Black garden ant (Lasius niger)

Black garden ant (Lasius niger)
Si n ón i mos: Formica pallescens, Formica nigerrima, Lasius transylvanica, Lasius niger subsp. emeryi, Lasius niger
subsp. nitidus, Lasius niger var. alienoniger, Lasius niger var. minimus, Lasius niger var. alieno-niger, Formica nigra
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) Anders Lennver, algunos derechos reservados (CC BY-NC)
Descripción de EOL Ver en EOL (inglés) →
Biology 1
This ant often builds its nest in soil, in tree stumps or under stones or logs, and it frequently nests
beneath paving stones in gardens (4). It may occasionally invade the nests of other species of ants (1).
Colonies number around 5, 500 individuals (1). A wide range of food is eaten, including seeds, flower
nectar, flies and other small insects, which are killed and taken back to the nest. Small black ants also
'milk' aphids, collecting drops of sweet honeydew exuded by the aphids. Aphids may even be taken into
the nest (2). Winged reproductive males and females engage in a mass mating flight in hot, humid
weather during July and August (2). Males die after mating, and females establish new colonies. A
queen mates only once, storing sufficient sperm inside her body to last her lifetime. The mating flight
ensures that the species disperses well, and also increases the chance that males and females from
different nests will mate, avoiding inbreeding, as the winged reproductive adults of different colonies in
one area fly at the same time (3). After finding a suitable location, the queen begins to produce eggs.
The resulting 'workers' are non-reproductive females, who take over the care of the colony. After
hatching, the larvae initially feed on unhatched eggs; they are then fed by the workers on a
regurgitated fluid (3).
Taxonomic history
1 subspecies
Formi ca n i gra Linnaeus, 1758 PDF: 580 (w.) EUROPE. AntCat AntWiki
Taxon omi c h i story
Latreille, 1798 PDF: 43 (q.m.); Wheeler & Wheeler, 1953c PDF: 148 (l.); Hauschteck, 1962 PDF: 219 (k.); Imai
& Kubota, 1972 PDF: 196 (k.).
Combination in Lasius: Fabricius, 1804: 415; in Donisthorpea: Donisthorpe, 1915f: 200; in Formicina
(Donisthorpea): Emery, 1916a PDF: 240; in Acanthomyops: Forel, 1916 PDF: 460; in Lasius: Menozzi, 1921
PDF: 32; Müller, 1923b PDF: 124; Kuznetsov-Ugamsky, 1929a PDF: 26; Wilson, 1955a PDF: 59.
Senior synonym of Lasius pallescens: Mayr, 1861 PDF: 49; of Lasius nigerrima: Emery, 1892c PDF: 162; of
Lasius alienoniger, Lasius emeryi, Lasius nitidus, Lasius minimus, Lasius transylvanica and material of
the unavailable name Lasius pilicornis referred here: Wilson, 1955a PDF: 59; of Lasius alienoniger:
Kutter, 1977c: 14.
Current subspecies: nominal plus Lasius niger pinetorum.
See also: Imai, 1966b PDF: 119; Tarbinsky, 1976 PDF: 134; Kutter, 1977c: 227; Yamauchi, 1979 PDF: 152;
Collingwood, 1982 PDF: 287; Kupyanskaya, 1990a: 219; Seifert, 1992b: 27.
General description 2
7. Lasius niger, Fab.
HNS
Syst. Piez. 415,1. Formica minor, Ray HNS , Hist. Ins. 69.
Swamm. Bill. Nat. t. 16, f. 1 - 11. The small black Ant, Gould, Eng. Ants, ii. 5. La Fourmi toute noire, Geoff.
Ins. Par. ii. 429, 6. Hab. - Britain, Banks.
Distribution
Throughout SLO
Taxonomic treatment
Forel , A., 1886 :
[[ worker ]] et [[ queen ]] recoltes a Hakodate, Japon, par M. Hilgendorf (Musee de Berlin). Ces
exemplaires sont absolument identiques a ceux d'Europe. — Comme cette espece si commune est deja
connue comme habitant toute l'Europe, le Turkestan, le nord de l'Afrique, Madere et les Etats-Unis, on
peut bien admettre maintenant qu'elle habite tout l'hemisphere nord jusqu'a environ 30 degres de
latitude au sud.
