P < 0.05, **P < 0.01, ***P < 0.001 142 . [ -0.161 ; 0.153 ] [ -0.146 ; 0.167 ] . Concerning traits related to growth, only size at 119 days was found to be under divergent selection. Differences were highly significant between populations but none of the fixed factors tested were explicative (GLMM analyses). Based on the full dataset (1154 individuals), the analysis indicated that the pattern of genetic differentiation in parameters of the Gompertz model was due to genetic drift only (QST = FST). However, a trend towards divergent selection was observed for the asymptotic size (A, observed QST-FST = 0.140, CI = [-0.149 ; 0.166] under neutrality). This relation became highly significant when considering only the subset of 492 snails used for fecundity traits (results not shown). Whatever the dataset, habitat was the main factor explaining variation in this parameter. Post-hoc tests indicated significantly greater asymptotic sizes (p < 0.001) for snails inhabiting ponds (34.78 mm SE ± 0.25) as compared to those from channels (31.05 mm SE ± 0.14) and ditches (30.79 mm SE ± 0.19) (Fig. 5, Tab. S3). Figure 5. Individual growth (G1 snails) according to habitat of origin. Gompertz growth curves were based on 12 dates of measurement, performed on 1154 individuals. The two other Gompertz parameters, i.e., b and k, although showing non significant departure from the neutral hypothesis with the full dataset, tended to be selected towards a same optimum (homogenizing selection, especially for k), as reflected by negative values for observed QST-FST difference, close to the lower bound CI under neutrality. Variation in growth rate (k) seemed to be mainly explained by population and family (no effect found for any fixed factor) whereas the parameter relative to the initial size (b) appeared partly influenced by geography (as reflected by “genetic cluster” factor), habitat, and anthropization level, whatever the dataset (Tab. S4). The corresponding trait, hatching length (i.e., body size at hatching), also showed a similar neutral pattern with a weak trend towards homogenizing 143 selection (Tab. 4). A significant effect of geography was also detected via GLMM analysis and post-hoc test, which indicated that hatching size was greater in eastern populations (1.51 mm, SE ± 0.01) than in western ones (1.44 mm, SE ± 0.01). This was consistent with results obtained with the parameter b (Tab. S4; W > E, as b is negatively related to size at t0). Considering traits related to fecundity, the three possible patterns of selection were observed. First, neutral patterns were found for the total number of eggs laid per snail during 15 days (15 days fecundity) and for the number of eggs per clutch (clutch size). In apparent contradiction with this finding, GLMM analysis followed by post-hoc test (p < 0.001) clearly indicated smaller clutches from pond populations (n = 31.11 SE ± 0.8) than from ditch populations (n = 33.55 SE ± 0.71), themselves being significantly smaller than clutches from channel populations (42.54 SE ± 0.8). Second, divergent selection was shown to act on three traits, i.e., ability to lay eggs, time to oviposition, and number of clutches laid during 15 days. According to the GLMM analyses, the number of clutches varied mainly according to population (no fixed effect) whereas habitat was the main fixed factor acting on reproduction ability and on time to oviposition. The proportion of reproductive (G1) snails was lower in pond populations (80.56% SE ± 1.66) than in ditch (97.22% SE ± 0.26) and channel populations (98.33% SE ± 0.11) (post-hoc test: p < 0.001). Snails from pond populations also laid their first clutch significantly later than snails from the other two types of aquatic system (8.9 days SE ± 0.8 vs. 4.4 days SE ± 0.3 and 4.8 days SE ± 0.3, respectively) (post-hoc test: p < 0.01). Furthermore, a trend to higher ability to reproduce was also noted in snails stemming from populations with a higher risk of pesticide exposure. Last, clutch hatching rate (i.e., G2 survival at hatching) appeared to be submitted to homogenizing selection (Tab. 4). However, despite this general trend towards the same optimum (highest survival) significant differences were noted between aquatic systems and levels of environmental risk, with higher hatching rates from channel populations (95.9% SE ± 0.46) as compared to those from ditches and ponds (93.9 % SE ± 0.61 and SE ± 0.7, respectively) (post-hoc test: p < 0.05), and independently in the less anthropized water bodies (96.1 % SE ± 0.53 vs. 94% SE ± 0.43 for AL2) (p < 0.001) (Fig. 6). 144 20 40 60 80 0 Hatching rate (%) AL1 AL2 Figure 6. Observed hatching rate depending on the level of anthropization. Plot based on 1537 clutches. Discussion The hypothesis that human activities may induce divergent selection patterns in Lymnaea stagnalis was addressed using a common garden experiment, involving life history traits and a set of natural populations stemming from contrasted environments, with respect to pesticide pressure. Different patterns of selection were suggested by the data. Compared to the level of anthropization and the pesticide risk related to agricultural activities, habitat type appeared as the main factor of population genetic divergence. Globally, between-population genetic variation was strong and significant, except for two early expressed traits, i.e., growth parameter b and size at hatching, for which the analysis consistently concluded to homogenizing selection. For these traits, low QST values were related to a high family effect. This finding supports results previously obtained in another freshwater gastropod (Galba truncatula; Chapuis et al., 2007), as the expression of maternal effects operating early in life, and which may result from the transfer of epigenetic, cytoplasmic or somatic factors, nutrients, or extra-organismal environment from parents to offspring (Bonduriansky and Day, 2009), and tend to recede with age (Wolf, 2000). However, our experimental design (G1-based design) did not allow disentangling these effects from true genetic effects. Indeed, as wild-caught adults were likely to have stored sperm from previous mating in the field, a full-sib design was assumed, under which both maternal effects and dominance effects cannot be separated from true additive genetic effects (Leinonen et al., 145 2008). Moreover, in the present experiment, an additional source of family variation may be related to the fact that the seven first measurements are mean sizes based on 4 or 14 snails that were randomly selected each date (depending on age, see Fig. 2 & methods). Despite low variability, these two traits were the only ones significantly influenced by the East-West geographical structure, with smaller size at hatching to the East. Also, the growth parameter b was significantly influenced by habitat type and anthropization level, suggesting larger individual size at hatching in the most exposed channels and ditches. The largest hatchlings were observed in families from Baarn population, whereas this population exhibited the smallest size at age 119 days and the smallest asymptotic size (see Tab. S3). Both of these traits were suspected to be under divergent selection. GLMM analysis revealed that later traits related to growth were mainly influenced by the type of habitat, with larger snails from pond populations than from ditches and channels. In contrast, regarding the growth rate parameter k, only population and family effects were significant, and this trait was shown to tend to be under homogenizing selection. As experimental conditions may act strongly on growth rate (Coutellec et al., 2011), standard rearing conditions applied in the present study, with limited amounts of food, might explain the homogenizing trend observed. One may expect that genetic variation in growth rate could express with a larger magnitude under ad libitum conditions (potential growth under optimal energetic conditions). However, this may on the other hand be counterbalanced by the fact that stressful conditions (here, limited food) are likely to increase phenotypic variation (Holloway et al., 2003). These results reflect the critical dependency of life-history expression upon direct environmental (and thus experimental) conditions, and the potential bias this may result in, when estimating evolutionary patterns from heritability, especially when the traits are used as fitness proxies (fitness vs. laboratory estimates of heritability; see Ritland 2000). Concerning traits related to fecundity, patterns of divergent selection were found to act on the ability of snails to lay eggs, indicating a lower ability in snails from pond populations, as well as a trend to higher reproductive ability in populations from sites more exposed to pesticides. Accordingly, divergent selection was shown to act also on the time to first clutch after isolation from grouping conditions, with a trend to longer times in snails from pond populations. Two populations (Cas. and Det.) showed particularly low reproductive ability. Overall, neutral genetic distances (pairwise FST) indicated that pond populations were particularly differentiated which is consistent with population isolation and weak habitat 146 connectivity, added to the low dispersal potential of the species. Although migratory birds are suspected to participate to dispersion in freshwater gastropods (e.g., Radix balthica; Pfenninger et al., 2011) and in other invertebrate taxa (Frisch et al., 2007), this has never been demonstrated in L. stagnalis, whose clutches are among the largest in this community (which may limit passive aerial dispersal). Be that as it may, such events are likely to be rare and have little evolutionary impact on populations. Consistently, genetic diversity was lower and inbreeding higher in populations from ponds, and to a lesser extent, in those from ditches. Compared to channels, these aquatic systems are likely to imply stronger population isolation, even among ditches. Indeed, despite the fact these habitats may belong to large interconnected networks, gene flow is expected to be limited, due to frequent drought. A similar influence of habitat was emphasized in another freshwater snail (Physa acuta; Escobar et al., 2008), with a stronger differentiation among pond populations than among river ones. Habitat fragmentation has also been shown to negatively impact body size in tadpoles of the common frog, Rana temporaria, and to correlate with low genetic diversity and high differentiation (Johansson et al., 2007). Although in the present study, ultimate body size (Gompertz’ parameter A) was found to be larger in ponds, the relation between size and fitness is not necessarily positive in L. stagnalis, possibly due to energetic trade-offs between growth and reproduction (Zimmer et al., 2012), whereas in amphibians, the size of tadpoles at metamorphosis is a critical trait which determines individual’s fitness in terms of survival and future reproductive success (Bridges and Semlitsch, 2000). Population inbreeding (FIS) was found negatively related to fecundity, in terms of ability to reproduce, and of number of eggs laid over a given period once oviposition started (G1 adults isolated from grouping conditions). This result is consistent with the occurrence of inbreeding depression in inbred populations, which translated into reduced fecundity in laboratory reared G1 snails, under outcrossing. Although inbreeding depression associated to self-fertilization is low in L. stagnalis (Puurtinen et al., 2004a; Puurtinen et al., 2004b; Coutellec and Lagadic, 2006; Puurtinen et al., 2007), inbreeding indices (FIS) determined in the present study seem directly correlated to reduced fecundity and lower ability to reproduce. This suggests that inbreeding depression in the field might be higher than empirically demonstrated in laboratory, and could confirm that random drift load might be strong in small and isolated natural populations (Coutellec and Caquet, 2011). 147 Regarding the mating system, selfing rates were generally not significant (not different from zero), in accordance with the status of preferential outcrosser of L. stagnalis (Puurtinen et al., 2007; Coutellec and Caquet, 2011; Escobar et al., 2011). However, large differences were found among populations, without link to anthropogenic pressure. Indeed, significant self-fertilization rates were found in two pond populations (Oud. and Det.) and one ditch population (Aga.), which represented each of the three levels of environmental pressure, as defined in the present study. Despite the apparent link between inbreeding and habitat type (isolation), and the correlation of inbreeding with reduced fecundity, clearly neutral pattern were found for total fecundity and for the mean number of eggs per clutches, indicating that differences observed within and among populations were due to random genetic drift only. However, habitat effect was revealed by GLMM analysis suggesting that clutches from ditch populations were smaller than those from channels and larger than those from ponds. In contrast, the number of clutches laid during the 15 day-survey was found to highly diverge among populations. As for total fecundity, none of the fixed factors was significant. More than the high variance among populations, the extremely weak variance observed within populations explains the high QST value for this trait. Although heterogeneous selection cannot be excluded, the fact that habitat type (connected vs. closed) explains largest part of variance for most of the studied traits, can also reflect a differential impact of drift rather than different selection regimes (Escobar et al., 2008). Regarding the last studied trait, i.e., the hatching success observed on clutches laid by G1 snails, significant differences between habitats were found indicating higher hatching rates in channel populations, although homogenizing selection was found to act on this trait. This selection pattern toward the best hatching rates was not surprising as this trait is related to survival. However, the negative correlation between hatching rates and inbreeding may be another proof of the non-negligible inbreeding depression occurring in natural populations of L. stagnalis as expected by theory for predominant outcrosser and ever demonstrated in other highly outcrossing basommatophorans (Coutellec-Vreto et al., 1998; Jarne et al., 2000; Escobar et al., 2011) although low inbreeding depression were observed in laboratory under self-fertilization controlled mating (Coutellec and Lagadic, 2006; Puurtinen et al., 2007; Coutellec and Caquet, 2011). Despite the lack of channels (i.e., habitat with high gene flow potential), significantly higher hatching rates were found in the less anthropized regions, 148 suggesting negative evolutionary impact of human activities on hatching success. Interestingly, a similar result was already observed on the hatching rate of the clutches laid by G0 snails (720 clutches, p = 0.007). Coupled with the reduced reproductive ability in populations from the less exposed regions, these were the main life-history traits impacted by human-induced pollution. This might highlight evolutionary response enhancing performances in fecundity in the most exposed populations to overcome early mortality induced by chemicals. Although the number of natural populations studied was close to the minimum number recommended for QST – FST approaches (Goudet and Buchi, 2006), and GLMM analysis can manage unbalanced designs (Pinheiro and Bates, 2002), the lack of ponds with a high expectation of contamination by pesticides and the miss of channels in the less anthropized regions may impede in part statistical analysis of phenotypic traits and hierarchical analyses. It underscores the need of a well equilibrate sampling design for such analyses. However, we currently try to apply analysis method based on G-matrix comparison, treating traits together and allowing hierarchical patterns (Chapuis et al., 2008; Martin et al., 2008; Ovaskainen et al., 2008; Ovaskainen et al., 2011). Our present results suggest that to investigate impact of human and more specifically agricultural activities on micro-evolutionary processes occurring in natural populations, sampling animals from comparable habitats could permit to discard some confounding effects. Anyway, the strong differences observed among and within populations whatever the studied traits, reflect high genetic and phenotypic diversity in natural populations. Both types of effects are expected to affect ecotoxicity testing (Barata et al., 2000; Coutellec and Lagadic, 2006; Coutellec et al., 2011). Thus, population adaptation to chemical stress alters the dose-response curve expected from non-adapted populations. Toxicity tests that ignore the genetic attributes of populations or cohorts (i.e., genetic diversity, inbreeding level) should not be used to extrapolate from the laboratory to the field (Bridges et al., 2001; Frankham, 2005; Nowak et al., 2007). Moreover, with regard to nongenetic trans-generational effects, exposed individuals may not be the right ones to focus on, as effects may only be detected after one or several generations. Arguments for the incorporation of population genetics and trans-generational endpoints into ecological risk assessment are thus now clearly identified (Breitholtz et al., 2006). 149 Conclusion and perspectives The investigation of evolutionary impact of human activities on natural populations of Lymnaea stagnalis has revealed potential impacts on the ability of snails to reproduce and on the hatching success of the progeny of wild-caught snails reared in common garden conditions. However, divergent selection patterns among populations revealed for some of the studied traits were found to be mainly influenced by the different types of habitat and their respective gene flow potentials. Nevertheless, the high differences within and among populations observed in this study confirm the need to take into account such population genetics and trans-generational endpoints for ecotoxicological risk assessment. However, fundamental work is still needed before concrete recommendations can be made. Additionally, as a companion study of the present work, a quantitative analysis of genetic divergence in gene expression has been conducted at the transcriptomic level (RNAseq) in response to a challlenge by oxidative stress (using the redox-cycling herbicide diquat). This approach is currently conducted on a subset of these populations (Cas., Put., Kui. and Emm.) and might possibly highlight stronger divergences in stressful conditions between populations with respect to their historical exposure to pesticides. The whole dataset and analysis thereof are expected to give a clearer picture of the evolutionary impact of pesticides on non-target organisms. Acknowledgments This work has been carried out with the financial support from the INRA (EFPA Projet Innovant 2010; AIP Bioressources 2010). AB is granted by the INRA (PhD, Contrat Jeune Scientifique). The authors thank the INRA U3E staff (INRA, Rennes) and more particularly Maïra Coke for her technical assistance. Our thanks are also due to Thierry Caquet, Sabrina Le Cam, Jessica Côte for their help, constructive discussions and advices in statistics, and also Laurent Lagadic for reviewing the last version of manuscript. The authors finally thank Benoît Heurtault and Gaëlle Méheut (from groovy-banana.com), Elise Petitpas and Arnaud Giusti for their hospitality and logistic support during the sampling period. 150 Supplementary tables Table S1. Locus and population genetic characteristics. n indicates the number genotyped individuals, Na is the number of alleles, AR is allelic richness (based on samples of 12 individuals), HO is the observed heterozygosity, HE is the unbiased expected heterozygosity, and FIS is the inbreeding coefficient (significance is indicated in bold characters). Locus Overall 1.Oud 2.Oos 3.Bie 4.Baa 5.Cas 6.Put 7.Sch 8.Emm 9.Kui 2k11 n Na AR Ho He F IS 10.Bux 11.Koe 12.Aga 13.Hed 336 14 7.633 0.530 0.822 0.356 13 5 4.85 0.615 0.683 0.103 31 8 6.13 0.903 0.770 -0.176 30 8 6.56 0.567 0.790 0.286 21 3 2.93 0.571 0.529 -0.084 30 4 3.62 0.433 0.481 0.1 32 3 2.99 0.563 0.569 0.012 25 4 3.35 0.480 0.545 0.121 23 4 3.94 0.609 0.565 -0.079 A112 n Na AR Ho He F IS 349 29 9.261 0.332 0.759 0.562 13 7 6.84 0.769 0.812 0.055 32 12 8.88 0.406 0.818 0.507 29 8 6.29 0.448 0.794 0.44 19 8 6.91 0.316 0.676 0.539 32 1 1.00 0.000 0.000 _ 31 2 1.99 0.290 0.252 -0.154 26 2 1.46 0.039 0.039 0 2k27 n Na AR Ho He F IS 349 5 3.919 0.338 0.664 0.491 13 4 3.85 0.385 0.345 -0.121 31 4 3.97 0.581 0.698 0.17 29 3 2.96 0.483 0.402 -0.206 22 3 2.99 0.318 0.555 0.432 31 4 2.88 0.032 0.211 0.849 30 4 3.04 0.200 0.403 0.508 n Na AR Ho He F IS 345 14 7.914 0.481 0.817 0.411 12 5 5.00 0.417 0.801 0.491 31 7 6.68 0.581 0.820 0.295 30 11 7.79 0.633 0.682 0.072 21 7 6.31 0.524 0.797 0.348 32 9 4.86 0.344 0.464 0.262 B117 n Na AR Ho He F IS 339 27 9.627 0.434 0.806 0.462 12 3 3.00 0.417 0.540 0.236 32 7 5.46 0.406 0.695 0.419 27 4 2.88 0.259 0.294 0.119 20 6 5.53 0.600 0.724 0.175 EMLS04 n Na AR Ho He F IS 351 5 2.778 0.202 0.317 0.361 13 2 2.00 0.154 0.148 -0.043 31 3 2.63 0.323 0.368 0.125 30 1 1.00 0.000 0.000 _ EMLS13 n Na AR Ho He F IS 354 4 2.133 0.271 0.470 0.423 13 2 1.92 0.077 0.077 0 32 2 2.00 0.438 0.508 0.141 EMLS21 n Na AR Ho He F IS 352 3 1.101 0.003 0.009 0.666 13 1 1.00 0.000 0.000 _ 32 1 1.00 0.000 0.000 _ 14.Det 24 3 2.48 0.250 0.228 -0.1 25 5 4.54 0.480 0.607 0.212 25 8 6.49 0.480 0.700 0.319 19 8 7.48 0.474 0.868 0.461 26 3 2.99 0.423 0.597 0.295 12 3 3.00 0.500 0.594 0.165 24 5 4.70 0.125 0.719 0.829 25 9 7.33 0.440 0.816 0.466 27 3 2.70 0.444 0.545 0.188 27 10 6.36 0.444 0.743 0.406 25 9 7.25 0.160 0.764 0.794 26 3 2.46 0.423 0.497 0.151 13 4 4.00 0.846 0.699 -0.222 26 3 2.96 0.308 0.456 0.33 23 3 2.90 0.391 0.484 0.195 25 3 2.73 0.360 0.411 0.126 27 4 3.14 0.333 0.486 0.318 27 3 2.84 0.519 0.469 -0.108 25 3 2.94 0.480 0.581 0.177 26 3 2.70 0.231 0.275 0.162 14 2 2.00 0.000 0.349 1 29 5 3.83 0.207 0.698 0.707 24 6 4.51 0.500 0.582 0.144 23 7 5.70 0.478 0.627 0.241 25 7 4.91 0.480 0.629 0.24 27 6 4.86 0.630 0.699 0.101 26 9 7.37 0.808 0.789 -0.024 25 7 5.56 0.440 0.692 0.369 26 4 3.45 0.423 0.635 0.338 14 4 3.86 0.071 0.516 0.866 31 6 5.04 0.161 0.623 0.744 32 4 3.80 0.281 0.514 0.457 21 5 4.47 0.238 0.547 0.571 22 5 4.33 0.500 0.613 0.188 24 5 4.96 0.583 0.769 0.245 27 7 6.45 0.704 0.787 0.107 26 17 11.49 0.808 0.858 0.06 25 9 6.89 0.560 0.779 0.285 26 7 5.47 0.462 0.646 0.289 14 3 2.97 0.000 0.265 1 22 2 2.00 0.409 0.384 -0.068 32 1 1.00 0.000 0.000 _ 30 1 1.00 0.000 0.000 _ 25 2 1.48 0.040 0.040 0 24 2 1.99 0.250 0.223 -0.122 25 3 2.22 0.120 0.117 -0.029 27 2 2.00 0.370 0.425 0.13 27 2 2.00 0.185 0.373 0.508 25 2 2.00 0.440 0.393 -0.123 26 3 2.46 0.539 0.520 -0.037 14 1 1.00 0.000 0.000 _ 30 2 2.00 0.367 0.463 0.21 22 2 1.91 0.136 0.130 -0.05 32 2 2.00 0.375 0.437 0.143 32 2 2.00 0.563 0.476 -0.185 26 4 3.43 0.308 0.434 0.296 24 2 2.00 0.458 0.503 0.09 24 2 2.00 0.333 0.422 0.214 27 1 1.00 0.000 0.000 _ 27 2 1.84 0.037 0.107 0.658 25 2 2.00 0.320 0.327 0.02 26 2 1.72 0.000 0.075 1 14 2 2.00 0.071 0.198 0.649 29 1 1.00 0.000 0.000 _ 22 2 1.80 0.000 0.089 1 31 1 1.00 0.000 0.000 _ 32 1 1.00 0.000 0.000 _ 25 1 1.00 0.000 0.000 _ 24 2 1.50 0.042 0.042 0 25 1 1.00 0.000 0.000 _ 27 1 1.00 0.000 0.000 _ 27 1 1.00 0.000 0.000 _ 25 1 1.00 0.000 0.000 _ 26 1 1.00 0.000 0.000 _ 14 1 1.00 0.000 0.000 _ A2 151 Table S1. (continued) Locus Overall 1.Oud 2.Oos 3.Bie 4.Baa 5.Cas 6.Put 7.Sch 8.Emm 9.Kui EMLS26 n Na AR Ho He F IS 10.Bux 11.Koe 355 8 5.934 0.468 0.787 0.406 13 5 4.99 0.615 0.726 0.158 32 5 4.50 0.656 0.682 0.038 30 6 5.51 0.800 0.777 -0.03 22 5 4.47 0.546 0.650 0.164 32 2 2.00 0.313 0.347 0.101 32 4 2.90 0.188 0.231 0.19 26 4 3.81 0.462 0.472 0.023 24 4 3.95 0.542 0.713 0.244 EMLS29 n Na AR Ho He F IS 348 4 3.105 0.112 0.280 0.6 13 2 2.00 0.154 0.271 0.442 32 2 2.00 0.406 0.396 -0.025 29 3 2.47 0.069 0.164 0.584 22 2 1.55 0.046 0.046 0 28 2 2.00 0.143 0.486 0.71 32 2 2.00 0.281 0.289 0.028 26 1 1.00 0.000 0.000 _ EMLS41 n Na AR Ho He F IS 355 6 4.669 0.378 0.694 0.456 13 2 2.00 0.462 0.517 0.111 32 3 2.95 0.594 0.590 -0.007 30 3 3.00 0.533 0.666 0.202 22 3 2.80 0.136 0.529 0.746 32 3 3.00 0.406 0.548 0.261 32 4 3.93 0.500 0.585 0.147 EMLS45 n Na AR Ho He F IS 347 9 3.794 0.378 0.507 0.256 13 2 1.92 0.077 0.077 0 32 4 3.97 0.563 0.732 0.234 30 3 2.64 0.367 0.396 0.075 21 4 3.32 0.143 0.264 0.464 32 4 2.75 0.563 0.499 -0.131 31 3 2.92 0.419 0.418 -0.003 12.Aga 13.Hed 14.Det 25 4 3.87 0.520 0.637 0.186 27 4 3.39 0.482 0.405 -0.192 27 3 2.96 0.482 0.514 0.064 25 3 2.74 0.600 0.548 -0.098 26 3 1.92 0.077 0.076 -0.01 14 2 2.00 0.286 0.254 -0.13 24 1 1.00 0.000 0.000 _ 25 1 1.00 0.000 0.000 _ 26 1 1.00 0.000 0.000 _ 26 3 2.46 0.192 0.298 0.359 25 3 2.45 0.080 0.220 0.64 26 1 1.00 0.000 0.000 _ 14 3 2.86 0.071 0.405 0.829 26 4 3.39 0.308 0.367 0.163 24 5 4.64 0.458 0.740 0.386 25 4 3.99 0.640 0.678 0.058 27 2 2.00 0.407 0.331 -0.238 27 3 2.87 0.259 0.297 0.129 25 2 1.99 0.280 0.246 -0.143 26 1 1.00 0.000 0.000 _ 14 2 1.86 0.071 0.071 0 23 4 3.78 0.348 0.410 0.154 23 4 3.20 0.261 0.243 -0.078 25 4 3.47 0.360 0.425 0.156 27 2 2.00 0.407 0.409 0.003 26 3 2.39 0.192 0.180 -0.068 25 2 2.00 0.520 0.481 -0.083 25 3 2.48 0.240 0.456 0.479 14 3 2.86 0.643 0.553 -0.17 Table S2. Pairwise θ values, estimated on the basis of 12 SSR loci (lower diagonal). Upper diagonal: nominal level for multiple comparisons (adjusted to 0.000549). 