Télécharger - Institut Pasteur de Tunis

Commentaires

Transcription

Télécharger - Institut Pasteur de Tunis
ANALYSE MUTATIONNELLE DU GENE BRCA1 DE
PREDISPOSITION HEREDITAIRE AUX CANCERS
SEIN/OVAIRE CHEZ LA FEMME TUNISIENNE
S. MESTIRI 1, K. MONASTIRI 1, S. BEN AHMED 2, N. BOUAOUINA 3, N. PRESNEAU4, Y.
J. BIGNON 4, H. KHAIRI 5 ET L. CHOUCHANE 1*.
Laboratoire d'Immuno-Oncologie Moléculaire, Faculté de Médecine de Monastir, Université du Centre, Tunisie.
Département de Carcinologie Médicale, CHU. Farhat Hached, Sousse, Tunisie.
3
Département de Cancérologie Radiothérapie, CHU. Farhat Hached, Sousse, Tunisie.
4
Laboratoire d'Oncologie Moléculaire, INSERM CRI 9502/EA 2145, Centre Jean Perrin, BP392, 58 rue Montalembert, 63011 Clermont-Ferrand Cedex 1, France.
5
Service de Gynécologie Obstétrique, CHU. Farhat Hached, Sousse, Tunisie.
* Auteur Correspondant
Ce travail a été présenté, partiellement, sous forme de communication orale, dans le colloque de Génétique et de
Cytogénétique Humaine, le 9-10 Mai 1997 à Sousse.
1
2
RESUME
ABSTRACT
Le gène BRCA1 est un gène de prédisposition héréditaire
au cancer du sein. Les mutations germinales du gène
BRCA1 interviennent dans 5 à 10% des cas de cancer
du sein. Le but de cette étude est de rechercher les mutations du gène BRCA1 chez des femmes tunisiennes
ayant un cancer du sein familial ou sporadique.
Les auteurs ont utilisé le test de la protéine tronquée
(PTT) et le séquençage d'ADN pour détecter les mutations du gène BRCA1 chez 12 familles tunisiennes
atteintes d'un cancer du sein héréditaire et la technique ASO-PCR (Allele Specific Oligonucleotide-PCR)
pour détecter les mutations 185delAG et 1294del40
chez 150 cas de cancer du sein sporadique.
Une mutation non sens a été retrouvée, par PTT, au
niveau de l'exon 11 du gène BRCA1 pour un cas familial. Aucune mutation n'a été détectée, par séquençage
sur le reste des exons du gène BRCA1. Une mutation
1294del40, chez un cas de cancer du sein non familial,
a été trouvée. La mutation 185delAG n'a été retrouvée
chez aucun des patients.
Cette étude suggère que des mutations germinales du
gène BRCA1 sont impliquées dans le cancer du sein
en Tunisie. La mutation 185delAG est absente chez les
femmes arabes tunisiennes.
Mots clés: Cancer du sein, gène BRCA1, mutation
185delAG, mutation 1294del40, PTT et ASO-PCR.
BRCA1 is a breast cancer susceptibility gene. Germline mutations in BRCA1 gene are found in 5 to 10%
of breast cancer. The aim of this study is to screen the
tunisian women with familial or sporadic breast cancer for BRCA1 gene mutations.
The authors used the Protein Truncation Test (PTT)
and DNA sequencing to detect BRCA1 gene mutations in 12 tunisian families with breast cancer
and the Allele Specific Oligonucleotide-PCR (ASOPCR) to detect the 185delAG and 1294del40 mutations in 150 tunisian womens with sporadic breast
cancer.
A nonsens mutation was found, by PTT, in exon 11
of BRCA1 gene in one case of familial breast cancer. No mutation in the rest of exons was found by
the DNA sequencing. The BRCA1 1294del40 mutation was found only in a patient with non familial
breast cancer.
The 185delAG mutation was absent in all cases of
breast cancer.
These data suggest that the germline mutation of
BRCA1 is implicated in breast cancer in Tunisia and
that the 185delAG mutation is absent in arab tunisian women.
Key Words: Breast cancer, BRCA1 gene, 185delAG
mutation, 1294del40 mutation, PTT and ASO-PCR.