Forel , A., 1890 :
Tébessa (jardins).
Smi th , F. :
Syst. Piez. 415,1. Formica minor, Ray , Hist. Ins. 69.
Swamm. Bill. Nat. t. 16, f. 1 - 11. The small black Ant, Gould, Eng. Ants, ii. 5. La Fourmi toute noire,
Geoff. Ins. Par. ii. 429, 6. Hab. - Britain, Banks.
Emery, C., 1893 :
— Canaria, Tenerife (M. Noualhier). Forme typique a scapes et tibias tres poilus.
Ces deux especes sont tres communes en Europe; la deuxieme a ete trouvee aussi dans le nord de
l'Afrique, ou elle a ete probablement importee d'Europe.
Ward , P. S., 2005 :
Forel , A., 1904 :
Chine occidentale (Sze-tschwan, fl. Pasyn-kou, pres de Tschzumse, 2 [[ queen ]], 19. VII; vallee de Maonjukou, 1 [[ queen ]], 20. VII. 1893. Potanin!); Ussuri merid. (Sidemi, 4 [[ worker ]], 20 - 30. VII. 1897.
Jankovsku!); Region transcaspienne (As'- chabad, 1 [[ queen ]], 1896. Ahkger!); Transcaucasie (Borzom,
Likani, attires par la lumiere electr., 3 [[ queen ]], 8 [[ male ]], 12. VII. 1901. R. Schmidt!; Gouv. Kutais,
Artvin, 2 [[ worker ]], 23. VI. 1898. Derjugin!).
Forel , A., 1894 :
Pas de longs poils epais, couches, jaunes sur l'abdomen.
Habitat 1
Although found in a wide range of habitats, this ant is perhaps most familiar as a garden species (4). It
also occurs in scrubland and wet areas. It can only survive in grasslands providing that there are either
stones or mounds of the yellow meadow ant (Lasius flavus) present (1).
Associations 3
Animal / guest
larva of Clytra laeviuscula is a guest in nest of Lasius niger s.s.
In Great Britain and/or Ireland:
Animal / predator
Lasius niger s.s. is predator of larva (early instart) of Chrysolina graminis
Remarks: Other: uncertain
Animal / honeydew feeder
Lasius niger s.s. feeds on honeydew Aphis ochropus
Animal / honeydew feeder
Lasius niger s.s. feeds on honeydew Aphis gentianae
Lifespan, longevity, and ageing 4
Maximum longevity: 28 years Observations: Like in other species of ants, there are major differences in
longevity between queens and workers. Workers normally live up to 1-2 years while queens have can
live up to 28 years (Parker et al. 2004).
Barcode data: lasius niger 5
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There are 3 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member
of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other
sequences.
ACTATTTTTTCTCTTCATATTGCTGGAATATCTTCTATTCTAGGAGCTATCAATTTTATTTCAACTATTATAAATATACATCATAA
-GCTATCACTATACTTCTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCTGGTGGTGGTGATCCTATTTTATACCAAC
-GAAACATTTGGATCTTTAGGAATAATTTATGCTTTAATAGCAATTGGATTTTTAGGATTTGTTGTATGAGCTCATCATATATTTA
--ACTCTTCATGGTACA--AAAATCAATAATAATTCTTCCTTATGATGAGCAATAGGATTTATCTTCTTATTCACCATAGGAGGTTTAACAGGAGTGATACTT
-TTATCAATAGGAGCAGTATTTGCTATTATTGCTAGATTTATTCACTGATTTCCCTTAATAACTGGTTTCTCTTTAAATAATTTCTT
-- end -Download FASTA File
Status 1
Widespread and very common (1).
Threats 1
This ant is not currently threatened.
Conservation 1
No conservation action has been targeted at this species.
References
1. © Wildscreen, some rights reserved
2. Smith, F. (1851): List of the specimens of British animals in the collection of the British Museum.
Part VI. - Hymenoptera Aculeata. London, British Museum: 2-3,
URL:http://antbase.org/ants/publications/8200/8200.pdf
3. © BioImages, some rights reserved
4. © Joao Pedro de Magalhaes, some rights reserved
5. © Barcode of Life Data Systems, some rights reserved