1.Oud. 2.Oos. 3.Bie. 4.Baa. 5.Cas. 6.Put. 7.Sch. 8.Emm. 9.Kui. 10.Bux. 11.Koe. 12.Aga. 13.Hed. 14.Det. 1.Oud 2.Oos * 0.129 0.180 0.124 0.274 0.148 0.405 0.247 0.335 0.188 0.285 0.202 0.143 0.116 0.211 0.135 0.415 0.283 0.349 0.245 0.293 0.209 0.475 0.330 0.348 0.230 3.Bie * * 0.158 0.291 0.154 0.200 0.180 0.231 0.330 0.229 0.231 0.418 0.290 4.Baa 5.Cas * * * * * * * 0.319 0.219 0.305 0.302 0.365 0.170 0.347 0.187 0.384 0.300 0.464 0.223 0.382 0.232 0.416 0.423 0.548 0.404 0.478 6.Put * * * * * 0.146 0.240 0.266 0.352 0.231 0.294 0.462 0.364 7.Sch 8.Emm * * * * * * * * * * * * * 0.194 0.249 0.041 0.404 0.335 0.290 0.237 0.306 0.206 0.455 0.364 0.440 0.382 152 9.Kui 10.Bux * * * * * * * * * * * * * * NS * * 0.369 0.287 0.138 0.262 0.147 0.412 0.212 0.395 0.519 11.Koe 12.Aga 13.Hed 14.Det * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 0.081 * * 0.247 0.149 * 0.449 0.419 0.597 Table S3. Mean values of the life history traits obtained for the 14 studied populations. Level of Environmental Risk ER0 ER1 W Region cluster W E Pond ER2 W E Canal Pond E W Canal Ditch Habitat Ditch Pop # 9. Kui 1. Oud 5. Cas 13. Hed 14. Det 7. Sch 10. Bux 2. Oos 3. Bie 11. Koe 12. Aga 4. Baa 6. Put 8. Emm Asymptotique size (1154i) 31.3 (0.4) 31.3 (0.3) 33.6 (0.3) 34.5 (0.3) 39.7 (0.5) 31 (0.2) 29.8 (0.2) 32 (0.3) 32.1 (0.3) 30.5 (0.3) 30.8 (0.3) 27.7 (0.5) 30.8 (0.3) 33.3 (0.4) size at 119 days (mm) 18 (0.1) 18.8 (0.2) 18.5 (0.2) 17.9 (0.1) 18.8 (0.2) 17.5 (0.1) 18.2 (0.1) 18.3 (0.1) 18.2 (0.1) 17.4 (0.1) 17.8 (0.1) 17 (0.3) 17.9 (0.1) 18.4 (0.1) parameter b (1154i) 2.93 (0.02) 3.07 (0.04) 3.11 (0.02) 2.98 (0.02) 3.3 (0.03) 3 (0.02) 2.93 (0.02) 3.05 (0.02) 2.99 (0.02) 2.93 (0.02) 2.92 (0.02) 2.83 (0.03) 3.05 (0.02) 2.96 (0.02) hatching lenth (427 clutches) 1.5 (0.02) 1.4 (0.03) 1.4 (0.02) 1.5 (0.02) 1.4 (0.03) 1.5 (0.02) 1.4 (0.02) 1.4 (0.02) 1.4 (0.02) 1.5 (0.02) 1.5 (0.03) 1.6 (0.05) 1.4 (0.03) 1.5 (0.04) egg laying ability rate (%) 100 100 58.3 94.4 69.4 100 97.2 97.2 100 97.2 97.2 91.7 97.2 100 oviposition time (days) 3.8 (0.4) 2.7 (0.3) 15.6 (1.8) 5.1 (0.9) 12.3 (1.9) 5.5 (0.4) 3.9 (0.8) 5.1 (0.8) 5.4 (0.5) 4.3 (0.8) 3.2 (0.5) 6.8 (1.6) 4.6 (0.8) 4.4 (0.4) total fecundity 101.8 (8.2) 149.5 (5.9) 51.4 (9.6) 107 (9.3) 55.7 (11.2) 99.3 (9.4) 144.1 (11.4) 145.1 (14.6) 143.2 (8.5) 118 (7.3) 110.6 (7) 105.2 (12.9) 111.1 (7.6) 112.1 (8.3) number of clutches 3 (0.2) 5.8 (0.2) 1.2 (0.2) 2.9 (0.3) 2 (0.4) 2.1 (0.2) 3.8 (0.3) 3.3 (0.3) 2.8 (0.2) 3.4 (0.2) 3.7 (0.2) 4.1 (0.5) 2.9 (0.2) 2.9 (0.2) number of eggs per clutch 34.6 (1.4) 26.2 (0.9) 45.4 (2.8) 36.5 (1.6) 27.7 (1.9) 47.1 (2.7) 38 (1.1) 44.3 (1.8) 50.8 (2.1) 36.2 (1.3) 30.6 (1.2) 26.1 (1.6) 37.4 (1.8) 39.5 (1.7) hatching rate (%) 97.5 (0.7) 97.5 (0.6) 94 (2.2) 92.6 (1.6) 85.1 (2.4) 95.4 (1.4) 96.4 (1.1) 97.1 (0.5) 92.4 (1.5) 97.4 (0.5) 95 (1) 83 (2.7) 96.7 (0.6) 96 (0.5) 153 Table S4. Effects of fixed factors on life history traits using GLMM (Y ~ covar + Geo + Hab + Enviromental Tisk + (1 | pop / fam)). P- value significance level Traits \ Factors number number of of Geography observations families Habitat Pesticide Risk Anthropization level Level of Environmental Risk Growth-related traits / parameters Hatching size 427 211 * E>W ns ns ns ns Size at 119 days 2855 182 ns ns ns ns ns Asymptotic size (A) 1154 144 ns * P>C=D ns ns ns Parameter related to initial size (b) 1154 144 * W>E ** P>C>D ns ** AL1 > AL2 * ER0 = ER1 > ER2 Parameter related to growth rate (k) 1154 144 ns ns ns ns ns ns ** P<D=C RP1 < RP2 ns ns . Fecundity –related traits Ability to lay eggs 492 144 . Time to oviposition (from a 15-day follow-up) 492 144 ns P>D=C ns ns ns Total fecundity 492 144 ns ns ns ns ns Number of clutches 492 144 ns ns ns ns ns Clutch size 1537 144 ns ** P<D<C ns ns ns Hatching rate 1537 144 ns * P=D<C ns * AL1 > AL2 * ER0 > ER1 = ER2 Significance levels : .P < 0.1, *P < 0.05, **P < 0.01, ***P < 0.001 Table S5. Effects of the fixed covariates on Life history traits from the GLMM analyses : Y ~ covar + Geo + Hab + ER + (1 | pop / fam). Traits Hatching lenght number of number of observations families 427 211 pop family age <0.05 <0.001 _ 15 days growth during fecundity monitoring Parent size clutch size development time of parental clutch <0.1 <0.01 <0.001 (from a 15-day follow-up) Traits relative to fecundity Traits relative to growth _ size at 119 days 2855 182 <0.001 <0.1 _ _ <0.001 _ _ Asymptotic size 1154 144 <0.001 <0.001 _ _ NS _ _ parameter (b) related to initial size 1154 144 NS <0.001 _ _ NS _ _ growth rate parameter (k) 1154 144 <0.01 <0.001 _ _ NS _ _ Ability to lay eggs 492 144 <0.01 NS _ <0.001 _ _ _ Oviposition time 492 144 <0.001 <0.001 _ <0.001 _ _ _ 15 days fecondity 492 144 <0.01 <0.001 _ <0.001 _ _ _ Number of clutches during 15 days 492 144 <0.001 NS _ <0.001 _ _ _ Number of eggs per clutches 1537 144 <0.01 <0.001 <0.001 <0.001 _ _ _ Hatching rate 1537 144 <0.01 <0.001 <0.05 <0.001 _ _ _ 155 Chapitre V - Analyse RNAseq (Illumina) de la divergence génétique des réponses moléculaires au stress entre différentes populations naturelles de Lymnaea stagnalis. 156 Dans le chapitre précédent, nous avons constaté que la pression exercée par les activités anthropiques, et plus spécifiquement par l’utilisation de pesticides, pouvait impacter certains traits d’histoire de vie au sein des populations naturelles de L. stagnalis (i.e., augmentation de la capacité à se reproduire, baisse de la survie à l’éclosion). Dans le présent chapitre, nous avons cherché à savoir si, sur le long-terme, ces perturbations environnementales pouvaient induire au sein de ces populations, une divergence liée à l’adaptation locale au niveau des réponses transcriptomiques au stress oxydant. Pour cela, 504 individus G1 (~9 mois) représentatifs de l’ensemble des lignées ont été exposés pendant 5h à 0 ou 222,2 µg/L de dibromure de diquat, pour étudier et comparer en RNAseq (Illumina 2000), le transcriptome exprimé dans la glande digestive aux niveaux intra- et inter-populations. Initialement, l’objectif était de tester l’hypothèse de sélection divergente en appliquant une approche QST-FST sur ces mêmes 14 populations naturelles. L’idée était de considérer les données d’expression génique à la manière des traits phénotypiques quantitatifs dans l’estimation des QST et de les analyser au moyen de matrice G. Malheureusement, en raison du coût associé aux techniques de séquençage de nouvelle génération (NGS), même s’il tend à diminuer au fil des ans, nous avons dû nous limiter à un total de 16 librairies sur une demie flow-cell Illumina Hiseq2000 (assurant a priori un minimum de 20 millions de séquences par librairie). La composante évolutive des réponses moléculaires de L. stagnalis au stress pesticide a ainsi été étudiée en comparant l’expression différentielle entre diquat et condition témoin de différentes familles maternelles issues d’un panel de quatre populations naturelles échantillonnées en Hollande. Ces populations proviennent de fossés situés en bordure de champs cultivés (Putten, Emmeloord) ou de milieux préservés tels que la réserve d’eau potable de Castricum ou dans la forêt de Kuinre à proximité d’une réserve naturelle (Fig. 9). Castricum Emmelord Putten Kuinre Figure 9. Photos des sites d’échantillonnage des quatre populations naturelles utilisées pour l’approche RNAseq. 157 Les données de séquençage ont été générées, assemblées et annotées à la plateforme génomique et bioinformatique de l’INRA de Toulouse (Genotoul) et nous sont parvenues à la fin du mois de novembre 2012. A partir d’un nombre initial de 632464 contigs, la procédure d’assemblage suivie de filtration des contigs pour lesquels mappent moins de une lecture sur 1000000, a conduit à un total de 48381 contigs, dont 26958 ont un blast hit contre Swissport, Refseq-Prot ou Refseq-RNA et 12581 contigs ont une annotation fonctionnelle dans KEGG (> 50% hits). En raison du temps imparti, nous présentons ci-après les résultats préliminaires de l’analyse d’expression différentielle (méthodes statistiques test-t et DEseq). Globalement, ces résultats suggèrent une forte différenciation de la réponse transcriptomique entre les populations étudiées et présentent une forte analogie avec les résultats de l’analyse de différenciation génétique neutre. La variation intra-population est également très prononcée et démontre l’influence non négligeable de l’effet famille sur la réponse aux toxiques. Ces analyses préliminaires suggèrent donc un potentiel d’évolution adaptative important pour ces réponses (interactions génotype×environnement) et les réponses observées semblent cohérentes avec une toxicité du diquat induite par le stress oxydant, régulant la transcription de gènes impliqués dans de multiples voies de signalisation (e.g., apoptose, phosphorylation oxydative, système ubiquitine, métabolisme des xénobiotiques, etc.). Bien que des analyses qualitatives à l’échelle de ces processus et voies cellulaires spécifiques semblent indiquer une plus faible sensibilité au sein des populations historiquement exposées, l’analyse statistique ne permet pas pour le moment d’affirmer avec certitude la présence de réponses adaptives communes, à cause notamment de la forte variabilité des réponses transcriptomiques au sein des populations. Des méthodes statistiques plus appropriées à l’analyse de ce type de données sont actuellement en cours de développement (Lurin & Balzergue, en préparation), et seront prochainement appliquées afin d’optimiser l’analyse d’expression différentielle. L’analyse des réseaux de gènes impliqués dans ces réponses sera également réalisée pour enfin mettre l’ensemble de ces résultats en relation avec les indices de diversité génétique neutre et les traits d’histoire de vie précédemment étudiés sur ces mêmes lignées en condition de common garden. La recherche de corrélation permettra de mettre en évidence d’éventuels trade-offs et mécanismes pléiotropiques. 158 Article 4 - Genetic variation of transcriptomic expression in Lymnaea stagnalis exposed to a redox-cycling pesticide Anthony Bouétard1, Claire Hoede2, Thierry Pécot4, Anne-Laure Besnard1, Olivier Bouchez3, Nathalie Marsaud3, Marc Collinet1, Céline Noirot2, Marie-Agnès Coutellec1§ 1 INRA, UMR 0985 ESE, INRA/Agrocampus Ouest, Aquatic Ecotoxicology 65 rue de Saint-Brieuc 35042 Rennes, France 2 INRA, Genotoul Genomics Platform and 3 INRA, Genotoul Bioinformatics Platform, Toulouse Midi Pyrénées Toulouse-Auzeville, Chemin de Borderouge 31326 Castanet Tolosan, France 3 Genotoul, Plateforme Génomique, INRA UMR0444 LGC Toulouse-Auzeville, Chemin de Borderouge 31326 Castanet Tolosan, France 4 Comprehensive Cancer Center Ohio State University Columbus, Ohio 43210, USA § Corresponding author: Marie-Agnès Coutellec INRA, UMR INRA-Agrocampus Ouest ESE 0985 65 rue de Saint-Brieuc, 35042 Rennes cedex, France +33 2 2348 5529 [email protected] 159 Abstract Population response to stress may have a genetic component which, if additive, is the basis for adaptive evolution to local conditions. Apart from monogenic resistance, adaptive processes have been traditionally investigated through phenotypes at quantitative traits. However, more elementary responses may also entail a heritable component. This is true for gene expression, which results from various molecular interactions. We investigated the evolutionary potential of transcriptomic expression induced by a pro-oxidant herbicide, diquat, using lines from four natural populations of the pond snail Lymnaea stagnalis. Populations stemmed from contrasted environments (close to vs distant from agricultural zones), which allowed testing the influence of historical exposure to putative environmental stressors. These populations were significantly differentiated at neutral genetic markers (global FST) and showed significant genetic divergence at several life history traits. In the laboratory, G1 individuals were exposed during 5 hours to diquat vs control conditions. RNA was extracted from hepatic tissue. RNAseq (Illumina Hiseq2000) analysis was based on 16 cDNA libraries, i.e., two replicates (each based on three different families) per population × two exposure conditions (diquat, control). Read assembly was performed combining FLASH, Trans-AByss and MIRA, then reads count were done using bwa. After filtering contigs the less represented, 48321 contigs were obtained, 26958 of which had a blast hit against Swissprot, Refseq-Prot or Refseq-RNA and 12581 had blast hits against KEGG database. Diquat-induced differential expression was compared across genetic origins using DESeq package and compared to a Student t-test performed within each population. Overall, preliminary results indicate a strong differentiation of transcriptomic responses between populations and exhibit a strong analogy with neutral genetic differentiation. Variations within each population seem also very pronounced demonstrating the non-negligible influence of family effects on the response to toxic. Analyzes suggest a potential for adaptive evolution in these responses (G x E interactions). These responses were globally consistent with toxicity of diquat-induced oxidative stress and concerned various signaling pathways (e.g., apoptosis, oxidative phosphorylation, ubiquitin mediated proteolysis, xenobiotic metabolism, etc.). Although present analyses do not permit to conclude yet with certainty on the presence of common adaptive responses, qualitative analyzes across some of cellular processes of interest suggest a lower sensitivity in populations historically exposed to high pesticide pressure. 160 Introduction Understanding the genetic basis of population response to environmental change is a major issue in fundamental evolutionary biology (Pigliucci, 2006), which has also gained increasing interest in more finalized contexts, mainly environmental sciences and conservation biology (Hoffmann and Parsons, 1997; Hedrick and Kalinowski, 2000; Hoffmann and Hercus, 2000; Hoffmann and Willi, 2008a; Smith and Bernatchez, 2008). Similarly (although more recently), in the current context of environmental crisis which combines ever-expanding anthropogenic alterations with the effects of climate and global changes, ecotoxicologists have started to express their concern towards the long term and evolutionary impact of pollutants and other human-induced environmental disturbances (Depledge, 1994; Bickham et al., 2000; Medina et al., 2007). Consistently, a growing corpus of knowledge is currently being provided to the scientific community, which builds on both natural case-study documentation (Lind and Grahn, 2011) and experimental approaches (Barata et al., 2002; Coutellec et al., 2011; Jansen et al., 2011; Costa et al., 2012). These new datasets, by producing cumulative evidences for the multi-generational impact of pollutants, set out relevant and timely arguments to support the need to incorporate an evolutionary dimension into ecological risk assessment (Breitholtz et al., 2006; Coutellec and Barata, 2011). To this end, reliable tools are required which may be directly borrowed from population genetics and quantitative genetics (Bickham, 2011; Klerks et al., 2011), and also benefit from new advances in genomics (Martyniuk et al., 2011; van Straalen and Feder, 2011). Population response to stress may have a genetic component which, if additive, is the basis for adaptive evolution to local conditions (Bridges et al., 2001; Carvajal-Rodriguez et al., 2005). Evolutionary processes related to adaptation have been traditionally investigated through integrated responses that involve polygenic characters, such as quantitative traits (e.g., life-history traits, physiological functions). However, besides this level of phenotypic integration, more elementary responses may also entail a heritable genetic component. This is particularly true for gene expression, which results from genetic interactions between the encoding gene itself and other regulatory genes. Genetic variation in gene expression has been rarely quantified (Roelofs et al., 2008). The genetic component of transcriptomic responses to environmental stress has been investigated at the level of natural populations in only a few studies, reflecting either divergent (Schoville et al., 2012) or convergent patterns (Whitehead et al., 2012). Inferring evolutionary adaptive patterns associated to environmental change 161 focuses mainly on the search for genes or gene sets under positive selection (see Hoffmann and Willi, 2008). However, one possible drawback of the strategy is that it can bias estimation towards genes of major effects, at the expense of adaptive processes based on quantitative tolerance responses, which may involve more numerous genes of smaller effect, and whose genetic basis may be more complex to assess. Although tolerance to pollutants can be attributable to monogenic mutations in some cases, such as advantageous mutations on gene promoter regions, as described in the soil arthropod Orchesella cincta, as increased constitutive expression of metallothionein gene in populations from metal contaminated sites (van Straalen and Roelofs, 2011; Costa et al., 2012), historical exposure to toxicants may also trigger different molecular processes which may altogether contribute to adaptation. Freshwater organisms inhabiting water bodies adjacent to agricultural parcels, such as ditches and marshes, are expected to be good models to test local evolutionary effects of pesticides (e.g., Coutellec et al. 2011). This is particularly true for species with a fully aquatic life cycle (e.g., molluscs and crustaceans). Indeed, various pesticides that are repeatedly applied under culture protection programs may non-intentionally reach these habitats through several ways, including aerial drift, run-off, and drainage (Brown and van Beinum, 2009) and may impact non-target organisms. Moreover, water bodies located in agricultural landscapes have hydro-physical characteristics that also promote local evolutionary processes, due to limited habitat connectivity and permanence (lentic and close or frequently drained habitats). In theory, local evolutionary processes may involve both random genetic drift and selection. Genetic variation of small population inhabiting freshwater lentic habitats located close to agricultural parcels may have a predominant effect because of low (or frequently reduced) population size and limited gene flow, whereas larger population sizes would be needed for local adaptation to occur (Willi et al., 2006). The present study investigates transcriptomic responses of the freshwater pulmonate gastropod Lymnaea stagnalis exposed to a redox-cycling herbicide, diquat. Ecologically, L. stagnalis is representative of freshwater lentic environments and of the holarctic herbivorous macroinvertebrate community. Freshwater snails may represent up to 20—60% of the total abundance and biomass of macroinvertebrates in some freshwater ecosystems (Habidja et al. 1995) where they play a major role in the transfer of energy and material across food webs. The bypiridyl herbicide diquat was chosen as model pesticide to test the hypothesis that agricultural activities may induce evolutionary changes in natural population of L. stagnalis. First, diquat belongs to the first class of synthetic herbicides ever commercialized 162 in the 1940s (Karuppagounder et al., 2012) and is still widely used, mostly in industrial countries, in crop protection (potato, banana, vine and other seed crops) and also floating and emerging weeds control (US-EPA, 1995; Ritter et al., 2000; FAO, 2008; French Ministry of Agriculture, 2012). Therefore, populations inhabiting farmland ditches or ponds may be regularly exposed to diquat, for many successive generations. Second, as a number of xenobiotics, including pharmaceuticals, metals and pesticides, the toxicity of diquat is elicited by oxidative stress (Smith et al., 1985). Due to its pro-oxidant properties, diquat is used as model chemical in medical toxicology and cellular biology (Smith et al., 1985; Sandy et al., 1986; Thomas and Aust, 1986; Gallagher et al., 1995). Oxidative stress results from the unbalanced redox status in cells inducing cascade damages on protein, cellular membrane and DNA integrity by the increase of uncontrolled reactive oxygen species (ROS) (Dröge, 2002; Monaghan et al., 2009). Despite their toxic nature, ROS are natural by-products of aerobic metabolism that mediate the toxicity of oxygen, and are expected to act in intracellular signalling transduction (Poulsen et al., 2000; D'Autreaux and Toledano, 2007). Defence systems against ROS, including antioxidant enzymes such as superoxide dismutase (SOD), catalase (Cat), glutathione peroxidase (GPx) or glutathione reductase (Gred), a regulator factor (retinoid X receptor), and chaperones such as Hsp70 and Hsp40, have been investigated through qPCR and biochemical analyses on a L. stagnalis laboratory strain (Renilys®, INRA). Results showed a significant impact of diquat on these candidate genes, which was however not necessarily followed by changes in activity of the corresponding enzymes. Transcriptomic resources have been recently increased in L. stagnalis (Bouétard et al., 2012; Sadamoto et al., 2012), providing tools for genomewide investigations of molecular mechanisms of stress response. These new resources were applied in the present study, together with a set of new microsatellite markers (Besnard et al., 2013), to address the following nested issues: (i) is there genetic variation in the molecular ability to handle oxidative stress? This hypothesis was tested by using G1 families from four natural populations of L. stagnalis, (ii) if occurring, is genetic variation mainly driven by random forces or selectively directed? To tackle this question, we compared the pattern of population variation inferred from neutral markers (FST) to that obtained from a whole transcriptome expression analysis of the digestive gland tissue, as inferred from RNAseq analysis. (iii) finally, if population divergence has a genetic component, we aimed at testing the hypothesis that historical exposure to anthropogenic stress may act as a selective force that shapes gene expression variation and evolution. To do so, four natural populations were selected to represent two contrasted environmental conditions with respect to anthropogenic pressures (reference vs. exposed to 163 high risk of contamination by pesticides). These populations belong to a group of 14 natural populations previously sampled in July 2011, for the purpose of a companion study (Bouétard et al in prep.), which investigated the evolutionary impact of historical pesticide exposure on fitness-related traits, through a QST-FST approach. In the present context, RNAseq (Illumina Hiseq2000) was used to assess transcriptomewide differential expression induced by diquat, using G1 snails representing several families per population, and a total of 16 libraries. Coupled with the neutral genetic diversity, we have used these datasets to search for selective patterns between population types that could be indicative of an evolutionary impact of historical exposure to anthropogenic stress. (Fig. 1) Figure 1. Overview of the scientific approach. On the map are localized the four studied populations, Unexposed and exposed sites are indicated in white and black, respectively. 