INTRODUCTION
Le gène BRCA1 est un gène majeur de prédisposition
héréditaire au cancer du sein. En 1990, le gène BRCA1 a
été localisé au niveau de la région 21 du bras long du
chromosome 17 1 et en 1994 il a été identifié par clonage
positionnel 2. Il s'agit d'un grand gène constitué de 5592
nucléotides distribués sur 100 kb d'ADN génomique. Il est
A r c h s . I n s t . P a s t e u r T u n i s , 2000, 7 7 (1/2/3/4)
formé de 24 exons dont 22 seulement codent pour une
protéine de 1863 acides aminés et de 220 kDa, les exons
1 et 4 sont des exons non codants. La protéine BRCA1 est
une protéine suppresseur de tumeur qui agit de façon
négative sur la différenciation et la prolifération cellulaire,
elle joue aussi un rôle dans la réparation de l'ADN 3,4.
11
ANALYSE MUTATIONNELLE DU GENE BRCA1 EN TUNISIE
Les mutations germinales du gène BRCA1 sont retrouvées dans 5 à 10% des cas de cancer du sein, 40 à 50%
des cas des cancers du sein héréditaires et elles représentent un facteur de risque très important (85%) dans
le développement de la maladie 5. Plusieurs mutations
ont été retrouvées sur le gène BRCA1, la mutation 185
de lAG est parmi les mutations les plus fréquentes 6. La
majorité des mutations sont des mutations non sens
qui conduisent à une protéine tronquée par décalage du
cadre de lecture par insertion ou délétion de bases et
production d'un codon stop prématuré 7.
Le but de notre étude est de rechercher les mutations
du gène BRCA1 chez des femmes tunisiennes présentant un cancer du sein sous une forme sporadique ou
familiale.
POPULATIONS ET METHODES
1- POPULATIONS
Notre étude a été menée sur deux populations différentes de femmes originaires du centre tunisien.
- Une population de douze familles, avec des cas
familiaux de cancer du sein, a été sélectionnée
selon les critères d'inclusion du groupe "Génétique et cancer" de la Fédération Nationale française des centres de lutte contre le cancer. Ces
critères se résument en trois cas de cancer du sein
ou deux cas du cancer du sein avec un cas de
cancer de l'ovaire chez des femmes liées au premier ou au deuxième degré et appartenant à la
même branche parentale ou la présence d'au moins
deux cas de cancer du sein chez des femmes liées
au premier degré, dont l'un au moins est bilatéral
ou diagnostiqué avant l'âge de 40 ans 8.
- Une population de 150 femmes ne présentant
aucun cas de cancer du sein dans la famille, représente les cas de cancer du sein "sporadiques". Le
diagnostic de cancers du sein a été basé sur l'étude
anatomo-pathologique.
2- METHODES
a- Extraction de l'ADN
L'ADN génomique est extrait des lymphocytes à partir
de 5 ml de sang périphérique en utilisant le principe de
la précipitation des protéines, par une solution saline
concentrée, selon la technique décrite par Olerup et al.
(1992) 9. Les lymphocytes sont centrifugés et lavés avec
l'eau. Le culot est incubé avec la protéinase K à 56°C.
Les protéines précipitées avec du NaCl saturé sont éliminées après centrifugation. L'ADN restant dans le surnageant est précipité avec l'éthanol et récupéré dans
400µl d'eau.
b- Le test de la protéine tronquée ou PTT
(Protein Truncation Test)
Le PTT identifie les altérations de l'ADN de type mutations non sens qui entraînent la formation de codon
stop et l'arrêt prématuré de la traduction de la protéine. Ce test est basé sur la synthèse protéique in vitro
à partir d'un fragment d'ADN amplifié par PCR à l'aide
d'une amorce contenant en 5' un promoteur de transition T7 et une séquence ATG d'initiation de la traduction 7, 10.