164 Materials and methods Snails, study sites and laboratory breeding The study populations of L. stagnalis represent a subset of 14 natural populations whose genetic variation has been previously characterized at neutral markers and life-history traits, in a FST-QST approach (Bouétard et al. in prep). The four study populations were selected using two criteria: geographic location (~100km maximum distance, northern part of The Netherlands) and pesticide pressure (two reference and two exposed populations). Two populations were sampled in the western side of the Ijsselmeer (Castricum – Cas., 52°33.17N / 4°37.22E ; Putten – Put., 52°45.81N / 4°39.82E) and the other two on the eastern side (Kuinre – Kui., 52°47.67N / 5°47.69E ; Emmeloord – Emm., 52°46.27N / 5°48.26E). Populations Cas. and Kui. were considered as unexposed with respect to the pesticide pressure, whereas Put. and Emm. were close to intensive agricultural areas (Fig. 1.). Details on sample sites characterization and on population neutral genetic diversity are given in Table_1. Laboratory-born G1 snails from wild-caught adults (Summer 2011) were reared under standard conditions, as explained earlier (Bouétard et al. in prep). Table 1. Ecological neutral genetic characteristics of four Lymnaea stagnalis populations. Pesticide exposure risk was based on the percentage of land use categories within a radius of 100 m around the sampled sites. n indicates the number of genotyped individuals, N is the number of alleles, AR is allelic richness (based on samples of 12 individuals), HE is the unbiased expected heterozygosity, HO is the observed heterozygosity, and FIS is the inbreeding coefficient (significance is indicated by asterisk). Ne is the effective population size and estimations of selffertilization rates calculated are also presented. Localization Castricum Putten (Alkmaar) Population features Abbreviation Cas. Land use 100% moor Habitat Pesticide Risk n N AR Genetic HE diversity HO indices FIS N e [CI 95%] Self-fertilization rate (%) Kuinre Emmeloord (Noordoostpolder) Put. Kui. Emm. Pond 30% crop, 70% urban Ditch 98% forest, 2% urban Ditch 80% crop, 20% urban Ditch unexposed exposed unexposed exposed 32 3.3 2.60 0.341 0.231 0.327 * 31 [19 ; 58] 32 2.9 2.62 0.370 0.291 0.216 * 37 [22 ; 67] 25 3.8 3.33 0.428 0.341 0.207 * 25 [14 ; 52] 24 3.7 3.32 0.456 0.343 0.252 * 36 [20 ; 80] 0 18.6 0 0 165 Molecular analyses DNA was chelex extracted from haemolymph or foot tissue from 113 wild-caught adults (24 to 32 snails per population). Neutral genetic variation was described at 12 microsatellite loci, i.e., A2, A112, B117 (Knott et al., 2003), 2k11 and 2k27 (Kopp and Wolf, 2007), and EMLS04, EMLS13, EMLS21, EMLS26, EMLS29, EMLS41, EMLS45 (Molecular Ecology Resources Primer Development et al., 2013), following the protocol described in Besnard et al. (2013). Only individuals with less than three missing (unreadable) genotypes were retained for analysis. Population neutral genetic diversity and differentiation Mean allele number (N), allelic richness (AR), expected heterozygosity HE (Nei, 1978), and observed heterozygosity HO, were calculated with GENETIX 4.05.2 (Belkhir et al., 2004). The distribution of neutral genetic diversity within and among populations was estimated from Weir and Cockerham’s estimators of Wright’s F indices (Weir and Cockerham, 1984) using FSTAT 2.9.3.2 (Goudet, 2001). The selfing rate were estimated per population with RMES (David et al., 2007). Effective population size was estimated using the sibship assignment method, as implemented in the software COLONY 2.0.3.0 (Jones and Wang, 2010) and, assuming inbreeding, male and female polygamic mating systems, and monoecy. To estimate the number of genetic clusters in our dataset without taking into account any predefined population, we used STRUCTURE 2.2 (Pritchard et al., 2000). Analyses were performed assuming an admixture model and a number of genetic clusters (k) from 1 to 4 (15 replicates for each k). Each run started with a burn-in period of 50 000 steps followed by 300 000 Markov Chain Monte Carlo (MCMC) replicates. The most likely number of clusters was determined using the ∆k statistic (Evanno et al., 2005) using STRUCTURE HARVESTER (Earl and von Holdt, 2012). DISTRUCT was used to plot Structure output data (Rosenberg, 2004). Diquat exposure and tissue sampling Among the 144 G1 snails used in the present study (i.e., 3 snails per family, 12 families per population, 4 populations), 48 snails of age 205.8 ± 5.7 days (and of size 26.7 ± 2.44 mm), were used for transcriptomics. Half of the snails were individually exposed to a diquat solution of 222.2 µg/L for 5 hours, and the other half was maintained under control conditions as described earlier (Bouétard et al., 2012). After the exposure period, snails were 166 quickly killed into liquid nitrogen, and their shell removed. The tip of the digestive gland was then cut and plunged into RNAlater® (Ambion), and stored at -80°C as previously described (Bouétard et al., 2013). RNA isolation and sample preparation Total RNAs were extracted from 48 individual samples using 1 mL of TRIzol® reagent (Invitrogen) according to manufacturer’s instructions on portions of GDC varying from 10 to 22.5 mg of stabilized tissues. RNA quantity and purity were assessed with Nanodrop (Thermo, Fisher Scientific). Absorbance ratio values were A260/A280 = 1.97 ± 0.07 and A260/A230 = 1.9 ± 0.26. Total RNAs (30 µg from each GDC samples) were treated with DNAse I (Promega) and purified with the RNeasy Minelute Cleanup Kit (Qiagen). Following purification and quantification (Nanodrop), RNA samples were pooled to constitute 16 different libraries. The design included two replicates per treatment × population combination. Each library contained a pool of equal amounts of RNA (4 µg per sample) from three samples from a same population and submitted to a same treatment (C or D). The three samples composing each library stemmed from different families. Table 2. Organization of the 16 libraries on the Illumina flow-cell and family relatedness within library. FlowCell \ Pop Cas. Put. Emm. Kui. lane 1 C-R1* D-R1# C-R1* D-R1* lane 3 D-R1* C-R1# D-R1* C-R1* lane 2 D-R2# C-R2# D-R2# C-R2# lane 4 C-R2# D-R2# C-R2# D-R2# * and # indicate 100% and 66% of families homology between replicates, respectively Initially, we intented to cross family sets with treatment, by creating replicates with the same sets of families under each treatment (e.g., library1 = fam1C + fam2C + fam3C, library2 = fam1D + fam2D + fam3D), in order to have a finer estimate of the evolutionary potential at the intra-population level. Unfortunately, because of natural pre-treatment mortality or accidental shell injuries (e.g., apex broken), total homology was only met for three of the eight pairs of family sets (e.g., total homology between CasR1C and CasR1D), the other five having 66% of homology (i.e., two identical families on three, e.g., CasR2C and CasR2D) (Tab. 2). After pooling, RNA quality was determined for each library using Agilent 2100 Bioanalyzer (Agilent Technologies). 167 Libraries preparation and Illumina sequencing Library sequencing was organized in a half run comprising 4 lanes as indicated on Figure 2. To do so, total RNA libraries were firstly prepared for sequencing using the Illumina TruSeq RNA Sample Preparation Kit according to the TruSeq protocol. Fragments of cDNA were tagged with Truseq indices 1 to 4 supplied in the kit and amplified with 15 cycle of polymerase chain reaction (PCR). PCR products were purified using the E-Gel SIZESELECT 2% Invitrogen and the range of fragments around 300pb were excised and purified according to the manufacturer’s protocol. Their quality was checked with Agilent 2100 Bioanalyzer and concentrations were assessed by qPCR, indicating an average size of 275bp and concentration of 0.64 to 36.64 nM. The 16 libraries were then diluted to homogenize concentrations at 13 pM and pooled in four samples corresponding to the four lanes. Sequencing was carried on using a HiSeq 2000 instrument with 100-bp paired-end reads at the platform Genome and Transcriptome (GeT) at the Genotoul INRA institute (Toulouse, France). De novo Assembly The de Bruijn graph method was used as a primary algorithm in the RNA-seq assembly. As the insert size between the two mapped reads was small, the computational tool FLASH was used to improve assembly on all libraries (Magoč and Salzberg, 2011). Multistep assembly method was applied using sequential analysis with the de novo assembler Trans-AByss (Robertson et al., 2010) and the meta-assembler MIRA (Chevreux et al., 2004). Multiple k-mer size was used (25, 35, 45, 55, 65, 75) for assembly. A filtration step was applied to remove the less represented contigs, i.e., those for which less than one read on one million mapped (7% reads were removed). Gene annotation The final Trans-AByss assembly contigs were used as queries against the National Center for Biotechnology Information (NCBI) BlastX or Blastn (version 2.2.25), to search for homologies in the generalist databases: UniProtKB/SwissProt, Refseq Protein Index Blast, Refseq RNA Index Blast and PDBaa database. The cut-off e-value was set to 1e-5. The following species specific databases were queried with a cut-off e-value of 1e-10: SadamotoContigs.fasta, Unigene Lottia gigantea Build #2, TIGR Spisula solidissima Build #1. Finally, we realigned our contigs (Pondsnail_Contigs_V1 database). 168 with the cut-off e-value of 1e-30 Functional annotation was performed using ‘‘single best hit’’ Blast comparison against the KEGG genes database, with the program KAAS (KEGG Automatic Annotation Server: http://www.genome.jp/tools/kaas/) requiring 50% identity. Annotated sequences were further categorized using KEGG Orthology (KO) and the BRITE hierarchy for protein families, where four top categories were examined: metabolism, genetic information processing, environmental information processing, organismal systems and cellular processes. Differential Expression The list of contigs defined after assembly with Trans-AByss and MIRA was used as reference against which reads were mapped for the analysis of gene expression. In order to identify potentially meaningful group of librairies in the global count dataset and in subdatasets specific to target pathways, we performed a hierarchical clustering based on the correlation table of count data in R (command : heatmap(cor(log10(countdata+1)))). Differential expression (DE) was tested using two statistical methods. Firstly, DE analysis was performed with the DESeq package (Anders and Huber, 2010). This method has been specifically developed for count data with high dispersal, and is based on a negative binomial error distribution. The analysis was performed after library normalization (function estimateSizeFactor), using the binomial test (function fitNbinomGLMs) fitted with “local dispersion parameter” in the following generalized linear model: Y ~ population + condition + condition * population Because of a large variance between populations, analyses of DE induced by diquat exposure were also conducted within each population separately on the basis of the normalized count data, as determined from the 16 libraries. P-values were adjusted for multiple testing using the false discovery rate controlling procedure (Benjamini and Hochberg, 1995). Secondly, significance of the expression fold change was also assessed using a t-type test statistic from which heatmap of DE were built (Pécot, unpublished method). For data visualization (Fig. 9 & Tab. S1-6), DE contigs were filtered using the followind threshold parameters, p < 0.1 and weighted proportions of fold-change superior to 2 or inferior to -2. 169 Results & discussion Short-read de novo sequencing and assembly Raw data After removing adaptor sequences, low-quality bases, too short reads, Illumina sequencing conducted on the four lanes of the flowcell generated ~1,253 billion 100 bp reads (Tab. 3). Table 3. Summary of Illumina sequencing data of the L. stagnalis transcriptome. lane 1 2 3 4 Number of sequences 284,921,410 224,170,090 360,222,272 383,613,024 Full sequences length (bp) 28,777,062,410 22,641,179,090 36,382,449,472 38,744,915,424 Average read length (bp) 100 100 100 100 Library Insert length (bp) Number of sequences in the final dataset Cas. C r.1 135 38,650,624 Put. D r.1 152 108,699,656 Emm. C r.1 163 43,753,934 Kui. D r.1 161 49,538,816 Cas. C r.2 145 35,552,536 Put. D r.2 151 52,704,702 Emm. C r.2 167 63,262,874 Kui. D r.2 159 37,795,962 Cas. D r.1 165 90,885,446 Put. C r.1 163 51,662,226 Emm. D r.1 148 113,077,600 Kui. C r.1 187 47,112,660 Cas. D r.2 163 75,965,736 Put. C r.2 147 59,249,150 Emm. D r.2 159 97,552,048 Kui. C r.2 176 93,236,350 De novo assembly After filtration of the less represented contigs (i.e., those for which less than one read on one million mapped), the combined assembly using Trans-AByss and Mira generated a total of 48,321 contigs (~101 billions bases) corresponding to a dataset of ~1,070 billion reads among the 16 libraries. Contigs length varied from 100 bp to 29,437 bp with a mean value of 2,086.84 bp and depth was comprised between 0 and 174,143 reads with a mean value of 111.97 reads. N50 (statistical index of length N where 50% of all bases in the sequences are in a sequence of length L > N) sizes at 3,349 bp and N90 at 1,200 bp. 170 All contigs <200 bp were removed from differential expression analysis because there are known to give poor downstream results (Feldmeyer et al., 2011; Wang et al., 2012). We decided to remove also the few contigs >20,000 bp, as there annotations were unreliable (low % coverage query and % hit identity). Such extremely long contigs might reflect artefactual chimeras. Finally, a dataset of 45249 contigs totalizing ~1.060 billions 100 bp reads were selected for further differential expression analysis. Gene annotation Among the 45,249 contigs selected, 26,040 (57.55 %) had a significant BLAST hit against the generalist databases, i.e, 8,425 (18.62 %) against UniprotKB/Swiss-Prot, 16,087 (35.55%) against RefSeq protein, and 1,528 (3.38%) against RefSeq RNA. Figure 2 indicates the distribution of identities according to the database. 0.9 RefSeqProt relative frequency 0.8 0.7 RefSeqRNA 0.6 SwissProt 0.5 0.4 0.3 0.2 0.1 0 20 30 40 50 60 70 80 90 100 % identity Figure 2. Distribution of annotation quality according to the database used in BlastX (percent identity between query and database sequences). Identity percent is represented on the axis (“20” stands for 0-20% identity, etc.) 171 The highest numbers of best annotation hits were obtained with the acorn worm Saccoglossus kowalevskii (7845 contigs) and the amphioxus Branchiostoma floridae (6640 contigs), belonging respectively to phyla Hemichordata and Chordata (Fig. 3). The high phylogenetic distance between L. stagnalis and these species highlights the lack of (and critical need for) relevant genomic resources among invertebrates, and particularly in molluscs. Figure 3. Numbers of best hit annotations among the 20 most represented species (E-value < 1e-5) The search of functional annotations on KEGG database allowed to classify 12581 contigs within the 5 top process categories. As previously observed with the preliminary approach based on 454 pyrosequencing (Bouétard et al., 2012), the mostly represented category was metabolism (6245 annotations), followed with genetic information processing, (4165 annotations), environmental information processing (3262 annotations), organismal systems (2626 annotations) and cellular processes (2293 annotations) (Fig. 4). 172 Figure 4. Number of contigs classified according to the KEGG top categories. (12581 contigs, BLAST threshold > 50% identity). 173 Comparison between neutral and transcriptomic diversity Cas. A 005 Kui. Emm. Put. B Cas. Put. Emm. Kui. C P E Ca Ca K K E P s. s. ut. r ut. r mm mm u i. r ui. r rep re p ep . re . re e p ep ep 1 2 1 1 2 p1 p2 2 Figure 5. Genetic differentiation among the four studied populations. A, Unrooted Neighborjoining tree based on FST values estimated from 12 SSR loci. B, Bayesian individual clustering results with STRUCTURE for k=2. C, hierarchical clustering based on the count data of the 8 control libraries. As observed in the companion article investigating neutral genetic diversity among 14 natural populations, the four presently studied populations were significantly differentiated on the whole (FST = 0.280, p = 0.001), although pairwise FST-values revealed that it was not the case between Kui. and Emm. (Fig. 5a). Although in the previous Bayesian analysis involving 14 populations, these four populations belonged to the same western cluster, STRUCTURE here segregates two groups (Cas. and Put. vs. Emm. and Kui.) consistent with geographical location (Fig. 5b). Regarding the hierarchical clustering obtained from the correlation table restricted to eight control samples, it is worth noting that the corresponding tree had a very similar topology compared with the tree based on neutral markers. To our knowledge, it is the first evidence of such a RNAseq-based clustering of natural populations, if we except the case of natural populations of carrion crow Corvus corone and their hybrids with the hooded crow Corvus cornix, which is consistent with morphological phenotypic divergence, whereas no structure is observed with neutral markers (Wolf et al., 2010). 174 As suggested by the non-significant neutral differentiation (FST) between Emm. and Kui., gene flow might be possible through the network of temporary connected ditches. This hypothesis was confirmed by similar transcriptomic responses produced by these two populations, which are 2.5 km apart. By contrast, the two other populations Cas. and Put., separated by ~25 km, appeared strongly differentiated. Because of the low dispersal ability of L. stagnalis, genetic drift seems to play a predominant role in population differentiation. However no apparent link between the level of neutral genetic diversity and variance in transcriptomic response was observed under control conditions. Aside from local selective processes associated to chronic environmental stress, background selection and factors influencing the expression of deleterious mutations (of genomewide distribution), may become predominant under multi-stress and relatively unpredictable conditions. Indeed, stressful conditions have been shown to exacerbate the effect of spontaneous deleterious mutations (Szafraniec et al., 2001). Therefore, conditions under which deleterious accumulate or express at homozygous state (or do both), are expected to lead to a more severe impact of stress. Clearly, this is the case in small and inbred populations, where both local drift load and inbreeding depression can occur (Whitlock et al., 2000). Increased inbreeding depression under stressful conditions is empirically well supported (Armbruster and Reed, 2005; Fox and Reed, 2011; Bijlsma and Loeschcke, 2012), whereas the effect of environmental stress on heterosis is less documented (but see e.g., Coutellec and Caquet 2011). Our four populations differing in neutral genetic variability as well as in level of inbreeding, the relation between transcriptomic expression variation and neutral variation could be investigated at this scale, under oxidative stress used as stressful condition. Differential expression analysis When considering treated libraries, populations were still grouped according to the geographical pattern (Fig. 6). Interestingly, more variation occurred in Emm. than in Kui., however, whatever the degree of homology between family sets, correspondence between related family groups was respected. Such a proximity between family replicates was observed for most C-D pairs although the topology was slightly less clear in Put., possibly because only 66% of families were identical among C and D conditions for both treatment replicates (R1 and R2) (see Tab. 2). 175 Cas. diquat2 Cas. control2 Cas. diquat1* Cas. control1* Emm. diquat2 Emm. control2 Kui. diquat2 Kui. control2 Kui. diquat1* Kui. control1* Emm. diquat1* Emm. control1* Put. diquat1 Put. control2 Put. diquat2 Put. control1 Figure 6. Heatmap based on Euclidean distance between samples, as calculated from the variance stabilising transformation of the count data. * indicates 100% family homology between replicates. According to the generalized linear mixte model approach conducted with DEseq, 6157 contigs on the 45249 tested were significantly influenced by a population effect, confirming that population was the main factor shaping molecular responses among the 16 libraries (Fig. 7). Most of the 631 contigs detected to be significantly impacted by diquat exposure were shown to be also influenced by population (108 contigs) and by their interaction (505 contigs). The significant interaction detected between population and treatment for 542 contigs indicates that populations have strongly different responses and reaction norms to face oxidative stress induced by diquat. In other words, the effect of diquat is mainly expressed through its interaction with population. Diquat Population n=631 (84) n=6157 (979) 108 (14) 9 (2) 9 (3) 505 (65) 5518 (896) 26 (4) 2 (0) Population x Diquat n=542 (72) 176 Figure 7. Venn Diagramm of the DE contigs according to the three factors implemented in the multi-factorial model analyzed in Deseq. The count data dispersion of the 45249 contigs were fitted with a "local" parameter, adjusted p-value < 0.1. Number of Contigs having annotation in KEGG is indicated between brackets. Indeed, only 9 contigs were found to be differentially impacted by diquat exposure in all populations, including genes coding for ABCA4 implicated in membrane transport and the helicase SKI2 degrading RNA. The analysis of diquat-induced DE appeared very conservative, despite the fact that the significance threshold was set to 0.1. Due to the extreme influence of (population) origin on molecular responses, we investigated DE induced by diquat for each population separately using both a t-test and DEseq. Comparison of statistical methods Table 4. Overview of the preliminary results obtained from Kegg annotation and statistical analyses conducted per population, using t-test statistics and DEseq. Number of contigs (& related gene) Total dataset Number of contig DE according Number of contig DE according to t-test (p < 0.1) to DEseq (p < 0.1) FoldChange > |2| D>C D <C D >C D<C total total 45249 1211 523 132 100 125 166 688 168 218 113 189 592 287 41 43 60 153 311 43 96 53 122 12581 (4161) 170 80 20 20 19 21 90 24 28 11 27 90 49 6 12 6 27 42 7 10 6 19 2293 (595) 47 52 4165 (1548) 44 6245 (2023) 75 2626 (668) 58 30 8 8 5 9 34 10 7 6 11 21 4 9 2 6 40 11 11 5 13 34 6 13 2 13 22 3262 (983) 18 4 5 5 4 20 4 3 7 6 23 8 4 6 5 35 9 13 5 8 25 4 8 6 7 10 2 3 3 2 16 2 7 2 7 9 2 1 1 5 30 4 6 3 17 20 4 5 0 11 12 1 3 2 6 17 2 3 2 10 17 2 6 4 5 20 4 5 3 8 16 3 3 2 8 Cas. Put. Emm. Kui. Kegg annotated contigs dataset Cas. Put. Emm. Kui. Kegg processes Cellular processes Cas. Put. Emm. Kui. Environmental Information Processing Cas. Put. Emm. Kui. Genetic Information Processing Cas. Put. Emm. Kui. Metabolism Cas. Put. Emm. Kui. Organismal Systems Cas. Put. Emm. Kui. 177 33 25 50 36 Globally, DEseq was more conservative than the t-test analysis with almost half less contigs considered as DE (p < 0.1) (i.e., 592 / 1211), and this, although no threshold foldchange was applied on DEseq results (Table 4). This result tends to corroborate the fact that DEseq is a too conservative method for DE analyses, as revealed by a recent comparative analysis with microarrays and qPCR on A. thaliana (in this study, half of the contigs found as non DE with DEseq were actually highly DE, according to microarrays and qPCR; Balzergue, com. pers.). A method to overcome this bias is currently under development by the authors (Lurin & Balzergue, unpublished). However, in the present study, we found consistent results among both methods for 326 contigs. The proportion of annotated contigs in KEGG was similar and close to 15 % for both DE lists. Although at the scale of the whole dataset, ABCA4 and SKI2 appeared impacted by diquat exposure whatever the population, this response was less global in analyses conducted per population (see Fig. 9 and Tab. S1-5). Indeed, both statistical methods (t-test and DEseq) indicated that ABCA4 was significantly up-regulated in the two populations of the eastern cluster only. Consistently, ABCA4 has been shown to be significantly sollicitated in natural populations of the marine bivalve Modiolus modiolus inhabiting sites next to wastewater outfall (Veldhoen et al., 2009; Veldhoen et al., 2011). Concerning SKI2, opposite responses were observed in the western cluster, down-regulation occurring in Cas. whereas it was upregulated in Put.. The homologue of SKI2 in the yeast Saccharomyces cerevisiae, SUV3, is known to be a critical component of mitochondrial degradosome and its downregulation can be linked with the induction of apoptosis through AIP (apoptosis-inducing factor)- and caspase- dependent pathway (Szczesny et al., 2007). Regulation of apoptosis SKI2 might have different functions according to species or tissue, as regarding the results of statistical analyses conducted population per population, over-transcription of the inhibitor apoptosis proteins, IAP, BIRC proteins in Cas. as also observed in Emm. suggested that both induced an active anti-apoptotic response. In Emm., the down-regulation of the transmembrane death receptor FAS and TRAILR was consistent with this hypothesis. In opposition, the decreased transcription of BIRC proteins and TNFα receptor, as well as the up-regulation Caspase7 might reveal induction of apoptosis in Put., presumably through the intrinsic pathway. In Kui., the response was less clear, with on the one hand, a decrease of Fas ligand and Casp7 transcription, which suggest anti-apoptotic response, and on the other hand, down-regulation of apoptosis inhibitor BIRC and up-regulation of TRAILR (Fig. 9, Tab. S2). 