L'amplification de l'exon 11, par PCR, a été réalisée à
53°C avec une extension de 1min 30 sec et une autoextension de 3 sec à chaque cycle. Le Kit TNTTM T7 coupled Reticulocyte Lysate System (Cat. No. L4610,
Promega) a été utilisé pour l'analyse de cet exon par
PTT. La réaction a été effectuée selon les instructions
usuelles avec 10µCi de 35 S-Methionine (Amersham). La
protéine synthétisée a été séparée sur un gel SDS-polyacrylamide 12% avec un tampon TRIS-glycine. Le gel a
été exposé toute TMune nuit, à température ambiante, à un
film (Hyperfilm -MP; Amersham).
c- Le séquençage d'ADN
Le fragment d'ADN à séquencer a été amplifié par
PCR selon le protocole de Laplace et al (1999) 11. Le
produit de PCR, purifié sur une colonne sephadex
G50, a migré sur un minigel d'agarose de 1,5% afin
d'évaluer la qualité de l'ADN. L'ADN purifié a été utilisé dans la réaction de séquençage (Kit PRISM Ready
Reaction; Applied Biosystems) dont le produit a été
déposé sur un gel dénaturant de polyacrylamide 6%
en présence de 8,3M d'urée. La migration a été effectuée dans un séquenceur automatique 373A pendant
une nuit. La séquence a été analysée par SEQUENCE
NAVIGATOR (Applied Biosystems) au laboratoire
d'Oncologie Moléculaire du Pr. Y. J. Bignon, centre
Jean Perrin, Clermont-Ferrand.
d- ASO-PCR (Allele Specific Oligonucleotide-PCR)
La ASO-PCR est une technique très sensible et spécifique à une mutation. Il s'agit d'une PCR dans laquelle
nous utilisons des amorces qui amplifient de façon
spécifique l'ADN susceptible d'avoir la mutation
Tableau 1 - Séquence des amorces utilisées dans ASO-PCR
Mutation
185delAG
Exon
2
1294del40
11A
Amorce
S-delAGwt
A-delAGwt
A-delAGmut
S-del40wt
A-del40wt
A-del40mut
Séquence (5’-3’)
ttcattggaacagaaagaaa
cagatgggacactct
cagatgggacactaa
taagcagaaactgccatgct
cagctactttggcatttga
cagctactttggcatttgt
A: Amorce anti-sens; S: Amorce sens
12
A r c h s . I n s t . P a s t e u r T u n i s , 2000
S. MESTIRI et coll.
185delAG ou 1294del40. La réaction de PCR est réalisée dans un volume total de 50µl contenant 1,5 mM
MgCl2, 200µM dNTP, 100 ng de chaque amorce
(Tableau 1), 2,5 U Taq polymérase et 10 ng d'ADN
génomique de sujets atteints de cancer du sein sporadique. La PCR est initiée par une étape de dénaturation
à 94°C pendant 5 minutes suivie par 35 cycles de 1
minute à 94°C, 1 minute à 57°C ou 55°C pour les mutations 185delAG et 1294de l40 respectivement, 2 minutes
à 72°C et une étape finale d'extension de 10 minutes à
72°C. Le produit de PCR est analysé sur un gel d'agarose
de 2% et visualisé par marquage par le bromure d'éthidium 12.
e- Stratégies d'étude
Pour les cancers familiaux, nous avons analysé par
PTT l'exon 11 chez les 12 familles. Le reste des exons
a été analysé par le séquençage systématique.
Pour les cancers sporadiques, nous nous sommes limités à rechercher deux mutations par ASO-PCR: la mutation 185delAG et la mutation 1294del40.
RESULTATS
1 - ANALYSE MOLECULAIRE DES MUTATIONS
DE BRCA1 DANS LES CAS FAMILIAUX DU
CANCER DU SEIN.
Le test de la protéine tronquée a permis d'identifier
une altération de la taille de la protéine BRCA1 chez un
cas familial du cancer du sein (Figure 1).
Le séquençage d'ADN des exons 2 à 24 (sauf l'exon 4)
du gène BRCA1 des cas familiaux n'a pas permis de
retrouver une anomalie quelconque du gène BRCA1, y
compris la mutation 185delAG.
Figure 1: Analyse par PTT de l'exon 11 du gène BRCA1:
elle révèle une protéine tronquée et une protéine normale
pour le cas index (M) et seulement une protéine normale
pour une parente non malade (N). T: Témoin positif T7
contrôle (Luciférase, 64 KD).