178 Several contigs matching with NOTCH behave in opposite ways in this population whereas once again in Cas. and Emm., similar up-regulation were observed. As NOTCH proteins regulate many processes such as cellular interactions, proliferation, cell fate or apoptosis (Theodosiou et al., 2009), its regulation by oxidative stress is not surprising. Metabolism Globally, most DE contigs were implicated in metabolism (Fig. 9, Tab. S5), notably in oxidative phosphorylation, as shown by the up-regulation of several cytochrome oxidases such as COX3, COX1 or CYTB, as well as several NADH-ubiquinone oxidoreductases (e.g., ND1, ND4 and ND5) indicating probable perturbations in the energy metabolism of mitochondria. These effects appeared stronger in Cas. than in other populations. Considering active response against oxidative stress, further genes encoding phase II detoxication enzymes seemed to be sollicitated such as CYP2U ou CYP3A (Cytochrome P450 family) in Cas. and Kui., respectively. Additionally, glutathione metabolism was apparently involved in diquat toxicity pathway in Put. and Kui., as revealed by the upregulation of GST in Put. and the GCLC in Kui.. In Emm. surprisingly, no up-regulation was noted in this pathway, however we can mention the down-regulation of the Xanthine dehydrogenase XDH, which is recognized to play a role in oxidative stress. As Xanthine oxygenase (XO), which is able to generate ROS, can be formed from XDH by reversible sulfhydryl oxidation (Harris et al., 1999), the under-expression measured for XDH may reflect a strategy to decrease intracellular sources of ROS. Taken together, these results are consistent with molecular responses to diquat toxicity. However, it seems difficult from the present statistical analyses, to identify common molecular responses within the two studied types of population, and thus to detect any putative evolutionary influence of historical exposure to pesticide. Another approach could be to not focus on DE contigs only, but compare populations at a larger scale such as pathways integrating all expressed contigs. 179 Potential impact of historical pesticide exposure Figure 8. Hierarchical clustering based on correlation table of subset of contigs matching in signalling pathways apoptosis, ubiquitin metiated proteolysis and the cellular process “Folding, sorting and degradation”. Numbers of contigs is indicated under each corresponding trees. 100% homology between family replicates is indicated by a point after samples names. Colored frames differentiate population types according to the historical pesticide pressure, i.e., low (red) or high (green). When comparing topologies of correlation trees based on contigs implicated in signalling pathways, apoptosis, and ubiquitin mediated proteolysis, or at the level of the cellular processes related to folding, sorting and degradation functions (Fig. 8), the strong divergence of molecular responses among population appears still clear. However, the isolation of one of the two replicates was observed in Put. (C/D-R1), which seem to be mainly due to the absence of reads for several contigs. However, similar patterns were generally observed whatever the subset of contigs, and differences appeared between populations originated from historically exposed or unexposed sites. Indeed we can see that diquat seems to explain more variance than family compositions in population Kui and Cas.. Although we could expect more adapted responses in more exposed populations Put. and Emm., such results could be also interpreted as a lower sensitivity of these populations to diquat exposure. However, it is not possible yet to conclude with statistical confidence for such evolutionary impacts. 180 181 Figure 9 (previous page). Heatmap of DE contigs detected by t-test statistics and ranged by KEGG processes. Only annotated contigs presented (p-val < 0.1) a foldchange > |2| for at least one of the four populations are presented. On the left, foldchange intensity is determined by divided the mean expression of treated samples by the mean expression of the control samples of the relative population. On the right, count data of each sample are divided by the mean count obtained from the two controls of the relative population. Within-population variation and evolutionary potential Initially the aim was to test a QST-FST approach with multivariate G matrix analyses, considering reads count as quantitative traits in the process. Unfortunately, because of the cost of the RNAseq run, we were too limited in the number of population and family replicates. Nevertheless, family variance appeared very high (Fig. 9). The relative proximity between treated-untreated family replicates dataset tends to indicate that the family effect is strong, which is also supported by the fact that inbreeding was significant in all populations. As replicates between conditions were genetically related, we have tested the procedure for data without replication, as proposed in DEseq to analyse DE per replicate, i.e., regardless of the intra-population variability (Anders and Huber, 2010). This procedure is not recommended, as biological replication is the basis for any statistical test, but in this case, we simply wanted to test the method performance in detecting differential expression. Data have not been fully analyzed yet but a preliminary look indicates a higher number of DE contigs than obtained with replication. Thus, taking into account sample relatedness would seem totally relevant for a finer understanding of implicated molecular mechanisms in this kind of toxigenomic approach. Our results emphasize a limit to the definition of biological replication when genetic variation is accounted for. Indeed, biological replication would be relevant in the context of RNAseq, as long as individuals from the same genetic line are used, which on the other hand limits the scope of findings to this genetic line. Despite low replication and the impossibility to conduct appropriate estimations of additive genetic variances, the apparent strong family effect may be interpreted as a high evolutionary potential of the species. Moreover, except for the genetically undifferentiated populations Emm. and Kui., the effect of random genetic drift may be too strong to identify selective patterns induced by the historical pesticide pressure. This is also strengthened by the fact that selection needs large population size to operate (see Keller and Waller, 2002). The comparison of non differentiated populations at neutral markers (such as eastern populations in the present study), may thus be more relevant in this respect. Also, focusing on large populations (as inferred from Ne) might increase the chances of identifying divergent 182 selection patterns. In the respect, no conclusion can be drawn from our study, since Ne-values were very similar across populations. Taking into account the low dispersal ability of L. stagnalis, transcriptomic expression differences observed among populations are a good example of evolutionary processes continuously occurring in nature among allopatric populations and possibly leading in the long term to speciation. The present results are poorly consistent with previous ones based on qPCR and using the laboratory strain ReniLys® (Bouétard et al., 2013). Considering the observed differences of population responses, this discrepancy is not surprising. A strong neutral genetic differentiation between this strain and another laboratory strain from Amsterdam has been previously demonstrated (Besnard et al., 2013). According to the present statistical analysis, HSPs genes were not found to be highly regulated by diquat, whereas up-regulation was expected. It is possible that constitutive HSPs expression might be naturally higher in natural populations than in laboratory cultures, because of multiple sources of environmental stress and cyclic environmental variation. Seasonal regulations of the anti-oxidant system have notably been shown to occur in snail Helix aspersa (Ramos-Vasconcelos et al., 2005). Such effects could thus hamper the comparison of ecotoxicity tests performed on different lines or origins. In the present study, further qPCR analyses are clearly required to confirm observed patterns. Nevertheless, such differences highlight the difficulty to assess the tolerance of a species in regard to a toxicant by studying only one population, be it a laboratory strain or not. To conclude, deeper analyses are needed before assessing with confidence that historical pesticide pressure of a population could be responsible of the transcriptomic differences observed among populations, but the dataset seems powerful and this preliminary investigation is encouraging. Data should be refined by searching possible redundant contigs by multiple alignments within the present dataset as with newly published sequenced. Moreover, investigation of SNPs could reveal interesting polymorphism which might be relevant to explain DE patterns. Research of correlation with the life history traits studied in the precedent chapter should be promising when DE analyses will be updated with more appropriate statistical methods currently developed (Lurin & Balzergue, unpublished). Anyway, present analysis indicates that transcriptomic variations appeared very strong among and within populations suggesting a relatively high evolutionary potential of this species. Therefore, these results constitute another proof that such evolutionary issues are relevant in the context of ecological risk assessment (Breitholtz et al., 2006; Coutellec and Barata, 2011). 183 Acknowledgments The project has been carried out with INRA financial support (EFPA Projet Innovant 2010; AIP Bioressources 2010). AB is granted by the INRA (PhD, Contrat Jeune Scientifique). The authors thank Christophe Plomion, Moumen Bouziane for advices, exchange and insightful comments on the project. The authors thank the INRA U3E staff (INRA, Rennes) and more particularly Maïra Coke for technical assistance, Thierry Caquet, Sabrina Le Cam and Jessica Côte for their help and constructive discussions. The authors finally thank Benoît Heurtault and Gaëlle Méheut (from groovy-banana.com), Elise Petitpas and Arnaud Giusti for their hospitality and logistic support during the sampling period. 184 Table S1. List of gene hits (identity > 50%) in the “Enzymes” and “Cytochrome P450” categories matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene. Cas. KEGG category [Br:ko00199] Cytochrome P450 CYP2 family CYP3 family [Br:ko01000] Enzymes Oxidoreductases Acting on the CH-OH group of donors Oxygenases acting on single donors with O2 Acting on paired donors with incorporation of O2 Acting on the CH-NH2 group of donors Acting on CH or CH2 groups Acting on NADH or NADPH Acting on a heme group of donors Transferases Glycosyltransferases Transferring alkyl or aryl groups, other than methyl groups Transferring phosphorus-containing groups Transferring sulfur-containing groups Hydrolases Acting on ester bonds Glycosylases Acting on peptide bonds (peptidases) Acting on acid anhydrides gene code D<C K07422 K07424 K00088 K08683 K13370 K00461 K00502 K07424 K00280 K00106 K00344 K03878 K03881 K03883 K02256 K00699 K03766 K07968 K10799 K15261 K00799 K06125 K00889 K02327 K02677 K04427 K05099 K08892 K04742 K00412 K01057 K01104 K01175 K06776 K01350 K07188 K08624 K14073 K10147 K05970 K01176 K01181 K01229 K05349 K12047 K01301 K01349 K02857 K04397 K08621 K09614 K13050 K13289 K12599 K15255 Put. D>C D<C Kui. D>C D<C Emm. D>C D<C D>C CYP2U CYP3A guaB HSD17B10 HSD17B8 ALOX5a/b ALOX5c TPH1/2 CYP3A LOXL2/3/4 XDHa/b qor a ND1b ND4 ND5 qorb ND1a COX1a/b/c UGT B3GNT5 B4GALT3 TNKS PARPa PARP b /c /d GST COQ2 PIP5K POLD1 CPKC TAK1 MET FRK CHST12 CYTB a /b PGLS E3.1.3.48b E3.1.3.48a E3.1.-.PTPRK PTPRK PRTN3 HSL ADAMTS9 PNLIPa PNLIPb PNLIPc PPM1D SIAE amyA xynA LCT b bglXa MGAM LCTa bglXc bglXb E3.4.17.21 FURIN RHBDL CASP7b CORINa CASP7a/c ADAMTS6a ADAMTS6b CORINb PCSK9 CTSA SKI2b SKI2a PIF1 Lyases Carbon-nitrogen lyases Phosphorus-oxygen lyases Isomerases cis-trans-Isomerases Intramolecular oxidoreductases Ligases Forming carbon-nitrogen bonds Forming phosphoric-ester bonds K01754 K08042 K12323 K12735 K12663 tdcB ADCY2 ANPRA PPIL4 ECH1 K10624 K10645 K11204 K01974 RBBP6 MIB GCLC rtcA 185 Table S2. List of gene hits (identity > 50%) in the “Cellular processes category” matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene. Cas. KEGG processes KEGG pathway [Path:ko04520] Adherens junction gene code D<C Put. D>C D<C Kui. D>C K04393 MET K02677 CPKC ACTB/G1 K05692 K03900 VWF Cell communication K04393 CDC42 K04725 XIAP,BIRC4 K05099 MET K05635 K06236 LAMC1 COL1AS K06252 [Path:ko04540] [Path:ko04530] Gap junction Tight junction TN K16060 BIRC2/3e K02677 CPKC K07374 TUBAb/c K07375 TUBB K04420 MAP3K2 a K08042 ADCY2 K02677 BIRC2/3b/d TUBAa MAP3K2 c/d MAP3K2 b CPKC CDC42 K05692 ACTB/G1 K10352 Apoptosis BIRC2/3e BIRC2/3a /c K04393 [Path:ko04210] MYHa MYH b /c K03158 TNFR1a/b K04389 FASLa/b/c K04390 FAS K04397 CASP7b CASP7a/c K04722 [Path:ko04111] Cell cycle TRAILR K04725 XIAP,BIRC4 K16060 BIRC2/3 e BIRC2/3b/d K16061 BIRC7/8i BIRC7/8f/g/h BIRC2/3e BIRC2/3a /c SMC2 K12575 Meiosis K12575 [Path:ko04114] Oocyte meiosis p53 signaling pathway K08042 [Path:ko04115] TRAILR K06674 [Path:ko04113] SLK19 SLK19 ADCY2 K04390 FAS Cell motility K10147 [Path:ko04810] Regulation of actin cytoskeleton K00889 PPM1D PIP5K ACTB/G1 K05692 K04393 [Path:ko04144] Endocytosis K00889 CDC42 PIP5K Transport & catabolism K03283 HSPA1/8 K04393 CDC42 K05099 MET K12482 RABIP4 K15053 [Path:ko04142] Lysosome K13289 [Path:ko04146] Peroxisome K00106 K12663 [Path:ko04145] Phagosome D>C TAK1 K05099 Cell growth & death D<C ACTB/G1 K04427 Focal adhesion D>C CDC42 K05692 [Path:ko04510] D<C Emm. CHMP7 CTSA XDHa/b ECH1 K06560 MRC K05692 ACTB/G1 K06563 CD209 K07374 TUBAb/c K07375 TUBB TUBAa 186 HSPA1/8 Table S3. List of gene hits (identity > 50%) in the “Environmental Information Processing” category matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene. Cas. Membrane transport KEGG KEGG processes pathway D<C D>C D<C Kui. D>C [Path:ko02010] ABC transporters [Br:ko02001] Solute carrier family [Br:ko02000] [Path:ko04020] [Path:ko04020] [Path:ko04012] [Path:ko04340] [Path:ko04066] [Path:ko04390] [Path:ko04010] Signal transduction gene code Put. [Path:ko04150] [Path:ko04064] [Path:ko04330] [Path:ko04070] [Path:ko04151] [Path:ko04350] [Path:ko04370] [Path:ko04310] K05644 K05038 K14611 K14687 Transporters K05644 K08175 Two-component system K00412 Calcium sig. path. K02677 K08042 ErbB sig. path. K02677 Hedgehog sig. path. K06233 HIF-1 sig. path. K02677 Hippo sig. path. K16507 K05692 MAPK sig. path. K02677 K04420 K03158 K03283 K04389 K04390 K04393 K04427 K09291 mTOR sig. path. K02677 K07204 NF-kappa B sig. path. K03158 K03161 K04427 K04725 K16060 Notch sig. path. K02599 K06058 Phosphatidylinositol sig. K00889 K02677 path. system PI3K-Akt sig. path. K03900 K04079 K04389 K05099 K05635 K06236 K06252 K07204 TGF-beta sig. path. K04658 VEGF sig. path. K02677 K04393 Wnt sig. path. K02677 K04427 K03068 D<C Emm. D>C D<C ABCA4 D>C ABCA4 SLC6A5S SLC23A1/2 SLC31A2 ABCA4 ABCA4 NAGLT1 CYTB a/b CPKC ADCY2 CPKC LRP2a/b/c CPKC PCDH16/23 ACTB/G1 CPKC MAP3K2 a MAP3K2 c/d MAP3K2 b TNFR1a/b HSPA1/8 HSPA1/8 FASLa/b/c FAS CDC42 TAK1 TPRa TPRb CPKC RAPTOR TNFR1a/b TNFSF5 TAK1 XIAP,BIRC4 BIRC2/3 e NOTCHc BIRC2/3a/c NOTCHb/d DTX BIRC2/3b/d NOTCH f NOTCHa/e PIP5K CPKC VWF HSP90A FASLa/b/c MET LAMC1 COL1AS TN RAPTOR NOG CPKC CDC42 CPKC TAK1 LRP5/6 [Path:ko04514] 187 Table S3. “Environmental Information Processing” category. (continued) Cas. KEGG KEGG processes pathway gene code D<C Put. D>C [Path:ko04514] Cell adhesion molecules K03161 K06550 (CAMs) [Br:ko04516] Signaling molecules & interaction [Br:ko04090] [Br:ko04050] [Path:ko04060] K06759 Cell adhesion molecules K05635 K05637 & their ligands K06240 Cellular Antigen K02599 K03158 K04389 K04390 K04550 K04722 K05099 K06550 K06560 K06563 K06702 Cytokine receptors K05099 Cytokine-cytokine receptor interaction D>C D<C Emm. D>C D<C D>C TNFSF5 L1CAM CNTN1 NOTCHc NOTCHb/d LAMC1 LAMA1-2 LAMA3-5 NOTCHa/e NOTCH f CD120a/b CD178a/b/c CD95 CD91b CD91c CD91a CD261-2-3-4 CD261-2-3-4 MET CD171 CD206-208 CD209-99 CDw93 MET TNFR1a/b K03158 K03161 K04389 K04390 K04722 K05099 [Path:ko04512] ECM-receptor K03900 K05635 interaction K06236 K06252 [Br:ko01020] Enzyme-linked receptors K05099 [Br:ko04091] Glycan Binding Proteins K06560 K06563 [Br:ko04031] GTP-binding proteins K04393 K07912 [Br:ko04040] Ion Channels K04825 K04914 K05038 K05185 K05185 [Path:ko04080] Neuroactive ligand- D<C Kui. TNFSF5 FASLa/b/c TRAILR FAS TRAILR MET VWF LAMC1 COL1AS TN MET MRC CD209-99 CDC42 RAB24 SCNN1B KCNK3 SLC6A5S GABRE GABRE receptor interaction 188 Table S4. List of gene hits (identity > 50%) in the “Genetic Information Processing” category matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene. Cas. KEGG KEGG processes pathway gene code D<C Put. D>C D<C Kui. D>C D<C Emm. D>C Transcription Replication & repair Folding, sorting & degradation [Path:ko04141] Protein processing in endoplasmic reticulum [Path:ko03018] [Path:ko04120] [Br:ko03110] [Br:ko04121] [Path:ko03410] [Br:ko03400] [Path:ko03030] [Path:ko03440] [Path:ko03430] [Path:ko03420] [Br:ko03041] [Path:ko03040] [Br:ko03000] Translation [Path:ko03010] [Br:ko03011] [Path:ko03013] [Path:ko00970] [Br:ko03016] K03283 K04079 HSP90A K14000 RRBP1 K09542 CRYAB RNA degradation K12599 SKI2a XIAP,BIRC4 Ubiquitin mediated K04725 BIRC2/3b/d K16060 BIRC2/3 e proteolysis K16061 BIRC7/8i BIRC7/8f/g/h LCTa K01229 Chaperones & folding K01349 FURIN catalysts K03283 K09542 CRYAB K03900 K04079 HSP90A K12172 K13289 Ubiquitin system K10268 K10272 FBXL6 K10314 K10461 KLHL24/35a K10470 K10473 K10314 K06058 Base excision repair K02327 DNA repairs & recombinationK02327 proteins DNA replication K02327 K15255 PIF1 Homologous recombination K02327 Mismatch repair K02327 Nucleotide excision repair K02327 Spliceosome K03283 K12735 PPIL4 K13122 FRG1 K03283 Transcription factors K09206 K09228 K09250 CNBP K09266 SRY K09431 ETV1 Ribosome K02872 K02949 K02990 RP-S6 Ribosome K02872 K02949 K02927 K02990 RP-S6 RNA transport K09291 K12172 Aminoacyl-tRNA biosynthesisK01867 WARS a/b Transfer RNA biogenesis K15433 RLLM1 189 D<C D>C HSPA1/8 HSPA1/8 SKI2b BIRC2/3e BIRC2/3a/c LCT b HSPA1/8 HSPA1/8 VWF RanBP2 CTSA FBXL2/20 FBXO39 KBTBD2a KLHL24/35 b KBTBD2b KBTBD2 b KBTBD5/10 FBXO39 DTX POLD1 POLD1 POLD1 POLD1 POLD1 POLD1 HSPA1/8 HSPA1/8 HSPA1/8 HSPA1/8 KLF5 KRABa/c KRABb RP-L13Ae RP-S11eb/c RP-S11ea RP-S11eb/c RP-S11ea RP-L13Ae RP-L40e a/b TPRa TPRb RanBP2 WARS c Table S5. List of gene hits (identity > 50%) in the “Metabolism” category matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene. Cas. KEGG pathway KEGG processes Amino acid metabolism Biosynthesis of other 2 metabolites nd Carbohydrate metabolism [Path:ko00260] [Path:ko00380] [Path:ko00290] [Path:ko00280] Glycan biosynthesis & metabolism [Path:ko00940] Phenylpropanoid biosynthesis [Path:ko00053] Ascorbate & aldarate metabolism [Path:ko00052] Galactose metabolism K05349 K00699 K01229 K12047 K00889 K00699 K01057 K00699 K01176 K05349 K12047 K01179 K01027 K02256 K02262 K03881 K00412 K03878 K03883 K00412 K04742 Inositol phosphate metabolism Pentose & glucuronate interconversions Pentose phosphate path. Starch & sucrose metabolism [Path:ko00650] Butanoate metabolism [Path:ko00190] Oxidative phosphorylation [Path:ko00910] Nitrogen metabolism [Path:ko00920] Sulfur metabolism Glycosaminoglycan biosynthesis: [Path:ko00532] - Chondroitin sulfate / dermatan sulfate [Path:ko00533] - Keratan sulfate [Path:ko00601] Glycosphingolipid biosynthesis: lacto & neolacto series [Br:ko00536] [Path:ko00510] [Path:ko00514] [Path:ko00513] [Path:ko00072] [Path:ko00590] [Path:ko00561] [Path:ko00564] [Path:ko00565] [Path:ko00591] [Path:ko00140] [Path:ko00130] Ubiquinone & other terpenoid-quinone biosynthesis Metabolism of other amino [Path:ko00460] Cyanoamino acid metabolism acids [Path:ko00480] Glutathione metabolism [Br:ko01006] Prenyltransferases [Path:ko00230] Purine metabolism [Path:ko00240] Pyrimidine metabolism Xenobiotics biodegradation [Path:ko00627] Aminobenzoate degradation & metabolism [Path:ko00982] Drug metabolism - cytochrome P450 [Path:ko00983] Drug metabolism - other enzymes [Path:ko00980] Metabolism of xenobiotics by cytochrome P450 Put. D>C D<C D>C D<C TPH1/2 HSD17B10 OXCT XDHa/b bglXc bglXa LCTa LCT b MGAM bglXb UGT PIP5K UGT PGLS UGT amyA bglXa MGAM E3.2.1.4 OXCT bglXc bglXb COX1a /b/c COX3 a/b ND4 CYTB a/b ND1b ND5 ND1a CYTB a/b CHST12 B4GALT3 B3GNT5 B4GALT3 FUT1/2 UGT B3GNT5 B4GALT3 TN B4GALT3 B4GALT3 B4GALT3 OXCT ALOX5a/b CYP2U PNLIPc ALOX5c PNLIPb PLA2G a PLA2G b /c/d/e PLA2G a PLA2G b /c/d/e CYP3A PLA2G a PLA2G b /c/d/e UGT CYP3A HSD17B8 UGT UGT CYP3A COQ2 K05349 K00799 K11204 190 D>C Emm. tdcB K00699 K00699 K07424 K06125 K06125 K00088 K00106 K02327 K08042 K12323 K02327 K07424 K00699 K00799 K07424 K00088 K00106 K00699 K07424 K00699 K00799 K07424 D<C Kui. tdcB K04742 CHST12 K07968 K03766 K07968 K00718 Glycosyltransferase K00699 K03766 K04742 CHST12 K07968 Heparan sulfate / heparin binding proteins K06236 COL1AS K06252 N-Glycan biosynthesis K07968 Other types of O-glycan biosynthesis K07968 Various types of N-glycan biosynthesis K07968 Synthesis and degradation of ketone bodies K01027 Arachidonic acid metabolism K00461 K07422 Glycerolipid metabolism K14073 PNLIPa Glycerophospholipid metabolism K01047 Ether lipid metabolism K01047 Linoleic acid metabolism K07424 K01047 Steroid hormone biosynthesis K00699 K07424 K13370 Metabolism of cofactors & [Path:ko00860] Porphyrin metabolism vitamins [Path:ko00830] Retinol metabolism Metabolism of terpenoids & polyketides Nucleotide metabolism D<C K01754 K00502 K01754 K08683 K01027 K00106 [Br:ko01003] Lipid metabolism Glycine, serine & threonine metabolism Tryptophan metabolism Valine, leucine & isoleucine biosynthesis Valine, leucine & isoleucine degradation [Path:ko00232] Caffeine metabolism [Path:ko00562] [Path:ko00040] [Path:ko00030] [Path:ko00500] Energy metabolism gene code bglXc bglXa bglXb GST GCLC COQ2 guaB XDHa/b POLD1 ADCY2 ANPRA POLD1 CYP3A UGT GST CYP3A guaB XDHa/b UGT CYP3A UGT GST CYP3A D>C Table S6. List of gene hits (identity > 50%) in the “Organismal system” category matching