Tome 7 7 (1/2/3/4)
2 - RECHERCHE DE LA MUTATION
185DELAG
Les allèles mutés et sauvages du gène BRCA1 ont été
recherchés par ASO-PCR. En absence de mutations,
les amorces S-delAGwt et A-delAGwt amplifient un
fragment d'ADN de 98pb alors qu'aucune amplification n'est observée avec les amorces S-delAGwt et AdelAGmut. Si la mutation 185delAG est homozygote, les
amorces S-delAGwt et A-delAGmut amplifient un fragment d'ADN de 96pb. L'ADN hétérozygote pour cette
mutation est amplifié aussi bien avec S-delAGwt et AdelAGwt qu'avec S-delAGwt et A-delAGmut.
Pour notre étude, nous avons testé 150 échantillons,
aucun échantillon n'a montré la mutation 185delAG.
3 - RECHERCHE DE LA MUTATION 1294DEL40
L'ASO-PCR réalisée sur des échantillons non mutés
amplifie un fragment d'ADN de 162pb avec les amorces
S-del40wt et A-del40wt. Aucune amplification n'est
observée avec les amorces S-del40wt et A-del40mut.
Lorsque l'échantillon est hétérozygote pour la mutation
1294del40, la ASO-PCR produit un fragment de 162pb
avec S-del40wt et A-del40wt et un fragment de 122pb
avec S-del40wt et A-del40mut.
Sur les 150 échantillons de cancer du sein sporadique
testés pour la mutation 1294del40, un seul échantillon
porte la mutation de façon hétérozygote (Figure 2).
Figure 2: Etude de la mutation 1294del40 du gène BRCA1
par ASO-PCR.
Le produit de PCR est analysé par électrophorèse sur un gel
d'agarose.
L'échantillon sauvage (S -/-), montre une amplification
d'un fragment d'ADN de 162pb avec les amorces sauvages
S-del40wt et A-del40wt (wt), pas d'amplification avec les
amorces S-del40wt et A-del40mut (mut).
L'échantillon muté hétérozygote (M +/-) montre une amplification d'un fragment de 162pb avec les amorces Sdel40wt et A-del40wt (wt) et un fragment de 122pb avec les
amorces S-del40wt et A-del40mut (mut).
13
ANALYSE MUTATIONNELLE DU GENE BRCA1 EN TUNISIE
DISCUSSION
Le gène BRCA1 est un gène majeur de prédisposition
héréditaire au cancer du sein. La grande taille et le
nombre élevé de mutation rapporté dans la littérature
13
rendent l'étude des mutations du gène BRCA1 compliquée et coûteuse 14. Nombreuses stratégies d'analyse de ces mutations sont utilisées, la plus rentable est
celle commençant par l'étude de l'exon 11 par le test de
la protéine tronquée. En effet, l'exon 11 est le plus
grand exon du gène BRCA1, il couvre 61% de la
séquence codante du gène. De plus, comme 90% environ des anomalies du gène sont des mutations frameshift et des mutations non sens, le test de la protéine
tronquée a de forte chance de repérer une terminaison
précoce de la protéine 7, 15.
D'autres stratégies ciblent certaines mutations connues
du gène BRCA1 pour estimer leur fréquence dans une
population donnée de femmes. Plusieurs techniques de
biologie moléculaire sont utilisées telles que la SSCP
(Single Strand Conformation Polymorphism), l'hétéroduplex, la TGGE (Temperature Gradient Gel Electrophoresis) et la ASO-PCR (Allele Specific Oligonucleotide
-PCR). Contrairement à la SSCP, l'hétéroduplex et la
TGGE, la ASO-PCR est une technique rapide réalisée en
une seule étape, non radioactive, très sensible et spécifique à une seule mutation.
Afin d'analyser les mutations du gène BRCA1, deux
populations de femmes tunisiennes, atteintes de cancer
du sein à contexte familial ou sporadique, ont été sélectionnées. Deux stratégies moléculaires ont été adoptées:
dans les cas de cancers du sein familial, l'analyse mutationnelle de l'exon 11 a été réalisée par le test de la protéine tronquée puis par un séquençage systématique
des exons 2 à 24 ( sauf l'exon 4). Cette analyse a permis d'identifier une protéine tronquée chez une famille
sur 12. La synthèse de cette protéine tronquée serait due
à une mutation non sens (en cours de caractérisation
moléculaire). La fréquence des mutations germinales de
BRCA1 serait donc de 8,3% chez la population de
femmes tunisiennes atteintes de cancer du sein héréditaire.