exclusively with contigs for which the Fold-Change is either less than -2 or higher than +2 between diquat and control conditions (D < C ; D > C) according to a t-test, and/or considered as DE by DEseq analysis (p < 0.1). Genes in italics were detected by DEseq. Genes in bold were detected by both methods. Index letters indicate different contigs matching with the same reference gene. Cas. KEGG processes KEGG pathway gene code D<C Put. D>C D<C Circulatory system [Path:ko04260] Cardiac muscle contraction [Path:ko04270] Development [Path:ko04360] [Path:ko04320] [Path:ko04380] [Path:ko04976] [Path:ko04973] [Path:ko04975] Digestive system [Path:ko04971] [Path:ko04978] [Path:ko04972] [Path:ko04974] [Path:ko04970] [Path:ko04977] [Path:ko04672 ] K02256 K00412 K02262 Vascular smooth muscle contraction K02677 K01047 K08042 K12323 Axon guidance K04393 K05099 K06550 K06820 K06841 Dorso-ventral axis formation K02599 K02184 K04427 Osteoclast differentiation K03158 Bile secretion K08042 Carbohydrate digestion & absorption K01176 K01229 K12047 Fat digestion & absorption K14073 K01047 Gastric acid secretion K02677 K08042 Mineral absorption K14735 Pancreatic secretion K02677 K01047 K08042 K14073 Protein digestion & absorption K06236 K08132 K16628 Salivary secretion K02677 K08042 Vitamin digestion & absorption K14073 K14616 Intestinal immune network for IgA K03161 Endocrine system production [Path:ko04920] Adipocytokine sig. path. [Path:ko04912] GnRH sig. path. [Path:ko04910] Insulin sig. path. [Path:ko04916] Melanogenesis [Path:ko03320] PPAR sig. path. [Path:ko04914] Progesterone-mediated oocyte maturation [Path:ko04614] Renin-angiotensin system Kui. D>C D<C Emm. D>C D<C D >C COX1a/b/c CYTB a/b COX3 a/b CPKC PLA2G a PLA2G b/c/d /e ADCY2 ANPRA CDC42 MET L1CAM PLXNA NOTCH c SEMA5 NOTCHa /e NOTCHb /d NOTCH f FMN2 TNFR1 TAK1 ADCY2 amyA LCTa PNLIP a PNLIPc LCT b MGAM PNLIPb PLA2G a PLA2G b/c/d /e CPKC ADCY2 HEPH CPKC PLA2G a PLA2G b/c/d /e ADCY2 PNLIP a COL1AS PNLIPb PNLIPc COL12Ab COL12Aa COL7A CPKC ADCY2 PNLIP a PNLIPc CUBNa PNLIPb CUBNb TNFSF5 K03158 K04420 MAP3K2 a K04393 K08042 ADCY2 K07188 K07204 K02677 K08042 ADCY2 K08770 K04079 HSP90A K08042 ADCY2 K13289 K01283 191 TNFR1a/b MAP3K2 c/d MAP3K2 b CDC42 HSL RAPTOR CPKC UBC a/b CTSA ACE Chapitre VI - Discussion générale 192 Dans cette thèse, nous nous sommes intéressés au potentiel adaptatif de L. stagnalis vis-à-vis du stress provoqué par les activités anthropiques, avec un intérêt particulier pour les impacts évolutifs liés à l’usage des pesticides. Dans les paysages agricoles, les milieux lentiques occupés par cette espèce sont susceptibles d’être contaminés de façon récurrente par les produits phytosanitaires (Brown & van Beinum, 2009). La question initiale de ce projet était de savoir si ce type de perturbations répétées pouvait entraîner des processus microévolutifs de différenciation adaptative au sein des populations naturelles chez une espèce non cible. D’une façon plus générale, nous avons cherché à mieux comprendre les bases génétiques de la réponse aux changements environnementaux au sein des populations naturelles. La question de l’impact évolutif des polluants sur les écosystèmes est d’intérêt croissant en écotoxicologie et représente un défi majeur pour les futures procédures d’évaluation du risque écologique. Le travail réalisé présente donc un intérêt à la fois en termes de résultats de recherche originale (documentation d’effets) et d’application à l’évaluation environnementale. Le sujet était articulé autour de quatre questions majeures : Q1 Existe-t-il une divergence génétique phénotypique et moléculaire entre populations naturelles génétiquement différenciées du point de vue neutre ? Q2 L’exposition historique aux stress d’origine anthropique peut-elle entraîner une divergence adaptative des populations (sélection divergente sur les traits d’histoire de vie) ? Q3 A l’échelle moléculaire, observe-t-on une variation inter-population dans la réponse au stress oxydant généré par le diquat ? Si tel est le cas, cette variation résulte-t-elle des pressions de sélection d’origine anthropique auxquelles sont soumises les populations impliquées ? Q4 Quel est le potentiel adaptatif de ces populations naturelles vis-à-vis du stress d’origine anthropique en général ? 193 Les résultats obtenus dans cette étude répondent à ces différentes questions en mettant en évidence : Un effet toxique du diquat sur les réponses moléculaires produites par l’hémolymphe et la glande digestive (approche toxicologique classique) Une forte structure génétique des populations de L. stagnalis dans le Nord-Ouest de l’Europe Une forte variabilité inter-population des traits quantitatifs, à l’échelle phénotypique (traits d’histoire de vie) et moléculaire (expression génique) Un impact évolutif potentiel des pressions d’origine anthropique sur la fitness et les réponses moléculaires au stress oxydatif Le type d’habitat comme principal facteur de divergence adaptative et neutre (échelle phénotypique) Une forte variabilité intra-population des traits quantitatifs à l’échelle phénotypique (traits d’histoire de vie) et moléculaire (expression génique) La nécessité de prendre en compte de tels facteurs génétiques dans les procédures d’évaluation du risque écologique Effet toxique du diquat sur les réponses moléculaires de l’hémolymphe et de la glande digestive Dans une première approche toxicologique classique, nous avons testé la pertinence d’une molécule toxique modèle, l’herbicide diquat, utilisée comme xénobiotique générateur de stress oxydant sur notre modèle biologique, L. stagnalis. Sur la base des ressources génétiques initialement disponibles chez cette espèce, ont été développés des marqueurs transcriptionnels pour quantifier par PCR quantitative, l’impact de l’herbicide sur l’expression des gènes codant pour un certain nombre de gènes candidats [catalase (cat), une superoxyde dismutase cytosolique (Cu / Zn-sod), une glutathion peroxydase sélénium-dépendante (gpx), une glutathion réductase (gred), le récepteur X des rétinoïdes (rxr), deux protéines chaperons (hsp40 et hsp70)], ainsi que pour la cortactine (cor) et les sous-unités ribosomiques r18S et r28s. L’exploration des réponses moléculaires précoces (5, 24 et 48 heures) d’individus exposés à trois concentrations de diquat considérées comme réalistes du point de vue des doses environnementales (22,2 ; 44,4 et 222,2 µg/L) a été réalisée sur deux tissus, 194 l’hémolymphe et la glande digestive. Les activités enzymatiques de Cat, SOD, Gpx, Gred et GST ont également été mesurées dans les tissus hépatiques. Globalement, les résultats obtenus sont cohérents avec l’observation antérieure d’une induction massive de processus apoptotiques dans les hémocytes après 48 heures d’exposition au deux plus fortes concentrations (sous-expression de la plupart des gènes) tandis que la plus faible concentration entraîne une surexpression significative de cor, hsp40, rxr, et sod après 24 heures. Dans la glande digestive (GD), nous avons constaté une forte réactivité vis-à-vis du stress oxydant. En effet, dès 5 heures d’exposition, la sur-expression quasi-générale des gènes étudiés dans les hépatocytes suggère une perturbation de l’équilibre homéostatique induite par la génération d’espèces réactives de l'oxygène (ROS), avant un retour à un niveau d’expression constitutive après 24 et 48 heures. De plus, les résultats indiquent un effet posttranscriptionnel du diquat, qui peut concerner la traduction, le repliement protéique ou l’activation des domaines catalytiques. Dans un contexte d’utilisation de ces réponses comme biomarqueur, le maintien des activités enzymatiques à un niveau constitutif en présence de diquat montre que l’absence de réponse significative au niveau fonctionnel (activité enzymatique) peut masquer des effets toxiques plus en amont, pouvant ainsi conduire à une sous-estimation des effets. A notre connaissance, cette étude est la première démontrant au niveau moléculaire, la toxicité du diquat chez un gastéropode d’eau douce, induisant des effets compatibles avec ceux observés sur des modèles murins dans le cadre d’étude du stress oxydant (Crabtree et al., 1977; Smith et al., 1985; Gallagher et al., 1995; Anton et al., 2002; Rogers et al., 2006). Sur la base de ces résultats, nous avons choisi les conditions expérimentales permettant d’obtenir les réponses les plus contrastées (i.e., 5 heures, 222.2 µg/L), afin de générer par pyroséquençage 454 des ressources transcriptomiques (141999 contigs) nécessaires à de futures analyses d’expression différentielle à l’échelle globale (RNAseq). Une analyse exploratoire conduite à cette occasion a suggèré une grande diversité d’effets moléculaires pour le diquat, outre l’effet spécifiquement lié au stress oxydant. Sur la base de ces résultats, cinq nouveaux marqueurs qPCR permettant d’étudier la transcription de gènes impliqués dans la réponse au stress (hsp 90, gst), dans les processus apoptotiques (endoG, dj1) la chaîne respiratoire (cytC) ont été mis au point (Barbu, 2011). L’herbicide diquat s’est donc avéré un modèle pertinent pour l’étude ultérieure de l’impact évolutif du stress d’origine anthropique, de par ses effets oxydatifs sub-létaux, représentatifs de la toxicité d’un grand nombre de substances et éléments présents dans les 195 milieux aquatiques, tels que pesticides, métaux, ou encore produits pharmaceutiques (Scandalios, 2005; Valavanidis et al., 2006). Les tests classiques d’écotoxicité sont généralement menés sur une seule lignée, souche ou origine génétique, pour limiter la variation intra-traitement, et de fait, négligent la variabilité génétique intra-spécifique. Pourtant, la variation génétique est une réalité biologique, et l’existence de variabilité inter et intra-populationnelle dans la réponse des espèces à différents stress environnementaux et anthropiques a été mise en évidence chez de nombreuses espèces, e.g., d’amphibiens (Bridges & Semlitsch, 2000; Semlitsch et al., 2000; Matson et al., 2006; Hangartner et al., 2012), de mollusques (Gnatyshyna et al., 2011; Veldhoen et al., 2011), de crustacés (Brausch & Smith, 2009; Coors et al., 2009; Jansen et al., 2011), d’arthropodes (van Straalen and Roelofs, 2011; Costa et al., 2012), ou encore de plantes (Keane et al., 2005). Dans le contexte d’écotoxicologie évolutive du travail présenté, l’herbicide diquat a donc été utilisé pour comparer les réponses moléculaires au stress de plusieurs populations naturelles échantillonnées dans des milieux contrastés en terme de pression anthropique chronique. Structure génétique des populations naturelles de L. stagnalis dans le Nord-Ouest de l’Europe L’étude de l’impact évolutif des stress d’origine anthropique sur les populations naturelles de L. stagnalis a porté sur 14 populations échantillonnées dans le nord de l’Europe, entre Bruxelles, Amsterdam et Hambourg, en juillet 2011. Les analyses de structure basées sur le génotypage à 12 loci de 355 individus ont mis en évidence (i) une consanguinité généralement élevée des populations, des effectifs efficaces homogènes, une variation des systèmes de reproduction allant de l’absence d’autofécondation à des taux intermédiaires, et (ii) la différenciation de deux groupes principaux (Est et Ouest) discriminant les quatre populations allemandes des autres, en cohérence avec un modèle d’isolement par la distance, et donc d’une structure neutre. Globalement, les populations sont fortement différenciées (FST global = 0.282). Etant donné l’écologie de l’espèce, sa capacité de dispersion limitée et les dimensions de l’aire d’échantillonnage, de telles différences ne sont pas étonnantes. Des valeurs de FST par paires particulièrement élevées ont été constatées entre la plupart des populations d’étangs étudiées. Ce résultat est compatible avec l’absence de flux de gène dans ce type d’habitat fermé, comme déjà observé chez d’autres gastéropodes d’eau douce, tels que Physa acuta (Escobar et al., 2008). 196 Compte tenu de la forte différenciation génétique et de la faible capacité de dispersion de L. stagnalis, l’hypothèse d’adaptation locale des populations étudiées est possible. Nous avons ainsi cherché à déterminer à cette échelle le niveau de variation génétique de traits liés à la fitness et à la sensibilité au stress oxydant, et à évaluer l’impact évolutif potentiel lié aux pressions historiques d’exposition au stress d’origine anthropique. Présence d’une forte variabilité inter-populationnelle des traits quantitatifs à l’échelle phénotypique (traits d’histoire de vie) et moléculaire (transcriptome) L’étude en common garden des traits d’histoire de vie, mesurés sur la descendance des individus échantillonnés en milieu naturel a permis de constater de fortes disparités entre populations, ceci pour la plupart des traits étudiés, que ceux-ci soient relatifs à la croissance ou à la fécondité. L’influence de la localisation géographique (Est/Ouest, déterminée par STRUCTURE) semble n’avoir que peu d’influence sur les traits étudiés, excepté pour deux traits liés à la taille à l’éclosion (taille mesurée et paramètre du modèle de Gompertz). L’hypothèse de divergence génétique adaptative testée grâce à l’approche QST-FST, a mis en évidence des processus de sélection divergente entre les populations étudiées (QST > FST) pour plusieurs traits, tels que la taille à l’âge adulte, l’aptitude à pondre, le délai d’oviposition, ou encore le nombre de pontes produites en 15 jours. Les traits relatifs à la fécondité et à la taille des pontes ne semblent pas soumis à la sélection divergente malgré une influence significative de la population (GLMM, comparaison de modèles successifs, avec et sans le facteur aléatoire « population »). Le test a estimé que la variance inter-population ne diffère pas des valeurs attendues sous l’hypothèse neutre, ce qui indique un effet exclusif de la dérive génétique (QST = FST). Des travaux réalisés sur les amphibiens ont mis en évidence une variation des valeurs de QST en fonction des conditions environnementales, suggérant que des conditions stressantes pouvaient faciliter la mise en évidence de patrons de sélection divergente entre populations (Palo et al., 2003; Hangartner et al., 2012). Dans le cadre de la thèse, l’exploration des réponses transcriptomiques en condition de stress oxydant à partir d’un sous-ensemble de quatre populations nous a permis dans une certaine mesure de tester cette hypothèse. Bien que l’approche QST-FST initialement prévue à l’échelle transcriptomique n’ait pu être réalisée en raison du nombre limité de réplicats et de populations étudiées, une forte différenciation de la réponse transcriptomique inter-populations a été mise en évidence, aussi bien en condition stressante qu’en condition témoin. De plus, une forte analogie entre les 197 niveaux de différenciation génétique neutre et les différences de réponse transcriptomique a été constatée. A notre connaissance, ce type de concordance n’a encore jamais été révélée à une telle échelle. Les observations mettent en exergue des processus évolutifs propres à chaque population. L’analyse préliminaire de l’expression différentielle entre conditions expérimentales a en effet confirmé que l’origine de la population expliquait une bien plus grande part de variance que le toxique lui-même. Le stress oxydant étant à la fois un processus moléculaire naturel et un état pouvant résulter de l’exposition à des sources variées de stress environnemental, il n’est probablement pas étonnant d’observer une si grande divergence entre populations. Il est vraisemblable que des réponses plus convergentes aient pu être observées dans le cas d’une molécule dont le mode d’action est plus ciblé, bien que d’un point de vue adaptatif, les réponses produites par des populations isolées sont le reflet de processus évolutifs indépendants propres à chaque population (cf. Morgan et al. 2007). Absence de relation entre le système de reproduction et les facteurs environnementaux testés Certains traits mesurés sur les G1, comme l’aptitude à se reproduire, la fécondité estimée, le taux d’éclosion des pontes, montrent une corrélation négative avec le degré de consanguinité des populations. Ce résultat est cohérent avec ceux précédemment obtenus dans un ensemble de populations différentes de la même espèce (Puurtinen et al., 2004b), et supporte l’hypothèse d’existence de dépression de consanguinité dans les populations naturelles. Le système de reproduction de L. stagnalis est classé dans les « allofécondants préférentiels » (Escobar et al., 2011), et ce, en dépit de la faible dépression de consanguinité observée expérimentalement, entre descendance d’auto- vs allo-fécondation (Coutellec & Lagadic, 2006 ; Puurtinen et al., 2007 ; Coutellec & Caquet, 2011). Dans la présente étude, l’analyse du système de reproduction basée sur la distribution de l’hétérozygotie multi-locus au sein de la population (RMES), ne montre pas de relation particulière entre d’une part le taux d’autofécondation et la consanguinité globale, et d’autre part le taux d’autofécondation et la valeur des traits d’histoire de vie mesurés. De plus, ce taux n’est affecté par aucun des facteurs environnementaux testés, même si on peut noter que deux des trois valeurs de taux d’autofécondation significatifs sont observés en étang, où l’on observe également une plus grande divergence génétique (arbre basé sur les valeurs de FST). Il semble donc que dans les populations étudiées, la consanguinité biparentale (fécondation croisée entre apparentés) joue un rôle important dans la structure globale, et contribue majoritairement au fardeau de mutations délétères dans les populations. 198 Une hypothèse connexe à ce travail était relative à l’influence du système de reproduction dans la réponse au stress environnemental, et nous nous attendions en particulier à une relation positive entre le taux d’autofécondation des populations et le niveau de stress environnemental caractérisé, pour des raisons liées à l’assurance de reproduction (chances réduites de rencontre de partenaire, ou de partenaire en état de s’accoupler) et d’allocation énergétique en condition de stress. Sur la base du jeu de données et des conditions environnementales choisies, l’étude n’a pas permis de mettre en évidence une telle relation. Il est probable que cet échec soit lié à la faible puissance du plan statistique, et qu’un échantillonnage plus conséquent soit nécessaire (en nombre de populations par type de milieu) pour approfondir cette question. Effets potentiels des pressions historiques d’origine anthropique sur les réponses moléculaires au stress oxydatif et la fitness des populations Les deux approches utilisées dans cette thèse pour évaluer l’impact évolutif des pressions anthropiques sur les populations de L. stagnalis ont mis en évidence des effets au niveau de la fitness (baisse de survie à l’éclosion, aptitude accrue à se reproduire), ainsi que des résultats préliminaires compatibles avec un processus de sélection divergente au niveau transcriptomique. D’après l’étude des traits d’histoire de vie mesurés en common garden, il semblerait en effet que les perturbations répétées des milieux aquatiques par les polluants puissent avoir un impact évolutif diminuant la survie à l’éclosion. Dans ces populations, il est possible qu’une fécondité accrue ait été sélectionnée en réponse à la survie précoce réduite. Concernant l’étude du transcriptome en condition de stress oxydant, les analyses qualitatives de classification hiérarchique basées sur les corrélations relatives aux contigs impliqués dans l’apoptose, la protéolyse impliquant le système de l’ubiquitine, ou à plus large échelle, les processus de repliement, de transport et de dégradation protéique, suggèrent une plus faible sensibilité des populations exposées aux pesticides. Cependant, l’analyse statistique de l’expression différentielle n’a pas permis pour le moment de faire ressortir des réponses communes aux deux populations. L’effet du diquat s’exprime principalement via son interaction avec le facteur population (542 contigs), ce qui suggère une réponse différente pour chacune des quatre populations. Seuls neufs contigs semblent influencés par le traitement quelle que soit la population (e.g., dont deux contigs annotés, SKI2, ABCA4), bien que l’analyse indépendante de ces transcrits par population suggère un impact différentiel. 199 Bien que préliminaires, ces résultats démontrent toutefois une forte base génétique de la réponse de L. stagnalis au stress oxydant induit par le diquat. L’analyse statistique des données d’expression différentielle fait l’objet d’un développement actuellement important. Ainsi, parmi les méthodes disponibles, DEseq nous est apparue comme la plus intéressante, car elle se base sur une distribution binomiale négative, adaptée aux données de comptage présentant une très forte dispersion (caractéristique des données de RNAseq). Cependant, une étude comparative (microarray, qPCR, RNAseq) récemment menée chez un modèle éprouvé (A. thaliana) a montré les limites de cette méthode, et son incapacité à détecter l’expression différentielle pour une certaine catégorie de contigs. Une amélioration de la méthode DEseq est en cours de développement (Lurin and Balzergue), et devrait permettre d’obtenir des résultats statistiquement plus fiables, nécessaire à l’identification des voies moléculaires réellement sollicitées par le diquat et de leur caractère commun au niveau de l’espèce. Cependant, compte tenu de l’hétérogénéité des pressions environnementales entre les différentes localités, i.e., la diversité des polluants, de leur toxicité, mode d’action et effets synergiques potentiels, il est peu probable que l’évolution adaptative de tolérance aux stress anthropiques résulte de sélection pour les mêmes gènes. D’après les analyses préliminaires, la diversité des mécanismes de réponse au stress induit par le diquat semble aller dans le sens de cette hypothèse. Il apparait en effet plus pertinent de réfléchir à l’échelle des voies moléculaires sollicitées dans ces réponses. Une analyse des réseaux de gènes impliqués permettrait d’approfondir ces questions, moyennant une meilleure connaissance du génome de l’espèce (Horvath, 2011). Au vue de la diversité des réponses produites, les processus micro-évolutifs en action semblent spécifiques des caractéristiques écologiques locales des milieux occupées par ces populations. Dans ce contexte, une approche méta-transcriptomique impliquant l’étude de plusieurs taxa pourrait également s’avérer pertinente pour tester l’hypothèse de mécanismes moléculaires communs vis-à-vis des mêmes conditions environnementales (Garcia-Reyero & Perkins, 2011), à la condition toutefois que la composante phylogénique des réponses mesurées puisse être prise en compte (Carew et al., 2011). Le type d’habitat comme principal facteur de divergence adaptative et neutre Bien que la présente étude suggère un effet de l’exposition chronique aux pesticides sur la fitness des populations, la confrontation des résultats obtenus par l’approche QST-FST et l’analyse statistique en modèle linéaire mixte a révélé que le type d’habitat constituait le principal facteur de la divergence observée. D’une façon générale, les étangs se distinguent 200 des fossés et des canaux d’irrigation. Les populations inféodées aux étangs semblent composées d’individus plus grands, moins aptes à se reproduire et produisant des pontes plus petites, avec un délai d’oviposition post-isolement plus long et une survie à l’éclosion moins importante. Dans une moindre mesure, la taille des pontes et la survie à l’éclosion semblent également plus faibles dans les populations de fossés que dans celles occupant les canaux. La comparaison de ces patrons de divergence avec ceux issus de la diversité génétique neutre suggère un rôle important de l’isolement des populations et donc de la dérive génétique. En effet, le flux génique est en théorie plus faible entre étangs isolés qu’entre fossés connectés temporairement ou entre canaux plus permanents. Concernant l’étude des réponses moléculaires observées en condition de stress oxydant, il est impossible d’évaluer l’impact du type d’habitat et du niveau de diversité génétique étant donné le plan expérimental utilisé. Bien que l’analyse GLMM puisse gérer des plans expérimentaux déséquilibrés (Pinheiro & Bates, 2002), l’absence d’étangs en zone agricole et de canaux d’irrigation en zone non anthropisée constitue un facteur limitant dans l’étude présentée. En effet, il eut été intéressant de tester les hypothèses de divergence adaptative dans un cadre hiérarchique, i.e., permettant de prendre en compte simultanément les différents facteurs suspectés d’agir sur la structure des populations, comme la région, la pression anthropique, le type d’habitat (Goudet, 1995). De même, un test de l’hypothèse de sélection aurait été intéressant à développer à l’échelle de l’ensemble des traits étudiés (Chapuis et al., 2008; Martin et al., 2008; Ovaskainen et al., 2008; Ovaskainen et al., 2011). Une tentative d’application de la méthode développée par Martin et al. (2008) a cependant montré des résultats ambigus (non présentés ici), probablement liés au fait que l’ensemble des traits ne suivent pas le même modèle de sélection (cf. analyses univariées présentées). L’application d’une méthode bayésienne récemment développée (Ovaskainen et al. 2011), pour laquelle un outil statistique sera bientôt disponible (Ovaskainen, comm. pers.), pourrait se révéler intéressante dans le présent contexte. D’une façon plus globale, ces résultats confirment l’importance de la prise en compte des caractéristiques des habitats dans l’étude de l’effet de la sélection sur les organismes (Johansson et al., 2007), ainsi que dans l’estimation des effets toxiques sur le terrain. 