Dans le cas des cancers du sein sporadique, deux
mutations 185delAG et 1294del40 ont été ciblées. La
mutation 185delAG est une mutation framshift qui
entraîne le décalage du cadre de lecture, elle est fréquente chez les Juives Ashkénazes et représente 13%
des mutations caractérisées sur le gène BRCA1 16. La
délétion d'une adénine et d'une guanine en position 185
est retrouvée dans 16% des cas de cancer du sein héréditaire et 39% des cancers de l'ovaire héréditaires chez
les femmes Juives ashkénazes 17.
Fodor et al. (1998)18 ont recherché la mutation
185delAG du gène BRCA1 chez 268 femmes juives ashkénazes ayant un cancer du sein sporadique. En utilisant l'ASO-PCR, ils ont démontré que la mutation
185delAG a une fréquence de 3%. Ce résultat suggère
14
que la fréquence de la mutation 185delAG diminue
lorsqu'il s'agit de cas de cancer du sein sans histoire
familiale.
Une étude récente19 a montré que la mutation 185delAG
est présente chez des juifs non Ashkénazes (juifs maghrébins et irakiens) avec une fréquence comparable à
celle des juifs Ashkénazes.
Notre étude n'a retrouvé aucune mutation 185delAG
aussi bien pour les cas sporadiques que les cas familiaux. Ce résultat suggère que cette mutation est absente
chez les tunisiennes arabes, malgré des origines communes avec des juifs non ashkénazes.
La mutation 1294 de l40 est l'une des mutations non sens
de l'exon 11 du gène BRCA1, elle est fréquente chez les
familles irlandaises (2 familles sur 11 présentent la mutation) et elle entraîne l'arrêt prématuré de la traduction protéique. Notre étude, effectuée sur la population des cas
sporadiques, n'a identifié qu'une seule mutation
1294del40, soit un cas sur 150. Cette mutation aurait
donc, une fréquence de 0,66% chez les femmes tunisiennes atteintes de cancer mammaire sporadique.
A l'instar de nombreux travaux dans les pays occidentaux 20, 21,11, 22 nous avons démontré l'implication du gène
BRCA1 dans la prédisposition au cancer du sein chez
la femme tunisienne. Le rôle majeur de ce gène dans la
survenue du cancer du sein familial est confirmé dans
notre population (1 mutation sur 12). Ce rôle semble
beaucoup plus restreint dans les cancers du sein sporadiques (1 mutation sur 150). Néanmoins, par notre
stratégie d'analyse moléculaire nous avons probablement sous-estimé le rôle réel du gène BRCA1 dans la
survenue du cancer du sein chez la femme tunisienne,
une étude avec un effectif beaucoup plus important
permettrait de vérifier nos résultats. Par ailleurs, d'autres
mutations que celles recherchées auraient pu être impliquées ou d'autres gènes de susceptibilité au cancer du
sein comme le gène BRCA2 et le gène TP53 23 pourraient être incriminés. En effet, le gène BRCA2 serait
impliqué dans environ 75% des prédispositions héréditaires aux cancers mammaires des femmes jeunes
non liées à BRCA1 24.
BIBLIOGRAPHIE
1- J. M. Hall, M. K. Lee, B. Newman et al. (1990).
Linkage of early onset familial breast cancer to
chromosome 17q21. Science. 250: 1684 - 1689
2- Y. Miki, J. Swensen, D. Shattuck-Eidens et al.
(1994). A strong candidate for the breast and ovarian cancer susceptibility gene BRCA. Science. 266:
66 - 71.
3- D. Bertwistle and Ashworth A. (1998). Fonctions of the BRCA1 and BRCA2 genes. Curr. Opin.
Genet. Dev., 8: 14 - 20
4- X. Yang and Lippman M. E. (1999). BRCA1 and
BRCA2 in breast cancer. Breast Cancer Res. Treat.
54: 1 - 10.
A r c h s . I n s t . P a s t e u r T u n i s , 2000
S. MESTIRI et coll.
6 - F. J. Couch and Weber B. L. (1996). Mutations
and polymorphisms in the familial early-onset
breast cancer (BRCA1) gene. Breast information
core. Hum. Mutat. 8: 8 - 18
5 - D. Ford, D. F. Easton and Peto J. (1995). Estimates of the gene frequency of BRCA1 and its
contribution to breast and ovarian cancer incidence. Am. J. Hum. Genet. 57: 1457-1462
7 - F. B. L. Hogervorst, R. O. Cournelis, M. Bout
et al. (1995). Rapide detection of BRCA1 mutations by the protein truncation test. Nature Genet.
10: 208 - 212
8- Groupe "Génétique et cancer", Fédération nationale des centres de lutte contre le cancer (1994).
Mise en place d'un protocole évalué de dépistage du
cancer du sein chez les femmes reconnues à risque
génétique. Patho. Biol. 42: 109 - 113
9- O. Olerup and Zetterquist H. (1992). HLA-DR
typing by PCR amplification with sequence specific primers (PCR-SSP) in 2 hours: an alternative to
serological DR typing in clinical practice including
donor-recipient matching in cadaveric transplantation. Tissue Antigens. 39: 225 - 235
10- S. A. Gayther, P. Harrington, P. Russell et al.
(1996). UKCCCR Familial Ovarian Cancer Study
Group. Rapid detection of regionally clustered
germ-line BRCA1 mutations by multiplex heteroduplex analysis. Am. J. Hum. Genet. 58: 451 - 456
11- V. Laplace-Marieze , N. Presneau, V. Sylvain et
al. (1999). Systematic sequencing of the BRCA1
coding region for germline mutation detection in 70
French breast-ovarian cancer families. Int. J. Oncol.
14 (5): 971 - 7
12- S. Richter and Seth A. (1998). One step direct
detection of recurrent mutations in the breast cancer susceptibility gene BRCA1. Inter. J. Oncol. 12:
1263 - 1267
13- W. Moore, I.. Bogdarina, U. A. Patel, M.Perry
and Crane-Robinson C. (2000). Mutation detection in the breast cancer gene BRCA1 using the
protein truncation test. Mol. Biotechnol. 14 (2): 89
- 97
Tome 7 7 (1/2/3/4)
14- R. Nowak (1994). Many mutations may make test
difficult. Science. 266: 1470
15- J. M. Lancaster, C. J. Cochran, H. A. Brownlee
et al. (1996). Detection of BRCA1 mutations in
women with early-onset ovarian cancer by use of
the protein truncation test. J. Natl. Cancer Inst. 88:
552 - 54
16- J. P. Struewing, D. Abeliovich, D. T. Peretz et al.
(1995). The carrier frequency of the BRCA1
185delAG mutation is approximately 1 percent in
Askhenazi Jewish individuals. Nat. Genet. 11: 198
- 200
17- R. Scully , J. Chen, A. Plug et al. (1997). Association of BRCA1 with Rad 51 in mitotic and meiotic cells. Cell. 88: 265 - 275
18- F. H. Fodor, A. Weston, I. J. Bleiweiss et al.
(1998). Frequency and carrier risk associated with
common BRCA1 and BRCA2 mutations in Ashkenazi jewish breast cancer patients. Am. J. Hum.
Genet. 63: 45 - 51
19- R. B. Bar-Sade, L.Theodor , E. Gak et al. (1997).
Could the 185delAG BRCA1 mutation be an ancient
Jewish mutation ? Eur. J. Hum. genet. 5 (6): 413 - 6
20- O.Johannsson , E.A. Ostermeyer, S. Hakansson et al. (1996). Founding BRCA1 mutations in
hereditary breast and ovarian cancer in Southern
Sweden. Am. J. Hum. Genet. 58: 441 - 450
21- A. Petrij-Bosch, T. Peelen, M. Van Vliet et al.
(1997). BRCA1 genomic deletions are major founder mutations in Dutch breast cancer patients.
Nature Genet. 17: 341 - 345
22- B. Gorski, T. Byrski, A. Jakubowska et al. (2000).
Founder mutations in the BRCA1 gene in Polish
families with breast-ovarian cancer. Am. J. Hum.
Genet. 66: 1963 - 1968
23- A. Katsama, G. Sourvinos, G. Zachos and Spandidos D.A. (2000). Allelic loss at the BRCA1,
BRCA2 and TP53 loci in human sporadic breast carcinoma. Cancer Letters. 150: 165 - 170
24- H.Takahashi , H.C. Chin, C.A. Bandera et al.
(1996). Mutations of the BRCA2 in ovarian carcinomas. Cancer Res. 56: 2738 - 2741
15