201 Présence d’une forte variabilité intra-populationnelle des traits quantitatifs à l’échelle phénotypique et moléculaire. L’étude des traits d’histoire de vie et des réponses transcriptomiques a mis en évidence la présence d’une forte variabilité au niveau intra-populationnel. Cette variabilité n’a toutefois pu être évaluée statistiquement qu’à travers l’expression des traits d’histoire de vie (pas de réplicat intra-famille pour l’étude RNAseq). L’effet famille s’est révélé significatif pour la plupart des traits étudiés, excepté pour l’aptitude à la reproduction et le nombre de pontes déposées par individu pendant les 15 jours de suivi de la fécondité. Ces effets famille étaient même supérieurs aux effets population pour les traits relatifs à la taille à l’éclosion, au taux de croissance, la fécondité totale, le nombre d’oeufs par ponte et le taux d’éclosion. Concernant les traits précoces, i.e., la taille à l’éclosion et le paramètre b du modèle de croissance de Gompertz, l’approche QST-FST suggère des patrons de sélection homogénéisante (QST < FST) entre les populations. Des résultats similaires ont déjà été rapportés chez un autre gastéropode d’eau douce, Galba truncatula (Chapuis et al., 2007). Une contribution artéfactuelle des effets maternels aux patrons observés ne peut être écartée dans la présente étude, car le plan expérimental fondé sur des lignées de type full-sib (pas de connaissance de l’origine paternelle) ne permet pas de faire la distinction entre effets maternels et effets génétiques. Cependant, le patron de sélection détecté est la sélection homogénéisante, ce qui suggère l’absence d’une part, d’influence environnementale locale sur les performances « maternelles » à ce niveau, et d’autre part une forte canalisation ou l’existence d’une contrainte évolutive importante sur le trait « taille individuelle à l’éclosion » (Lamy et al., 2012). Afin d’estimer plus précisément le potentiel évolutif à l’échelle intra-populationnelle des réponses biochimiques et moléculaires de L. stagnalis vis-à-vis du stress chimique, une étude d’héritabilité basée sur un protocole de génétique quantitative de type full-sib nested in half-sib design (Lynch & Walsh, 1998), a été initié en octobre 2009 par Marie-Agnès Coutellec et Marc Collinet. Ce plan expérimental a reposé sur les croisements des 40 familles issues de la souche de laboratoire Renylis®. L’élevage et l’exposition à l’herbicide diquat ont été réalisés dans des conditions similaires à celles décrites précédemment (voir chapitre V). Les mesures d’activité enzymatique sont partiellement analysées mais l’analyse d’expression génique n’a quant à elle, pas pu être réalisée dans le cadre de la thèse, par manque de temps. Néanmoins, nous disposons d’échantillons d’hémolymphe et de glandes digestives conservés dans le RNAlater (Ambion) à -80°C pour 309 individus. Ce jeu d’échantillons permettra 202 d’étudier à l’échelle individuelle, la relation entre transcription et expression fonctionnelle de gènes candidats, et d’estimer l’héritabilité des réponses au stress généré par le diquat. La variation intra-population peut perturber l’observation et la révélation statistique des effets toxiques lors des procédures d’évaluation du risque écologique (Barata et al., 2000; Coutellec & Lagadic, 2006; Coutellec et al., 2011). Les résultats obtenus lors de l’exploration des réponses transcriptomiques, même s’ils ne sont pas soutenus statistiquement, vont dans ce sens (patrons de réponse propre à chaque réplicat) ; et suggèrent un potentiel adaptatif élevé pour ces réponses (interactions génotype-environnement). Intérêt appliqué de l’étude dans le contexte de l’évaluation du risque écologique Les tests d’écotoxicité préconisés par l’OCDE, faisant référence dans les procédures d’homologation des produits phytosanitaires, font l’objet de certaines critiques, notamment liées au fait qu’ils se basent sur un nombre limité d’espèces (Frampton et al., 2006), et que ces tests utilisent principalement des organismes issus de souches d’élevage et négligent la diversité génétique intra-spécifique (Breitholtz et al., 2006). La toxicité estimée ainsi n’est donc pas forcément représentative des effets à l’échelle de l’espèce. Les populations élevées/cultivées en laboratoire pendant de nombreuses générations sont souvent sujettes à une perte de diversité génétique (par sélection et / ou dérive) invalidant ainsi l'extrapolation des résultats à l’échelle de populations naturelles (Frankham, 2005; Nowak et al., 2007). Ainsi, la souche de laboratoire Renylis® utilisée dans cette étude (chapitre II), est très peu polymorphe, comparativement aux populations naturelles étudiées ici (Besnard et al., 2013). Dans leur ensemble, les résultats présents appuient le bien-fondé de la prise en compte de la diversité génétique dans les procédures d’évaluation du risque écologique. 203 Conclusions et perspectives 204 Les ressources génomiques générées dans ce projet par pyroséquençage 454 et RNaseq (Illumina 2000) constituent une base solide pour de futures investigations à l’échelle transcriptomique, et utile à l’ensemble de la communauté scientifique travaillant sur ce modèle biologique ou sur des espèces proches. D’un point de vue finalisé, les nouvelles données offrent aussi la possibilité d’élaborer des outils de type « marqueur écotoxicogénomique » (biopuces), qui, dans le cadre d’analyses de routine, restent financièrement plus avantageux que le RNAseq (Ekblom & Galindo, 2011). Toutefois, bien que ces techniques de séquençage de nouvelle génération présentent un potentiel indéniable pour l’étude des réponses moléculaires chez les espèces non modèles, de nombreux mécanismes de régulation restent insondables, bien que théoriquement exploitables à partir du présent jeu de données. En effet, l’absence de génome de référence est un frein à la compréhension, par exemple, des mécanismes d’épissage alternatif et l’identification de différentes isoformes fonctionnelles issues d’une même séquence codante, et peut biaiser en partie les résultats de l’étape d’assemblage. Par ailleurs, en termes d’outils de cartographie, cette lacune tend à limiter la portée des approches de recherche de QTL pour des traits d’intérêt (cartographie dense ; e.g., Tarres et al., 2009). Cependant, les marqueurs SNPs détectés dans le cadre présent d’acquistion de séquences de transcrits, même s’ils ne sont pas représentatifs de l’ensemble du génome et restent sans information cartographique physique, peuvent s’avérer intéressants dans une perspective de génomique des populations (Nielsen, 2005) ainsi que de recherche de QTL de traits impliqués dans les réponses au stress environnemental. Un projet de séquençage du génome de L. stagnalis est en cours, mais l’acquisition d’un véritable génome annoté représente un travail de longue haleine. Dans un premier temps et dans le cadre du présent projet, les données d’assemblage seront à affiner, par un travail de recherche d'éventuels contigs redondants via des alignements multiples de contigs de même meilleure annotation, ainsi qu’avec les nouvelles séquences publiées (Sadamoto et al., 2012). Ces données seront ensuite analysées par les méthodes statistiques récentes les plus adaptées au RNAseq, en commençant par celle permettant de corriger le biais lié à l’utilisation d’une distribution binomiale négative (Lurin & Balzergue). Les résultats attendus permettront l’estimation plus précise de l’impact moléculaire du diquat, et de tester l’hypothèse actuellement suggérée par les analyses réalisées, d’une plus faible sensibilité au diquat pour les populations des milieux pollués. Etant donné les informations obtenues sur certaines voies cellulaires et moléculaires d’intérêt, telles que l’apoptose, l’analyse de réseaux de gènes permettrait d’approfondir ces questions (Horvath, 2011). Une étape postérieure de validation 205 par PCR quantitative peut être envisagée, notamment en relation avec les transcrits « candidats » déjà étudiés sur la souche Renilys® (chapitre II). Ces nouveaux résultats seront également à mettre en relation avec les données phénotypiques mesurées sur les mêmes lignées, en conditions de common garden (chapitre IV). Ainsi, nous chercherons à mettre en évidence d’éventuels trade-offs ainsi que des effets pléiotropiques (Zera & Harshman, 2001), pouvant être à l’origne de coût en termes de fitness dans les populations les plus tolérantes au stress. Ces effets pourront être estimés grâce à des analyses basées sur les matrices de corrélation génétique. Par ailleurs, le test des hypothèses relatives au modèle de sélection sera approfondi en appliquant les méthodes multivariées actuelles, qui permettent de considérer les traits dans leur ensemble (matrices G), et pour certaines de prendre en compte l’apparentement génétique des populations (Martin et al., 2008; Ovaskainen et al., 2008; Ovaskainen et al., 2011). Enfin, dans le contexte écotoxicologique, les données seront explorées à la lumière de nouveaux concepts relatifs à la toxicité, tel que celui d’Adverse Outcome Pathway (AOP), qui permet de relier un événement moléculaire initiateur à des effets phénotypiques intégrés (physiologie, traits liés à la fitness) par recherche de réseaux d’interactions (moléculaire, biologique), et de les mettre ensuite en relation avec des modèles populationnels (Ankley et al., 2010). Dans cette optique, les effets post-transcriptionnels du diquat mis en évidence sur la souche Renylis® (Chapitre II), peuvent justifier le développement d’approches protéomiques, ainsi que des analyses fonctionnelles (activité enzymatique). La disponibilité des échantillons de glande digestive issus des individus étudiés en RNAseq, devrait également permettre dans ce cadre d’étudier les effets toxiques du diquat à différentes étapes de l’expression protéique. Enfin, dans une perspective éco-évolutive plus large, l’importance évolutive des conditions environnementales locales (telles qu’elle est suggérée par les données du présent travail), pourrait être testée dans une approche méta-transcriptomique. En effet, l’étude des réponses produites par différents taxa présent dans un milieu donné pourrait s’avérer pertinente pour tester l’hypothèse de mécanismes moléculaires communs (Garcia-Reyero et al., 2011), à condition de pouvoir prendre en compte la composante phylogénétique de ces réponses (Carew et al., 2011). 206 Travaux annexes Colloques • 20ème Colloque annuel de la SETAC, Séville, 23-27 mai 2010 [poster] • Journée Des Doctorants du Caren, Rennes 28 juin 2010 [poster] • Congrès Ecologie 2010, Montpellier 2-4 septembre 2010 [poster] • 21ème Colloque annuel de la SETAC, Milan 15-19 mai 2011 [poster] • 13ème Congrès de l’ESEB, Tübigen 20-25 août 2011 [poster] • 6ème Colloque mondial de la SETAC, Berlin 20-24 mai 2012 [communication orale] Enseignement • Vacation (9h de TD et 24h de TP d’immunologie) à IUT Laval en mars avril 2012 • Encadrement stagiaire IUT : Hélène Barbu, avril à juin 2011 Formations • Formation INRA « prise de parole en public », Paris, 27-29 janvier 2010. • Workshop « Evolutionary potential in natural populations », Sandjberg, 11-14 avril 2010 [poster et synthèse bibliographique en anglais notée par V. Loeschcke] • Short course «The discovery of mechanism based biomarkers using “omics” technologies : a bioinformatics perspective» , Sevilla, 23 mai 2010. • Conférence « 8e journée de la plate-forme Bio-informatique : techniques NGS », Rennes, INRIA 26 octobre 2010. • Séminaire des doctorants du département EFPA de l’INRA, Lyon 10-12 janvier 2011 [poster] • Modules « Alignements de séquences et SNP » dispensé par la plateforme BioInformatique de la Génopole INRA de Toulouse, le 03 octobre 2012. Publications hors contexte thèse • Delatte H., Bagny L., Brengue C., Bouétard A., Paupy C., Fontenille D. The invaders: phylogeography of dengue and chikungunya viruses Aedes vectors, on the South West islands of the Indian Ocean. Infect Genet Evol. (2011) 11(7):1769-81. • Bouétard A., Lefeuvre P., Gigant R., Bory S., Pignal M., Besse P., Grisoni M. Evidence of transoceanic dispersion of the genus Vanilla based on plastid DNA phylogenetic analysis. Molecular Phylogenetics and Evolution (2010) 55(2):621630. • Delatte H., Desvars A., Bouétard A., Bord S., Gimonneau G., Vourc’h G., Fontenille D. Blood-feeding behavior of Aedes albopictus, vector of chikungunya on La Réunion. Vector-Borne and Zoonotic Diseases (2009) 10:249-258. • Heckmann LH., Sibly RM., Connon R., Hooper HL., Hutchinson TH., Maund SJ., Hill CJ., Bouétard A., Callaghan A. Systems biology meets stress ecology: Linking molecular and organismal stress responses in Daphnia magna. Genome Biology (2008) 9(2):R40. • Heckmann LH., Bouétard A., Hill C., Sibly R., Callaghan A. A simple and rapid method for preserving RNA of aquatic invertebrates for ecotoxicogenomics. Ecotoxicology (2007) 16(6):445-7. • Lauzon K., Zhao X., Bouétard A., Delbecchi L., Paquette B., Lacasse P. Antioxidants to prevent bovine neutrophil-induced mammary epithelial cell damage. Journal of Dairy Science (2005) 88:4295-303. 207 Références bibliographiques Adema, C.M., Van Deutekom-Mulder, E.C., Van Der Knaap, W.P.W., Sminia, T., 1994. Schistosomicidal activities of Lymnaea stagnalis haemocytes: the role of oxygen radicals. Parasitology 109, 479-485. Aiken, C.T., Kaake, R.M., Wang, X., Huang, L., 2011. Oxidative Stress-Mediated Regulation of Proteasome Complexes. Molecular & Cellular Proteomics 10. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter, P., 2008. Apoptosis. Molecular Biology of the Cell Fifth Edition. Garland Science, New York, pp. 1115-1129. Anders, S., Huber, W., 2010. Differential expression analysis for sequence count data. Genome Biology 11, 1-12. Ankley, G.T., Bennett, R.S., Erickson, R.J., Hoff, D.J., Hornung, M.W., Johnson, R.D., Mount, D.R., Nichols, J.W., Russom, C.L., Schmieder, P.K., 2010. Adverse outcome pathways: A conceptual framework to support ecotoxicology research and risk assessment. Environmental Toxicology and Chemistry 29, 730-741. Anton, P.M., Theodorou, V., Roy, S., Fioramonti, J., Bueno, L., 2002. Pathways involved in mild gastrointestinal inflammation induced by a low level exposure to a food contaminant. Digestive Diseases and Sciences 47, 1308-1315. Armbruster, P., Reed, D., 2005. Inbreeding depression in benign and stressful environments. Heredity 95, 235-242. Arnaud, L., Haubruge, E., Gage, M.J.G., 2005. The malathion-specific resistance gene confers a sperm competition advantage in Tribolium castaneum. Functional Ecology 19, 1032-1039. Aung, W., Hasegawa, S., Furukawa, T., Saga, T., 2007. Potential role of ferritin heavy chain in oxidative stress and apoptosis in human mesothelial and mesothelioma cells: implications for asbestos-induced oncogenesis. Carcinogenesis 28, 2047-2052. Awad, J.A., Burk, R.F., Roberts, L.J., 1994. Effect of selenium deficiency and glutathione-modulating agents on diquat toxicity and lipid peroxidation in rats. Journal of Pharmacology and Experimental Therapeutics 270, 858-864. Balaban, R.S., Nemoto, S., Finkel, T., 2005. Mitochondria, Oxidants, and Aging. Cell 120, 483-495. Barañano, D.E., Rao, M., Ferris, C.D., Snyder, S.H., 2002. Biliverdin reductase: A major physiologic cytoprotectant. Proceedings of the National Academy of Sciences 99, 16093-16098. Barata, C., Baird, D.J., Miñarro, A., Soares, A.M.V.M., 2000. Do genotype responses always converge from lethal to nonlethal toxicant exposure levels? Hypothesis tested using clones of Daphnia magna straus. Environmental Toxicology and Chemistry 19, 2314-2322. Barata, C., Baird, D.J., Mitchell, S.E., Soares, A.M.V.M., 2002. Among- and within-population variability in tolerance to cadmium stress in natural populations of Daphnia magna: Implications for ecological risk assessment. Environmental Toxicology and Chemistry 21, 10581064. Barata, C., Baird, D.J., Soares, A.M.V.M., 2002. Determining Genetic Variability in the Distribution of Sensitivities to Toxic Stress among and within Field Populations of Daphnia magna. Environmental Science & Technology 36, 3045-3049. Barbu, H., 2011. Mise au point d’outils moléculaires pour l’étude de l’expression de gènes d’intérêt en QPCR chez Lymnaea stagnalis exposée à un pesticide générateur de stress oxydant. IUT Génie Biologique de Brest, UMR ESE de l'INRA de Rennes., p. 30p. Bardot, O., Aldridge, T.C., Latruffe, N., Green, S., 1993. PPAR-RXR Heterodimer Activates a Peroxisome Proliferator Response Element Upstream of the Bifunctional Enzyme Gene. Biochemical and Biophysical Research Communications 192, 37-45. Barnosky, A.D., Hadly, E.A., Bascompte, J., Berlow, E.L., Brown, J.H., Fortelius, M., Getz, W.M., Harte, J., Hastings, A., Marquet, P.A., Martinez, N.D., Mooers, A., Roopnarine, P., Vermeij, G., Williams, J.W., Gillespie, R., Kitzes, J., Marshall, C., Matzke, N., Mindell, D.P., Revilla, E., Smith, A.B., 2012. Approaching a state shift in Earth's biosphere. Nature 486, 52-58. 208 Barnosky, A.D., Matzke, N., Tomiya, S., Wogan, G.O.U., Swartz, B., Quental, T.B., Marshall, C., McGuire, J.L., Lindsey, E.L., Maguire, K.C., Mersey, B., Ferrer, E.A., 2011. Has the Earth/'s sixth mass extinction already arrived? Nature 471, 51-57. Bartell, S.M., Campbell, K.R., Lovelock, C.M., Nair, S.K., Shaw, J.L., 2000. Characterizing aquatic ecological risks from pesticides using a diquat dibromide case study III. Ecological process models. Environmental Toxicology and Chemistry 19, 1441-1453. Baucom, R.S., Mauricio, R., 2004. Fitness costs and benefits of novel herbicide tolerance in a noxious weed. Proceedings of the National Academy of Sciences of the United States of America 101, 13386-13390. Beauchamp, C., Fridovich, I., 1971. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Analytical Biochemistry 44, 276-287. Belkhir, K., Borsa, P., Chikhi, L., Raufaste, N., Catch , F., 2004. GENETIX 4.05, software under Windowsä for the genetics of populations. In: Montpellier, U.o. (Ed.). Benjamini, Y., Hochberg, Y., 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B (Methodological), 289-300. Berberat, P.-O., Katori, M., Kaczmarek, E., Anselmo, D., Lassman, C., Ke, B., Shen, X., Busuttil, R.W., Yamashita, K., Csizmadia, E., Tyagi, S., Otterbein, L.-E., Brouard, S., Tobiasch, E., Bach, F.-H., Kupiec-Weglinski, J.-W., Soares, M.-P., 2003. Heavy chain ferritin acts as an antiapoptotic gene that protects livers from ischemia reperfusion injury. The FASEB Journal 17, 1724-1726. Besnard, A.-L., Bouétard, A., Azam, D., Coutellec, M.-A., 2013. Isolation and characterization of three new multiplex sets of microsatellite markers in the hermaphroditic freshwater snail Lymnaea stagnalis (Mollusca, Gastropoda, Heterobranchia, Panpulmonata, Hygrophila) using 454-pyrosequencing technology. Molecular Ecology Resources 13. Bickham, J., 2011. The four cornerstones of Evolutionary Toxicology. Ecotoxicology 20, 497-502. Bickham, J.W., Sandhu, S., Hebert, P.D.N., Chikhi, L., Athwal, R., 2000. Effects of chemical contaminants on genetic diversity in natural populations: implications for biomonitoring and ecotoxicology. Mutation Research 463, 33-51. Bijlsma, R., Loeschcke, V., 2012. Genetic erosion impedes adaptive responses to stressful environments. Evolutionary Applications. Bilbao, E., Cajaraville, M.P., Cancio, I., 2010. Differential transcription of genes involved in peroxisome proliferation in thicklip grey mullets Chelon labrosus injected with benzo(a)pyrene. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 151, 334342. Bonduriansky, R., Day, T., 2009. Nongenetic Inheritance and Its Evolutionary Implications. Annual Review of Ecology, Evolution, and Systematics 40, 103-125. Bouétard, A., Besnard, A.-L., Vassaux, D., Lagadic, L., Coutellec, M.-A., 2013. Impact of the redoxcycling herbicide diquat on transcript expression and antioxidant enzymatic activities of the freshwater snail Lymnaea stagnalis. Aquatic Toxicology 126, 256-265. Bouétard, A., Noirot, C., Besnard, A.-L., Bouchez, O., Choisne, D., Robe, E., Klopp, C., Lagadic, L., Coutellec, M.-A., 2012. Pyrosequencing-based transcriptomic resources in the pond snail Lymnaea stagnalis, with a focus on genes involved in molecular response to diquat-induced stress. Ecotoxicology 21, 2222-2234. Bourret, V., Couture, P., Campbell, P.G.C., Bernatchez, L., 2008. Evolutionary ecotoxicology of wild yellow perch (Perca flavescens) populations chronically exposed to a polymetallic gradient. Aquatic Toxicology 86, 76-90. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248-254. Brausch, J.M., Smith, P.N., 2009. Pesticide resistance from historical agricultural chemical exposure in Thamnocephalus platyurus (Crustacea: Anostraca). Environmental Pollution 157, 481-487. Breitholtz, M., Rudén, C., Ove Hansson, S., Bengtsson, B.-E., 2006. Ten challenges for improved ecotoxicological testing in environmental risk assessment. Ecotoxicology and Environmental Safety 63, 324-335. 209 Bridges, C.M., Semlitsch, R.D., 2000. Variation in Pesticide Tolerance of Tadpoles among and within Species of Ranidae and Patterns of Amphibian Decline Variación de la Tolerancia a Pesticidas en Renacuajos entre y dentro de Especies de la Familia Ranidae y Patrones de Disminución de Anfibios. Conservation Biology 14, 1490-1499. Bridges, C.M., Semlitsch, R.D., Price, A.H., 2001. Genetic Variation in Insecticide Tolerance in a Population of Southern Leopard Frogs (Rana sphenocephala): Implications for Amphibian Conservation. Copeia 2001, 7-13. Brown, C.D., Holmes, C., Williams, R., Beulke, S., van Beinum, W., Pemberton, E., Wells, C., 2007. How does crop type influence risk from pesticides to the aquatic environment? Environmental Toxicology and Chemistry 26, 1818-1826. Brown, C.D., van Beinum, W., 2009. Pesticide transport via sub-surface drains in Europe. Environmental Pollution 157, 3314-3324. Burk, R.F., Lawrence, R.A., Lane, J.M., 1980. Liver necrosis and lipid peroxidation in the rat as the result of paraquat and diquat administration. Effect of selenium deficiency. The Journal of clinical investigation 65, 1024-1031. Bustin, S.A., 2010. Why the need for qPCR publication guidelines?--The case for MIQE. Methods 50, 217-226. Byzitter, J., Lukowiak, K., Karnik, V., Dalesman, S., 2012. Acute combined exposure to heavy metals (Zn, Cd) blocks memory formation in a freshwater snail. Ecotoxicology 21, 860-868. Campbell, K.R., Bartell, S.M., Shaw, J.L., 2000. Characterizing aquatic ecological risks from pesticides using a diquat dibromide case study. II. Approaches using quotients and distributions. Environmental Toxicology and Chemistry 19, 760-774. Canesi, L., Lorusso, L.C., Ciacci, C., Betti, M., Regoli, F., Poiana, G., Gallo, G., Marcomini, A., 2007. Effects of blood lipid lowering pharmaceuticals (bezafibrate and gemfibrozil) on immune and digestive gland functions of the bivalve mollusc, Mytilus galloprovincialis. Chemosphere 69, 994-1002. Carew, M., Marshall, S., Hoffmann, A., 2011. A combination of molecular and morphological approaches resolves species in the taxonomically difficult genus Procladius Skuse (Diptera: Chironomidae) despite high intra-specific morphological variation. Bulletin of entomological research 101, 505-519. Carriere, Y., Deland, J.-P., Roff, D.A., Vincent, C., 1994. Life-History Costs Associated with the Evolution of Insecticide Resistance. Proceedings of the Royal Society of London. Series B: Biological Sciences 258, 35-40. Carter, K., Lukowiak, K., Schenk, J.O., Sorg, B.A., 2006. Repeated cocaine effects on learning, memory and extinction in the pond snail Lymnaea stagnalis. Journal of Experimental Biology 209, 4273-4282. Carvajal-Rodriguez, A., Rolán-Alvarez, E., Caballero, A., 2005. Quantitative variation as a tool for detecting human-induced impacts on genetic diversity. Biological Conservation 124, 1-13. Chapuis, E., Martin, G., Goudet, J., 2008. Effects of Selection and Drift on G Matrix Evolution in a Heterogeneous Environment: A Multivariate Qst-Fst Test With the Freshwater Snail Galba truncatula. Genetics 180, 2151-2161. Chapuis, E., Trouve, S., Facon, B., Degen, L., Goudet, J., 2007. High quantitative and no molecular differentiation of a freshwater snail (Galba truncatula) between temporary and permanent water habitats. Molecular Ecology 16, 3484-3496. Charlesworth, D., Charlesworth, B., 1987. Inbreeding depression and its evolutionary consequences. Annu. Rev. Ecol. Syst., 237-268. Chaudière, J., Ferrari-Iliou, R., 1999. Intracellular Antioxidants: from Chemical to Biochemical Mechanisms. Food and Chemical Toxicology 37, 949-962. Chevreux, B., Pfisterer, T., Drescher, B., Driesel, A.J., Müller, W.E.G., Wetter, T., Suhai, S., 2004. Using the miraEST Assembler for Reliable and Automated mRNA Transcript Assembly and SNP Detection in Sequenced ESTs. Genome Research 14, 1147-1159. Chou, H.-C., Chen, Y.-W., Lee, T.-R., Wu, F.-S., Chan, H.-T., Lyu, P.-C., Timms, J.F., Chan, H.-L., 2010. Proteomics study of oxidative stress and Src kinase inhibition in H9C2 cardiomyocytes: a cell model of heart ischemia–reperfusion injury and treatment. Free Radical Biology and Medicine 49, 96-108. 210 Claridge-Chang, A., Wijnen, H., Naef, F., Boothroyd, C., Rajewsky, N., Young, M.W., 2001. Circadian Regulation of Gene Expression Systems in the Drosophila Head. Neuron 32, 657-671. Clark, E.S., Whigham, A.S., Yarbrough, W.G., Weaver, A.M., 2007. Cortactin is an essential regulator of matrix metalloproteinase secretion and extracellular matrix degradation in invadopodia. Cancer Research 67, 4227-4235. Coors, A., Vanoverbeke, J., De Bie, T., De Meester, L., 2009. Land use, genetic diversity and toxicant tolerance in natural populations of Daphnia magna. Aquatic Toxicology 95, 71-79. Costa, D., Mariën, J., Janssens, T.S., Gestel, C.M., Driessen, G., Sousa, J., Straalen, N., Roelofs, D., 2012. Influence of adaptive evolution of cadmium tolerance on neutral and functional genetic variation in Orchesella cincta. Ecotoxicology 21, 2078-2087. Costantini, D., Rowe, M., Butler, M.W., McGraw, K.J., 2010. From molecules to living systems: historical and contemporary issues in oxidative stress and antioxidant ecology. Functional Ecology 24, 950-959. Coutellec-Vreto, M.-A., Jarne, P., Guiller, A., Madec, L., Daguzan, J., 1998. Inbreeding and fitness in the freshwater snail Lymnaea peregra: an evaluation over two generations of self-fertilization. Evolution 52, 1635-1647. Coutellec, M.-A., Barata, C., 2011. An introduction to evolutionary processes in ecotoxicology. Ecotoxicology 20, 493-496. Coutellec, M.-A., Collinet, M., Caquet, T., 2011. Parental exposure to pesticides and progeny reaction norm to a biotic stress gradient in the freshwater snail Lymnaea stagnalis. Ecotoxicology 20, 524-534. Coutellec, M.-A., Delous, G., Cravedi, J.-P., Lagadic, L., 2008. Effects of the mixture of diquat and a nonylphenol polyethoxylate adjuvant on fecundity and progeny early performances of the pond snail Lymnaea stagnalis in laboratory bioassays and microcosms. Chemosphere 73, 326-336. Coutellec, M.-A., Lagadic, L., 2006. Effects of Self-Fertilization, Environmental Stress and Exposure to Xenobiotics on Fitness-Related Traits of the Freshwater Snail Lymnaea stagnalis. Ecotoxicology 15, 199-213. Coutellec, M.A., Caquet, T., 2011. Heterosis and inbreeding depression in bottlenecked populations: a test in the hermaphroditic freshwater snail Lymnaea stagnalis. Journal of Evolutionary Biology 24, 2248-2257. Crabtree, H.C., Lock, E.A., Rose, M.S., 1977. Effects of diquat on the gastrointestinal tract of rats. Toxicology and Applied Pharmacology 41, 585-595. Curtin, J.F., Donovan, M., Cotter, T.G., 2002. Regulation and measurement of oxidative stress in apoptosis. Journal of Immunological Methods 265, 49-72. D'Autreaux, B., Toledano, M.B., 2007. ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nat Rev Mol Cell Biol 8, 813-824. David, P., Pujol, B., Viard, F., Castella, V., Goudet, J., 2007. Reliable selfing rate estimates from imperfect population genetic data. Molecular Ecology 16, 2474-2487. Davison, A., Blaxter, M.L., 2005. An expressed sequence tag survey of gene expression in the pond snail Lymnaea stagnalis, an intermediate vector of Fasciola hepatica Parasitology 130. De Wit, P., Palumbi, S.R., 2012. Transcriptome-wide polymorphisms of red abalone (Haliotis rufescens) reveal patterns of gene flow and local adaptation. Molecular Ecology, n/a-n/a. De Zwart, D., 2005. Ecological effects of pesticide use in The Netherlands: Modeled and observed effects in the field ditch. Integrated Environmental Assessment and Management 1, 123-134. Depledge, M.H., 1994. Genotypic toxicity - Implications for individuals and populations. Environ. Health Perspect. 102, 101-104. Diwakar, L., Ravindranath, V., 2007. Inhibition of cystathionine-γ-lyase leads to loss of glutathione and aggravation of mitochondrial dysfunction mediated by excitatory amino acid in the CNS. Neurochemistry International 50, 418-426. Dröge, W., 2002. Free Radicals in the Physiological Control of Cell Function. Physiological Reviews 82, 47-95. Ducrot, V., Péry, A.R.R., Lagadic, L., 2010. Modelling effects of diquat under realistic exposure patterns in genetically differentiated populations of the gastropod Lymnaea stagnalis. Philosophical Transactions of the Royal Society B: Biological Sciences 365, 3485-3494. 211 Duron, O., Labbé, P., Berticat, C., Rousset, F., Guillot, S., Raymond, M., Weill, M., 2006. High Wolbachia density correlates with cost of infection for insecticide resistant Culex pipiens mosquitoes. Evolution 60, 303-314. Earl, D., von Holdt, B., 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources 4, 359-361. Eeva, T., Belskii, E., Kuranov, B., 2006. Environmental pollution affects genetic diversity in wild bird populations. Mutation Research/Genetic Toxicology and Environmental Mutagenesis 608, 8-15. Ekblom, R., Galindo, J., 2011. Applications of next generation sequencing in molecular ecology of non-model organisms. Heredity 107, 1-15. Ellis, R.P., Parry, H., Spicer, J.I., Hutchinson, T.H., Pipe, R.K., Widdicombe, S., 2011. Immunological function in marine invertebrates: Responses to environmental perturbation. Fish & Shellfish Immunology 30, 1209-1222. Emmett, K., 2002. Final risk assessment for diquat bromide. Washington State Department of Ecology, Washington, DC. Eroukhmanoff, F., Hargeby, A., Svensson, E.I., 2009. Rapid adaptive divergence between ecotypes of an aquatic isopod inferred from FST–QST analysis. Molecular Ecology 18, 4912-4923. Escobar, J.S., Auld, J.R., Correa, A.C., Alonso, J.M., Bony, Y.K., Coutellec, M.-A., Koene, J.M., Pointier, J.-P., Jarne, P., David, P., 2011. Patterns of mating-system evolution in hermaphroditic animals: correlations among selfing rate, inbreeding depression, and the timing of reproduction. Evolution 65, 1233-1253. Escobar, J.S., Nicot, A., David, P., 2008. The Different Sources of Variation in Inbreeding Depression, Heterosis and Outbreeding Depression in a Metapopulation of Physa acuta. Genetics 180, 15931608. Evanno, G., Castella, E., Goudet, J., 2006. Evolutionary aspects of population structure for molecular and quantitative traits in the freshwater snail Radix balthica. Journal of Evolutionary Biology 19, 1071-1082. Evanno, G., Regnaut, S., Goudet, J., 2005. Detecting the number of clusters of individuals using the software structure: a simulation study. Molecular Ecology 14, 2611-2620. FAO, 2008. FAO specifications and evaluations for agricultural pesticides. http://www.fao.org/ag/AGP/AGPP/Pesticid/Specs/docs/Pdf/new/Diquat08.pdf. Feldmeyer, B., Wheat, C., Krezdorn, N., Rotter, B., Pfenninger, M., 2011. Short read Illumina data for the de novo assembly of a non-model snail species transcriptome (Radix balthica, Basommatophora, Pulmonata), and a comparison of assembler performance. BMC Genomics 12, 317. Feng, Z.-P., Zhang, Z., van Kesteren, R., Straub, V., van Nierop, P., Jin, K., Nejatbakhsh, N., Goldberg, J., Spencer, G., Yeoman, M., Wildering, W., Coorssen, J., Croll, R., Buck, L., Syed, N., Smit, A., 2009. Transcriptome analysis of the central nervous system of the mollusc Lymnaea stagnalis. BMC Genomics 10, 451. Figueiredo-Fernandes, A., Fontaínhas-Fernandes, A., Peixoto, F., Rocha, E., Reis-Henriques, M.A., 2006. Effects of gender and temperature on oxidative stress enzymes in Nile tilapia Oreochromis niloticus exposed to paraquat. Pesticide Biochemistry and Physiology 85, 97-103. Flohé, L., Günzler, W.A., 1984. Assays of glutathione peroxidase. In: Lester, P. (Ed.), Methods in Enzymology. Academic Press, pp. 114-120. Fong, W.-H., Tsai, H.-D., Chen, Y.-C., Wu, J.-S., Lin, T.-N., 2010. Anti-apoptotic Actions of PPAR-γ Against Ischemic Stroke. Molecular Neurobiology 41, 180-186. Forbes, V., 1998. Genetics and ecotoxicology. CRC. Fox, C.W., Reed, D.H., 2011. Inbreeding depression increases with environmental stress : an experimental study in meta-analysis. Evolution 65, 246-258. Frampton, G.K., Jänsch, S., Scott-Fordsmand, J.J., Römbke, J., van den Brink, P.J., 2006. Effects of pesticides on soil invertebrates in laboratory studies: A review and analysis using species sensitivity distributions. Environmental Toxicology and Chemistry 25, 2480-2489. Franco, R., Sánchez-Olea, R., Reyes-Reyes, E.M., Panayiotidis, M.I., 2009. Environmental toxicity, oxidative stress and apoptosis: Ménage à Trois. Mutation Research/Genetic Toxicology and Environmental Mutagenesis 674, 3-22. 212 Frankham, R., 2005. Stress and adaptation in conservation genetics. Journal of Evolutionary Biology 18, 750-755. French Ministry of Agriculture, 2012. http://e-phy.agriculture.gouv.fr/spe/7700078-5083.htm. Frisch, D., Green, A., Figuerola, J., 2007. High dispersal capacity of a broad spectrum of aquatic invertebrates via waterbirds. Aquat. Sci. 69, 568-574. Fu, Y., Cheng, W.-H., Porres, J.M., Ross, D.A., Lei, X.G., 1999. Knockout of cellular glutathione peroxidase gene renders mice susceptible to diquat-induced oxidative stress. Free Radical Biology and Medicine 27, 605-611. Fussell, K.C., Udasin, R.G., Gray, J.P., Mishin, V., Smith, P.J.S., Heck, D.E., Laskin, J.D., 2011. Redox cycling and increased oxygen utilization contribute to diquat-induced oxidative stress and cytotoxicity in Chinese hamster ovary cells overexpressing NADPH-cytochrome P450 reductase. Free Radical Biology and Medicine 50, 874-882. Gallagher, E.P., Buetler, T.M., Stapleton, P.L., Wang, C.H., Stahl, D.L., Eaton, D.L., 1995. The effects of diquat and ciprofibrate on mRNA expression and catalytic activities of hepatic xenobiotic metabolizing and antioxidant enzymes in rat liver. Toxicology and Applied Pharmacology 134, 81-91. Galletly, B.C., Blows, M.W., Marshall, D.J., 2007. Genetic mechanisms of pollution resistance in a marine invertebrate. Ecological Applications 17, 2290-2297. Garcia-Reyero, N., Habib, T., Pirooznia, M., Gust, K.A., Gong, P., Warner, C., Wilbanks, M., Perkins, E., 2011. Conserved toxic responses across divergent phylogenetic lineages: a meta-analysis of the neurotoxic effects of RDX among multiple species using toxicogenomics. Ecotoxicology 20, 580-594. Garcia-Reyero, N., Perkins, E.J., 2011. Systems biology: Leading the revolution in ecotoxicology. Environmental Toxicology and Chemistry 30, 265-273. Gilad, Y., Pritchard, J.K., Thornton, K., 2009. Characterizing natural variation using next-generation sequencing technologies. Trends in Genetics 25, 463. Glover, J.R., Lindquist, S., 1998. Hsp104, Hsp70, and Hsp40: A novel chaperone system that rescues previously aggregated proteins. Cell 94, 73-82. Gnatyshyna, L.L., Fal'fushinskaya, G.I., Golubev, O.P., Dallinger, R., Stoliar, O.B., 2011. Role of Metallothioneins in Adaptation of Lymnaea stagnalis (Mollusca: Pulmonata) to Environment Pollution. 47, 56-66. Goudet, J., 2001. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Goudet, J., Buchi, L., 2006. The Effects of Dominance, Regular Inbreeding and Sampling Design on QST, an Estimator of Population Differentiation for Quantitative Traits. Genetics 172, 13371347. Grune, T., Catalgol, B., Licht, A., Ermak, G., Pickering, A.M., Ngo, J.K., Davies, K.J.A., 2011. HSP70 mediates dissociation and reassociation of the 26S proteasome during adaptation to oxidative stress. Free Radical Biology and Medicine 51, 1355-1364. Guo, Z., Kozlov, S., Lavin, M.F., Person, M.D., Paull, T.T., 2010. ATM Activation by Oxidative Stress. Science 330, 517-521. Habdija, I., Lajtner, J., Belinić, I., 1995. The Contribution of Gastropod Biomass in Macrobenthic Communities of a Karstic River. Internationale Revue der gesamten Hydrobiologie und Hydrographie 80, 103-110. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione-S-transferases : the first enzymatic step in mercapturic acid formation. Journal of Biological Chemistry 249, 7130-7139. Han, E.-S., Muller, F.L., Pérez, V.I., Qi, W., Liang, H., Xi, L., Fu, C., Doyle, E., Hickey, M., Cornell, J., Epstein, C.J., Roberts, L.J., Van Remmen, H., Richardson, A., 2008. The in vivo gene expression signature of oxidative stress. Physiological Genomics 34, 112-126. Hangartner, S., Laurila, A., Räsänen, K., 2012. Adaptive divergence in moor frog (rana arvalis) populations along an acidification gradient : inferences from Qst-Fst correlations. Evolution 66, 867-881. Harris, C.M., Sanders, S.A., Massey, V., 1999. Role of the flavin midpoint potential and NAD binding in determining NAD versus oxygen reactivity of xanthine oxidoreductase. Journal of Biological Chemistry 274, 4561-4569. 213 Hartl, D.L., Clark, A.G., 1997. Principles of population genetics. Sinauer associates Sunderland, Massachusetts. Heckmann, L.-H., Sibly, R., Connon, R., Hooper, H., Hutchinson, T., Maund, S., Hill, C., Bouetard, A., Callaghan, A., 2008. Systems biology meets stress ecology: linking molecular and organismal stress responses in Daphnia magna. Genome Biology 9, R40. Heckmann, L.-H., Sorensen, P., Krogh, P.H., Sorensen, J., 2011. NORMA-Gene: A simple and robust method for qPCR normalization based on target gene data. BMC Bioinformatics 12, 250. Hedrick, P.W., Kalinowski, S.T., 2000. Inbreeding depression in conservation biology. Annu. Rev. Ecol. Syst., 139-162. Hendry, A.P., Farrugia, T.J., Kinnison, M.T., 2008. Human influences on rates of phenotypic change in wild animal populations. Molecular Ecology 17, 20-29. Hendry, A.P., Kinnison, M.T., Heino, M., Day, T., Smith, T.B., Fitt, G., Bergstrom, C.T., Oakeshott, J., Jørgensen, P.S., Zalucki, M.P., 2011. Evolutionary principles and their practical application. Evolutionary Applications 4, 159-183. Henry, P.-Y., Jarne, P., 2007. Marking hard-shelled gastropods: tag loss, impact on life-history traits, and perspectives in biology. Invertebrate Biology 126, 138-153. Hoffer, J., Ellers, J., Koene, J., 2010. Costs of receipt and donation of ejaculates in a simultaneous hermaphrodite. BMC Evolutionary Biology 10, 393. Hoffer, J.N.A., Schwegler, D., Ellers, J., Koene, J.M., 2012. Mating rate influences female reproductive investment in a simultaneous hermaphrodite, Lymnaea stagnalis. Animal Behaviour 84, 523-529. Hoffmann, A.A., Hercus, M.J., 2000. Environmental stress as an evolutionary force. Bioscience 50, 217-226. Hoffmann, A.A., Parsons, P.A., 1997. Extreme environmental change and evolution. . Cambridge University Press, Cambridge (UK). Hoffmann, A.A., Sgrò, C.M., 2011. Climate change and evolutionary adaptation. Nature 470, 479-485. Hoffmann, A.A., Willi, Y., 2008. Detecting genetic responses to environmental change. Nature Reviews Genetics 9, 421-432. Holloway, G., Crocker, H., Callaghan, A., 2003. The effects of novel and stressful environments on trait distribution. Functional Ecology 11, 579-584. Hook, S.E., Skillman, A.D., Small, J.A., Schultz, I.R., 2006. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants. Aquatic Toxicology 77, 372385. Hooven, L.A., Sherman, K.A., Butcher, S., Giebultowicz, J.M., 2009. Does the clock make the poison? Circadian variation in response to pesticides. PLoS ONE 4, e6469. Horvath, S., 2011. Integrated Weighted Correlation Network Analysis of Mouse Liver Gene Expression Data. Weighted Network Analysis. Springer, pp. 321-351. INED, 2013. Institut National d'Etudes Démographiques. Ishizuka, M., Tanikawa, T., Tanaka, K.D., Heewon, M., Okajima, F., Sakamoto, K.Q., Fujita, S., 2008. Pesticide resistance in wild mammals - Mechanisms of anticoagulant resistance in wild rodents. The Journal of Toxicological Sciences 33, 283-291. Jansen, M., Coors, A., Stoks, R., Meester, L., 2011. Evolutionary ecotoxicology of pesticide resistance: a case study in Daphnia. Ecotoxicology 20, 543-551. Jarne, Perdieu, Pernot, Delay, David, 2000. The influence of self-fertilization and grouping on fitness attributes in the freshwater snail Physa acuta: population and individual inbreeding depression. Journal of Evolutionary Biology 13, 645-655. Jarne, P., Lagoda, P.J., 1996. Microsatellites, from molecules to populations and back. Trends in Ecology & Evolution 11, 424-429. Jimenez-Ambriz, G., Petit, C., Bourrie, I., Dubois, S., Olivieri, I., Ronce, O., 2007. Life history variation in the heavy metal tolerant plant Thlaspi caerulescens growing in a network of contaminated and noncontaminated sites in southern France: role of gene flow, selection and phenotypic plasticity. New Phytol. 173, 199-215. Johansson, M., Primmer, C.R., MerilÄ, J., 2007. Does habitat fragmentation reduce fitness and adaptability? A case study of the common frog (Rana temporaria). Molecular Ecology 16, 2693-2700. 214 Jones, O.R., Wang, J., 2010. COLONY: a program for parentage and sibship inference from multilocus genotype data. Molecular Ecology Resources 10, 551-555. Junqueira, V.B.C., Barros, S.B.M., Chan, S.S., Rodrigues, L., Giavarotti, L., Abud, R.L., Deucher, G.P., 2004. Aging and oxidative stress. Molecular Aspects of Medicine 25, 5-16. Kang, K.W., Lee, S.J., Kim, S.G., 2005. Molecular mechanism of nrf2 activation by oxidative stress. Antioxidants & redox signaling 7, 1664-1673. Kannan, K., Jain, S.K., 2000. Oxidative stress and apoptosis. Pathophysiology 7, 153-163. Karuppagounder, S., Ahuja, M., Buabeid, M., Parameshwaran, K., Abdel-Rehman, E., Suppiramaniam, V., Dhanasekaran, M., 2012. Investigate the chronic neurotoxic effects of diquat. Neurochemical Research 37, 1102-1111. Keane, B., Collier, M., Rogstad, S., 2005. Pollution and Genetic Structure of North American Populations of the Common Dandelion (Taraxacum Officinale). Environ Monit Assess 105, 341-357. Keller, L.F., Waller, D.M., 2002. Inbreeding effects in wild populations. TRENDS in Ecology & Evolution 17, 230-241.0 Kijas, J., Fowler, J., Garbett, C., Thomas, M., 1994. Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. Biotechniques 16, 656. Kim, H.J., Hwang, N.R., Lee, K.J., 2007. Heat shock responses for understanding diseases of protein denaturation. Mol Cells 23, 123-131. Kirkpatrick, M., Lande, R., 1989. The evolution of maternal characters. Evolution, 485-503. Kiss, T., 2010. Apoptosis and its functional significance in molluscs. Springer, Secaucus, NJ, ETATSUNIS. Klerks, P., Xie, L., Levinton, J., 2011. Quantitative genetics approaches to study evolutionary processes in ecotoxicology; a perspective from research on the evolution of resistance. Ecotoxicology 20, 513-523. Klerks, P.L., 2002. Adaptation, ecological impacts, and risk assessment: insights from research at Foundry Cove, Bayou Trepagnier, and Pass Fourchon. Human and Ecological Risk Assessment 8, 971-982. Knott, E., Puurtinen, M., Kaitala, V., 2003. Primers for nine microsatellites loci in the hermaphroditic snail Lymnaea stagnalis. Mol. Ecol. Notes 3, 333-335. Kopp, K.C., Wolf, K., 2007. Lymnaea stagnalis microsatellites sequences. Genbank accession : EF208747-EF208748. Lackey, R.T., 1997. Ecological risk assessment: use, abuse, and alternatives. Environmental Management 21, 808-812. Lagadic, L., 2007. Biological scaling and risk assessment of binary mixtures of herbicides and adjuvant (CEREMEL). Scientific Report, French Ministry of Ecology and Sustainable Development, n° CV 03000143, 90 p. . Lamy, J.-B., Plomion, C., Kremer, A., Delzon, S., 2012. QST < FST As a signature of canalization. Molecular Ecology 21, 5646-5655. Lee, J.-Y., Koga, H., Kawaguchi, Y., Tang, W., Wong, E., Gao, Y.-S., Pandey, U.B., Kaushik, S., Tresse, E., Lu, J., Taylor, J.P., Cuervo, A.M., Yao, T.-P., 2010. HDAC6 controls autophagosome maturation essential for ubiquitin-selective quality-control autophagy. EMBO J 29, 969-980. Lee, S.-M., Lee, S.-B., Park, C.-H., Choi, J., 2006. Expression of heat shock protein and hemoglobin genes in Chironomus tentans (Diptera, chironomidae) larvae exposed to various environmental pollutants: A potential biomarker of freshwater monitoring. Chemosphere 65, 1074-1081. Leinonen, T., O’Hara, R.B., Cano, J.M., MerilÄ, J., 2008. Comparative studies of quantitative trait and neutral marker divergence: a meta-analysis. Journal of Evolutionary Biology 21, 1-17. Leroux, S., Feve, K., Vignoles, F., Bouchez, O., Klopp, C., Noirot, C., Gourichon, D., Richard, S., Leterrier, C., Beaumont, C., Minvielle, F., Vignal, A., Pitel, F., 2010. Non PCR-amplified Transcripts and AFLP(R)(R) fragments as reduced representations of the quail genome for 454 Titanium sequencing. BMC Research Notes 3, 214. Liess, M., 2002. Population response to toxicants is altered by intraspecific interaction. Environmental Toxicology and Chemistry 21, 138-142. 215 Lind, E.E., Grahn, M., 2011. Directional genetic selection by pulp mill effluent on multiple natural populations of three-spined stickleback (Gasterosteus aculeatus). Ecotoxicology 20, 503-512. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Marine Pollution Bulletin 42, 656-666. Lopes, P.C., Sucena, É., Santos, M.E., Magalhães, S., 2008. Rapid experimental evolution of pesticide resistance in C. elegans entails no costs and affects the mating system. PLoS ONE 3, e3741. Lurin, C., Balzergue, S., unpublished. DEV-Seq : DEVeloppements de nouvelles méthodes d'analyse des ARN par RNAseq. Lushchak, V.I., 2011. Environmentally induced oxidative stress in aquatic animals. Aquatic Toxicology 101, 13-30. Lynch, M., Walsh, B., 1998. Genetics and Analysis of Quantitative Traits., Massachusetts, USA. Mace, G.M., Norris, K., Fitter, A.H., 2012. Biodiversity and ecosystem services: a multilayered relationship. TRENDS in Ecology & Evolution 27, 19-26. Mackie, J.A., Levinton, J.S., Przeslawski, R., DeLambert, D., Wallace, W., 2010. Loss of evolutionary resistance by the Oligochaete Limnodrilus hoffmeisteri to a toxic substanced - cost or gene flow? Evolution 64, 152-165. Mager, W.H., de Boer, A.H., Siderius, M.H., Voss, H.P., 2000. Cellular responses to oxidative and osmotic stress. Cell stress & chaperones 5, 73-75. Magoč, T., Salzberg, S.L., 2011. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27, 2957-2963. Malausa, T., Gilles, A., Meglécz, E., Blanquart, H., Duthoy, S., Costedoat, C., Dubut, V., Pech, N., Castagogne-Sereno, P., Délye, C., 2011. High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources 11, 638-644. Mariette, J., Noirot, C., Klopp, C., 2011. Assessment of replicate bias in 454 pyrosequencing and a multi-purpose read-filtering tool. BMC Research Notes 4, 149. Martin, G., Chapuis, E., Goudet, J., 2008. Multivariate Qst-Fst Comparisons: A Neutrality Test for the Evolution of the G Matrix in Structured Populations. Genetics 180, 2135-2149. Martyniuk, C.J., Griffitt, R.J., Denslow, N.D., 2011. Omics in aquatic toxicology: Not just another microarray. Environmental Toxicology and Chemistry 30, 263-264. Matson, C.W., Lambert, M.M., McDonald, T.J., Autenrieth, R.L., Donnelly, K.C., Islamzadeh, A., Politov, D.I., Bickham, J.W., 2006. Evolutionary Toxicology: Population-Level Effects of Chronic Contaminant Exposure on the Marsh Frogs (Rana ridibunda) of Azerbaijan. Environ Health Perspect 114, 547-552. Medina, M.H., Correa, J.A., Barata, C., 2007. Micro-evolution due to pollution: Possible consequences for ecosystem responses to toxic stress. Chemosphere 67, 2105-2114. Meglécz, E., Costedoat, C., Dubut, V., Gilles, A., Malausa, T., Pech, N., Martin, J.-F., 2010. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics 26, 403-404. Memmott, J., 2009. Food webs: a ladder for picking strawberries or a practical tool for practical problems? Philosophical Transactions of the Royal Society B: Biological Sciences 364, 16931699. Meyers, L.A., Bull, J.J., 2002. Fighting change with change: adaptive variation in an uncertain world. TRENDS in Ecology & Evolution 17, 551-557. Molecular Ecology Resources Primer Development, C., Ahanchédé, A., Alfaya, J.E.F., Andersen, L.W., Azam, D., Bautista, M.A.M., Besnard, A.-L., Bigatti, G., Bouétard, A., Coutellec, M.-A., Ewédjè, E.-E.B.K., Fuseya, R., GarcÍa-Jiménez, R., Haratian, M., Hardy, O.J., Holm, L.E., Hoy, C.W., Koshimizu, E., Loeschcke, V., López-Márquez, V., Machado, C.A., Machordom, A., Marchi, C., Michel, A.P., Micheneau, C., Mittapalli, O., Nagai, T., Okamoto, N., Pan, Y., Panitz, F., Safaie, N., Sakamoto, T., Sharifnabi, B., Tian, E.-W., Yu, H., 2013. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 August 2012 – 30 September 2012. Molecular Ecology Resources 13, 158-159. Molle, L., 1984. Éloge du Professeur René Truhaut. Revue d'histoire de la pharmacie 72, 340-348. Monaghan, P., Metcalfe, N.B., Torres, R., 2009. Oxidative stress as a mediator of life history tradeoffs: mechanisms, measurements and interpretation. Ecology Letters 12, 75-92. 216 Morgan, A.J., Kille, P., Sturzenbaum, S.R., 2007. Microevolution and ecotoxicology of metals in invertebrates. Environmental Science & Technology 41, 1085-1096. Mousseau, T.A., Uller, T., Wapstra, E., Badyaev, A.V., 2009. Evolution of maternal effects: past and present. Philosophical Transactions of the Royal Society B: Biological Sciences 364, 10351038. Mroczek, S., Kufel, J., 2008. Apoptotic signals induce specific degradation of ribosomal RNA in yeast. Nucleic Acids Research 36, 2874-2888. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583-590. Nemec, S., Patel, S., Nowak, C., Pfenninger, M., 2012. Evolutionary determinants of population differences in population growth rate × habitat temperature interactions in Chironomus riparius. Oecologia, 1-10. Nielsen, R., 2005. Molecular signatures of natural selection. Annu. Rev. Genet. 39, 197-218. Nowak, C., Vogt, C., Diogo, J.B., Schwenk, K., 2007. Genetic impoverishment in laboratory cultures of the test organism Chironomus riparius. Environmental Toxicology and Chemistry 26, 10181022. O'Hara, R.B., Merila, J., 2005. Bias and Precision in QST Estimates: Problems and Some Solutions. Genetics 171, 1331-1339. Orsini, L., Spanier, K.I., De Meester, L.U.C., 2012. Genomic signature of natural and anthropogenic stress in wild populations of the waterflea Daphnia magna: validation in space, time and experimental evolution. Molecular Ecology 21, 2160-2175. Osburn, W.O., Wakabayashi, N., Misra, V., Nilles, T., Biswal, S., Trush, M.A., Kensler, T.W., 2006. Nrf2 regulates an adaptive response protecting against oxidative damage following diquatmediated formation of superoxide anion. Archives of Biochemistry and Biophysics 454, 7-15. Oshlack, A., Robinson, M., Young, M., 2010. From RNA-seq reads to differential expression results. Genome Biology 11, 1-10. Ovaskainen, O., Cano, J.M., Merilä, J., 2008. A Bayesian framework for comparative quantitative genetics. Proceedings of the Royal Society B: Biological Sciences 275, 669-678. Ovaskainen, O., Karhunen, M., Zheng, C., Arias, J.M.C., Merilä, J., 2011. A New Method to Uncover Signatures of Divergent and Stabilizing Selection in Quantitative Traits. Genetics 189, 621-632. Pagani, I., Liolios, K., Jansson, J., Chen, I.-M.A., Smirnova, T., Nosrat, B., Markowitz, V.M., Kyrpides, N.C., 2012. The Genomes OnLine Database (GOLD) v.4: status of genomic and metagenomic projects and their associated metadata. Nucleic Acids Research 40, D571-D579. Pakkasmaa, S., Merila, J., O'Hara, R.B., 2003. Genetic and maternal effect influences on viability of common frog tadpoles under different environmental conditions. Heredity 91, 117-124. Palo, J., O'Hara, R.B., Laugen, A.T., Laurila, A., Primmer, C.R., Merilä, J., 2003. Latitudinal divergence of common frog (Rana temporaria) life history traits by natural selection: evidence from a comparison of molecular and quantitative genetic data. Molecular Ecology 12, 19631978. Park, K., Bang, H.W., Park, J., Kwak, I.-S., 2009. Ecotoxicological multilevel-evaluation of the effects of fenbendazole exposure to Chironomus riparius larvae. Chemosphere 77, 359-367. Park, K., Park, J., Kim, J., Kwak, I.-S., 2010. Biological and molecular responses of Chironomus riparius (Diptera, Chironomidae) to herbicide 2,4-D (2,4-dichlorophenoxyacetic acid). Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 151, 439446. Perkins, E.J., Chipman, J.K., Edwards, S., Habib, T., Falciani, F., Taylor, R., Van Aggelen, G., Vulpe, C., Antczak, P., Loguinov, A., 2011. Reverse engineering adverse outcome pathways. Environmental Toxicology and Chemistry 30, 22-38. Pfenninger, M., Salinger, M., Haun, T., Feldmeyer, B., 2011. Factors and processes shaping the population structure and distribution of genetic variation across the species range of the freshwater snail radix balthica (Pulmonata, Basommatophora). BMC Evolutionary Biology 11, 135. Pigliucci, M., 2001. Phenotypic plasticity. Beyond nature and nurture. Baltimore. Pigliucci, M., 2005. Evolution of phenotypic plasticity: where are we going now? Trends in Ecology & Evolution 20, 481-486. 217 Pigliucci, M.K., J. , 2006. Making Sense of Evolution: Toward a Coherent Picture of Evolutionary Theory. Chicago. Pimm, S.L., Russell, G.J., Gittleman, J.L., Brooks, T.M., 1995. The Future of Biodiversity. Science 269, 347-350. Pinheiro, J.C., Bates, D.M., 2002. Mixed Effects Models in S and S-Plus. Springer Verlag New York, LLC, New York. Poulsen, H.E., Jensen, B.R., Weimann, A., Jensen, S.A., Sorensen, M., Loft, S., 2000. Antioxidants, DNA damage and gene expression. Free radical research 33 Suppl, S33-39. Powles, S.B., Yu, Q., 2010. Evolution in Action: Plants Resistant to Herbicides. Annual Review of Plant Biology 61, 317-347. Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of Population Structure Using Multilocus Genotype Data. Genetics 155, 945-959. Puurtinen, M., Hytönen, M., Knott, K.E., Taskinen, J., Nissinen, K., Kaitala, V., 2004a. The effects of mating system and genetic variability on susceptibility to trematode parasites in a freshwater snail, Lymnaea stagnalis. Evolution 58, 2747-2753. Puurtinen, M., Knott, K.E., Suonpaa, S., Nissinen, K., Kaitala, V., 2007. Predominance of outcrossing in Lymnaea stagnalis despite low apparent fitness costs of self-fertilization. Journal of Evolutionary Biology 20, 901-912. Puurtinen, M., Knott, K.E., Suonpää, S., Ooik, T.v., Kaitala, V., 2004b. Genetic varibility and drift load in populations of aquatic snail. Evolution 58, 749-756. Qiu, X., Shao, Y., Miao, S., Wang, L., 2006. The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cellular and Molecular Life Sciences 63, 2560-2570. Raes, J., Letunic, I., Yamada, T., Jensen, L.J., Bork, P., 2011. Toward molecular trait-based ecology through integration of biogeochemical, geographical and metagenomic data. Mol Syst Biol 7. Ramos-Vasconcelos, G.R., Cardoso, L.A., Hermes-Lima, M., 2005. Seasonal modulation of free radical metabolism in estivating land snails Helix aspersa. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 140, 165-174. Ran, Q., Liang, H., Gu, M., Qi, W., Walter, C.A., Roberts, L.J., Herman, B., Richardson, A., Van Remmen, H., 2004. Transgenic mice overexpressing glutathione peroxidase are protected against oxidative stress-induced apoptosis. Journal of Biological Chemistry 279, 55137-55146. Raymond, M., Rousset, F., 1995. GENEPOP (Version 1.2): Population Genetics Software for Exact Tests and Ecumenicism. Journal of Heredity 86, 248-249. Regoli, F., Giuliani, M.E., Benedetti, M., Arukwe, A., 2011. Molecular and biochemical biomarkers in environmental monitoring: A comparison of biotransformation and antioxidant defense systems in multiple tissues. Aquatic Toxicology 105, 56-66. Reznick, D.N., Ghalambor, C.K., 2001. The population ecology of contemporary adaptations: what empirical studies reveal about the conditions that promote adaptive evolution. Genetica 112, 183-198. Richards, C.M., 2000. Inbreeding depression and genetic rescue in a plant metapopulation. The American Naturalist 155, 383-394. Riedl, S.J., Shi, Y., 2004. Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol 5, 897-907. Ritland, K., 2000. Marker-inferred relatedness as a tool for detecting heritability in nature. Molecular Ecology 9, 1195-1204. Ritland, K., 2002. Extensions of models for the estimation of mating systems using n independent loci. Heredity 88, 221-228. Ritter, A.M., Shaw, J.L., Williams, W.M., Travis, K.Z., 2000. Characterizing aquatic ecological risks from pesticides using a diquat dibromide case study. I. Probabilistic exposure estimates. Environmental Toxicology and Chemistry 19, 749-759. Robertson, G., Schein, J., Chiu, R., Corbett, R., Field, M., Jackman, S.D., Mungall, K., Lee, S., Okada, H.M., Qian, J.Q., Griffith, M., Raymond, A., Thiessen, N., Cezard, T., Butterfield, Y.S., Newsome, R., Chan, S.K., She, R., Varhol, R., Kamoh, B., Prabhu, A.-L., Tam, A., Zhao, Y., Moore, R.A., Hirst, M., Marra, M.A., Jones, S.J.M., Hoodless, P.A., Birol, I., 2010. De novo assembly and analysis of RNA-seq data. Nat Meth 7, 909-912. 218 Roelofs, D., Aarts, M.G.M., Schat, H., Van Straalen, N.M., 2008. Functional ecological genomics to demonstrate general and specific responses to abiotic stress. Functional Ecology 22, 8-18. Rogell, B., Dannewitz, J., Palm, S., Petersson, E., Dahl, J., Prestegaard, T., Järvi, T., Laurila, A., 2012. Strong divergence in trait means but not in plasticity across hatchery and wild populations of sea-run brown trout Salmo trutta. Molecular Ecology 21, 2963-2976. Rogers, L.K., Bates, C.M., Welty, S.E., Smith, C.V., 2006. Diquat induces renal proximal tubule injury in glutathione reductase-deficient mice. Toxicology and Applied Pharmacology 217, 289298. Rosenberg, N.A., 2004. distruct: a program for the graphical display of population structure. Molecular Ecology Notes 4, 137-138. Rousset, F., 2008. genepop’007: a complete re-implementation of the genepop software for Windows and Linux. Molecular Ecology Resources 8, 103-106. Rozen, S., Skaletsky, H., 1999. Primer3 on the WWW for general users and for biologist programmers. . Methods in Molecular Biology, pp. 365-386. Russo, J., Lagadic, L., 2004. Effects of environmental concentrations of atrazine on hemocyte density and phagocytic activity in the pond snail Lymnaea stagnalis (Gastropoda, Pulmonata). Environmental Pollution 127, 303-311. Russo, J., Madec, L., 2007. Haemocyte apoptosis as a general cellular immune response of the snail, Lymnaea stagnalis, to a toxicant. Cell Tissue Res 328, 431–441. Rutherford, S.L., 2003. Between genotype and phenotype: Protein chaperones and evolvability. Nature Reviews Genetics 4, 263-274. Sadamoto, H., Takahashi, H., Okada, T., Kenmoku, H., Toyota, M., Asakawa, Y., 2012. De Novo Sequencing and Transcriptome Analysis of the Central Nervous System of Mollusc Lymnaea stagnalis by Deep RNA Sequencing. PLoS ONE 7, e42546. Saint-Laurent, R., Legault, M., Bernatchez, L., 2003. Divergent selection maintains adaptive differentiation despite high gene flow between sympatric rainbow smelt ecotypes (Osmerus mordax Mitchill). Molecular Ecology 12, 315-330. Salice, C.J., Roesijadi, G., 2009. Resistance to cadmium and parasite infection are inversely related in two strains of a freshwater gastropod. Environmental Toxicology and Chemistry 21, 1398-1403. Sanchez, W., Palluel, O., Lagadic, L., Aït-Aïssa, S., Porcher, J.M., 2006. Biochemical effects of nonylphenol polyethoxylate adjuvant, Diquat herbicide and their mixture on the three-spined stickleback (Gasterosteus aculeatus L.). Marine Environmental Research 62, Supplement 1, S29-S33. Sandy, M.S., Moldeus, P., Ross, D., Smith, M.T., 1986. Role of redox cycling and lipid peroxidation in bipyridyl herbicide cytotoxicity. Studies with a compromised isolated hepatocyte model system. Biochemical pharmacology 35, 3095-3101. Scandalios, J.G., 2005. Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Brazilian Journal of Medical and Biological Research 38, 995-1014. Schoville, S., Barreto, F., Moy, G., Wolff, A., Burton, R., 2012. Investigating the molecular basis of local adaptation to thermal stress: population differences in gene expression across the transcriptome of the copepod Tigriopus californicus. BMC Evolutionary Biology 12, 170. Schrader, M., Fahimi, H.D., 2006. Peroxisomes and oxidative stress. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1763, 1755-1766. Schuelke, M., 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18, 233-234. Schultz, I.R., Hayton, W.L., Kemmenoe, B.H., 1995. Disposition and toxicokinetics of diquat in channel catfish. Aquatic Toxicology 33, 297-310. Schwarzenbach, R.P., Egli, T., Hofstetter, T.B., von Gunten, U., Wehrli, B., 2010. Global Water Pollution and Human Health. Annual Review of Environment and Resources 35, 109-136. Schwarzenbach, R.P., Escher, B.I., Fenner, K., Hofstetter, T.B., Johnson, C.A., von Gunten, U., Wehrli, B., 2006. The Challenge of Micropollutants in Aquatic Systems. Science 313, 10721077. Segal, A.W., Shatwell, K.P., 1997. The NADPH Oxidase of phagocytic leukocytesa. Annals of the New York Academy of Sciences 832, 215-222. 219 Semlitsch, R.D., Bridges, C.M., Welch, A.M., 2000. Genetic variation and a fitness tradeoff in the tolerance of gray treefrog (Hyla versicolor) tadpoles to the insecticide carbaryl. Oecologia 125, 179-185. Sessions, A.L., Doughty, D.M., Welander, P.V., Summons, R.E., Newman, D.K., 2009. The Continuing Puzzle of the Great Oxidation Event. Current Biology 19, R567-R574. Sgro, C., Hoffmann, A., 2004. Genetic correlations, tradeoffs and environmental variation. Heredity 93, 241-248. Shan, P., Pu, J., Yuan, A., Shen, L., Shen, L., Chai, D., He, B., 2008. RXR agonists inhibit oxidative stress-induced apoptosis in H9c2 rat ventricular cells. Biochemical and Biophysical Research Communications 375, 628-633. Shirley, M.D., Sibly, R.M., 1999. Genetic basis of a between-environment trade-off involving resistance to cadmium in Drosophila melanogaster. Evolution, 826-836. Smith, C.V., Hughes, H., Lauterburg, B.H., Mitchell, J.R., 1985. Oxidant stress and hepatic necrosis in rats treated with diquat. Journal of Pharmacology and Experimental Therapeutics 235, 172-177. Smith, T.B., Bernatchez, L., 2008. Evolutionary change in human-altered environments. Molecular Ecology 17, 1-8. Snape, J.R., Maund, S.J., Pickford, D.B., Hutchinson, T.H., 2004. Ecotoxicogenomics: the challenge of integrating genomics into aquatic and terrestrial ecotoxicology. Aquatic Toxicology 67, 143154. Son, Y., Cheong, Y.-K., Kim, N.-H., Chung, H.-T., Kang, D.G., Pae, H.-O., 2011. Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? Journal of Signal Transduction Article ID 792639, doi:10.1155/2011/792639. Spellman, P., Rubin, G., 2002. Evidence for large domains of similarly expressed genes in the Drosophila genome. Journal of Biology 1, 5. Spitze, K., 1993. Population Structure in Daphnia obtusa: Quantitative Genetic and Allozymic Variation. Genetics Society of America 135, 367-374. Stearns, S.C., 1989. The Evolutionary Significance of Phenotypic Plasticity. Bioscience 39, 436-445. Sun, L.Y., Bokov, A.F., Richardson, A., Miller, R.A., 2011. Hepatic response to oxidative injury in long-lived Ames dwarf mice. The FASEB Journal 25, 398-408. Sung, B.H., Weaver, A.M., 2011. Regulation of lysosomal secretion by cortactin drives fibronectin deposition and cell motility. BioArchitecture 1, 257-260. Szafraniec, K., Borts, R.H., Korona, R., 2001. Environmental stress and mutational load in diploid strains of the yeast Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences 98, 1107-1112. Szanto, A., Narkar, V., Shen, Q., Uray, I.P., Davies, P.J.A., Nagy, L., 2004. Retinoid X receptors: Xploring their (patho)physiological functions. Cell Death Differ 11, S126-S143. Szczesny, R.J., Obriot, H., Paczkowska, A., Jedrzejczak, R., Dmochowska, A., Bartnik, E., Formstecher, P., Polakowska, R., Stepien, P.P., 2007. Down-regulation of human RNA/DNA helicase SUV3 induces apoptosis by a caspase- and AIF-dependent pathway. Biology of the Cell 99, 323-332. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28, 2731-2739. Tantely, M.L., Tortosa, P., Alout, H., Berticat, C., Berthomieu, A., Rutee, A., Dehecq, J.-S., Makoundou, P., Labbé, P., Pasteur, N., Weill, M., 2010. Insecticide resistance in Culex pipiens quinquefasciatus and Aedes albopictus mosquitoes from La Réunion Island. Insect Biochemistry and Molecular Biology 40, 317-324. Tarres, J., Guillaume, F., Fritz, S., 2009. A strategy for QTL fine-mapping using a dense SNP map. BMC proceedings. BioMed Central Ltd, p. S3. Taylor, M., Feyereisen, R., 1996. Molecular biology and evolution of resistance of toxicants. Molecular Biology and Evolution 13, 719-734. Theodosiou, A., Arhondakis, S., Baumann, M., Kossida, S., 2009. Evolutionary Scenarios of Notch Proteins. Molecular Biology and Evolution 26, 1631-1640. Thomas, C.E., Aust, S.D., 1986. Reductive release of iron from ferritin by cation free radicals of paraquat and other bipyridyls. Journal of Biological Chemistry 261, 13064-13070. 220 UICN, 2012. International Union for Conservation of Nature. Ukeda, H., Maeda, S., Ishii, T., Sawamura, M., 1997. Spectrophotometric assay for superoxide dismutase based on tetrazolium salt 3'-{1- (phenylamino)-carbonyl -3,4-tetrazolium}-bis(4methoxy-6-nitro)be nzenesulfonic acid hydrate reduction by xanthine-xanthine oxidase. Analytical Biochemistry 251, 206-209. Umina, P.A., Weeks, A.R., Roberts, J., Jenkins, S., Mangano, G.P., Lord, A., Micic, S., 2012. The current status of pesticide resistance in Australian populations of the redlegged earth mite (Halotydeus destructor). Pest Management Science 68, 889-896. US-EPA, U.S.E.P.A., 1995. Reregistration eligibility decision: diquat dibromide., Washington, DC. Valavanidis, A., Vlahogianni, T., Dassenakis, M., Scoullos, M., 2006. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicology and Environmental Safety 64, 178-189. Van Oosterhout, C., Hutchinson, W.F., Wills, D.P.M., Shipley, P., 2004. micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4, 535-538. van Straalen, N., Roelofs, D., 2008. Genomics technology for assessing soil pollution. Journal of Biology 7, 1-5. van Straalen, N.M., Feder, M.E., 2011. Ecological and Evolutionary Functional Genomics—How Can It Contribute to the Risk Assessment of Chemicals? Environmental Science & Technology 46, 3-9. van Straalen, N.M., Roelofs, D., 2006. An introduction to Ecological Genomics. Oxford University Press Inc., New York. van Straalen, N.M., Roelofs, D., 2011. An introduction to ecological genomics. OUP Oxford. van Straalen, N.M., Timmermans, M.J.T.N., 2002. Genetic Variation in Toxicant-Stressed Populations: An Evaluation of the “Genetic Erosion” Hypothesis. Human and Ecological Risk Assessment: An International Journal 8, 983-1002. Vandegehuchte, M., Janssen, C., 2011. Epigenetics and its implications for ecotoxicology. Ecotoxicology 20, 607-624. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 3, research0034.0031 - research0034.0011. Veldhoen, N., Kobylarz, M., Lowe, C.J., Meloche, L., deBruyn, A.M.H., Helbing, C.C., 2011. Relationship between mRNA biomarker candidates and location near a marine municipal wastewater outfall in the benthic indicator species Modiolus modiolus (L.). Aquatic Toxicology 105, 119-126. Veldhoen, N., Lowe, C.J., Davis, C., Mazumder, A., Helbing, C.C., 2009. Gene expression profiling in the deep water horse mussel Modiolus modiolus (L.) located near a marine municipal wastewater outfall. Aquatic Toxicology 93, 116-124. Vera, J.C., Wheat, C.W., Fescemyer, H.W., Frilander, M.J., Crawford, D.L., Hanski, I., Marden, J.H., 2008. Rapid transcriptome characterization for a nonmodel organism using 454 pyrosequencing. Molecular Ecology 17, 1636-1647. Villeneuve, D.L., Garcia-Reyero, N., 2011. Vision & strategy: Predictive ecotoxicology in the 21st century. Environmental Toxicology and Chemistry 30, 1-8. Wang, R., Li, C., Stoeckel, J., Moyer, G., Liu, Z., Peatman, E., 2012. Rapid development of molecular resources for a freshwater mussel, Villosa lienosa (Bivalvia:Unionidae), using an RNA-seqbased approach. Freshwater Science 31, 695-708. Wang, Z., Gerstein, M., Snyder, M., 2009. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10, 57-63. Waring, J.F., Jolly, R.A., Ciurlionis, R., Lum, P.Y., Praestgaard, J.T., Morfitt, D.C., Buratto, B., Roberts, C., Schadt, E., Ulrich, R.G., 2001. Clustering of Hepatotoxins Based on Mechanism of Toxicity Using Gene Expression Profiles. Toxicology and Applied Pharmacology 175, 28-42. Watanabe, K.H., Andersen, M.E., Basu, N., Carvan, M.J., Crofton, K.M., King, K.A., Suñol, C., Tiffany-Castiglioni, E., Schultz, I.R., 2011. Defining and modeling known adverse outcome pathways: Domoic acid and neuronal signaling as a case study. Environmental Toxicology and Chemistry 30, 9-21. 221 Weir, B.S., Cockerham, C.C., 1984. Estimating F-Statistics for the analysis of population structure. Evolution 38, 1358–1370. Weitzman, J., 2002. Transcriptional territories in the genome. Journal of Biology 1, 2. Whitehead, A., Pilcher, W., Champlin, D., Nacci, D., 2012. Common mechanism underlies repeated evolution of extreme pollution tolerance. Proceedings of the Royal Society B: Biological Sciences 279, 427-433. Whitlock, M.C., 2008. Evolutionary inference from QST. Molecular Ecology 17, 1885-1896. Whitlock, M.C., Guillaume, F., 2009. Testing for Spatially Divergent Selection: Comparing QST to FST. Genetics 183, 1055-1063. Whitlock, M.C., Ingvarsson, P.K., Hatfield, T., 2000. Local drift load and the heterosis of interconnected populations. Heredity 84, 452-457. Willi, Y., Van Buskirk, J., Hoffmann, A.A., 2006. Limits to the Adaptive Potential of Small Populations. Annual Review of Ecology, Evolution, and Systematics 37, 433-458. Wilson, E.O., Peter, F.M., 1988. Biodiversity. Washington, D.C. Wolf, J.B., 2000. Gene interactions from maternal effects. Evolution 54, 1882-1898. Wolf, J.B.W., Bayer, T., Haubold, B., Schilhabel, M., Rosenstiel, P., Tautz, D., 2010. Nucleotide divergence vs. gene expression differentiation: comparative transcriptome sequencing in natural isolates from the carrion crow and its hybrid zone with the hooded crow. Molecular Ecology 19, 162-175. Wood, Z.A., Schröder, E., Robin Harris, J., Poole, L.B., 2003. Structure, mechanism and regulation of peroxiredoxins. Trends in Biochemical Sciences 28, 32-40. Yeyati, P., Bancewicz, R.M., Maule, J., van Heyningen, V., 2007. Hsp90 Selectively Modulates Phenotype in Vertebrate Development. Plos genetics 3, 431-447. Zalasiewicz, J., Williams, M., Steffen, W., Crutzen, P., 2010. The New World of the Anthropocene. Environmental Science & Technology 44, 2228-2231. Zera, A.J., Harshman, L.G., 2001. The physiology of life history trade-offs in animals. Annu. Rev. Ecol. Syst. 32, 95-126. Zhang, Q., Wang, C., Liu, W., Zhang, X., Zhuang, S., 2012. Evidence for DNA-diquat interaction and cytotoxicity in in vitro rat cells. Environmental Chemistry Letters 10, 35-39. Zimmer, E., Jager, T., Ducrot, V., Lagadic, L., Kooijman, S.A.L.M., 2012. Juvenile food limitation in standardized tests: a warning to ecotoxicologists. Ecotoxicology 21, 2195-2204. 222