Hybridation moléculaire Southern blots

Commentaires

Transcription

Hybridation moléculaire Southern blots
Travaux dirigés UE BIO24c
Techniques de biologie moléculaire
Hybridation moléculaire
Southern blots
Enzymes de restriction
Fréquence de sites de restriction sur un chromosome:
1 / 46 = 1 / 4096 pb
Extraction ADN
chromosomique
Coupures par enzymes
de restriction
Séparation des fragments d’ADN par électrophorèse
Southern blot
Transfert sur membrane de nylon
Sonde marquée
Hybridation
Révélation
ATGGCATGGACC
::::::::::::
CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA
E
sonde
E
6 kb
E
sonde
5 kb
E
E
2 kb
E
E
E
E
sonde
8 kb
E
- 8 kb
- 6 kb
- 5 kb
E
Isolats de Yersinia pestis
Tour aéro-réfrigérante
Isolats cliniques
Et comment fabriquer les sondes?
Différents environnements
Amplification d’ADN par PCR
Polymerase Chain Reaction
3’
Amorces
5’*
3’
*5’
3’
*5’
*5’
3’
Si n le nombre de cycles, accroissement de la quantité d’ADN = 2n.
Possibilité de marquage radioactif des amorces, et donc de tous les fragments d’ADN
Fonctionnel sur des quantités infimes d’ADN
Applications: clonage, isolement d’ADN d’échantillons faiblement concentrés:
•Environnements divers
•Prélèvements cliniques…
Analyses de l’expression des gènes:
La transcription
Northern blot
Objectifs:
•un gène est-il transcrit?
•Dans quelles conditions?
•A quel niveau?
Principe:
ARNr 23S
ARNr 16S
ARNr 5S
Résultats:
Sonde = gène de virulence
Membrane : Hybridation
Sonde = contrôle
Gel ARN
Sonde
Gène de virulence
Extension d’amorces
Objectifs:
•un gène est-il transcrit?
•Dans quelles conditions?
•A quel niveau?
•Où est le site d’initiation de sa transcription?
•Peut-on en déduire la séquence du promoteur?
Principe
Résultats:
Séquençage d’ADN
Gène d’intérêt
Amorce marquée (20b)
Séquençage d’ADN
Analyses de l’expression des gènes:
La transcription et la traduction
Les fusions transcriptionnelles et traductionnelles
Objectifs:
•Mesurer la transcription et/ou la traduction d’un gène
•Dans quelles conditions?
•A quel niveau?
Résultats:
Principe:
Gène rapporteur:
lacZ: activité
lux: luminescence
-galactosidase
gfp, yfp, cfp: fluorescence
Analyses de l’expression des gènes:
Les protéines
Western blot
Objectifs:
•une proteïne est-elle synthétisée?
•Dans quelles conditions?
•A quelle quantité?
Principe:
ou luminescent
Résultats:
Ac primaire protéine 3
Ac primaire protéine 2
Ac primaire protéine 1
Ac primaire contrôle
Interactions ADN - protéines
Electrophorectic Mobility Shift Assay (EMSA)
Gel retard
Objectifs:
•une proteïne se fixe-t-elle sur l’ADN?
•Dans quelles conditions?
•A quelle affinité?
Principe:
Résultats:
Contrôles?
Empreintes à la DNase
Objectifs:
•une proteïne se fixe-t-elle sur l’ADN?
•Sur quelle séquence?
•A quelle affinité?
Principe:
ADN seul
Pas de protéine
5’
5’
ADN + protéine
5’
5’
+ DNase
Mélange de
molécules
Migration
Empreinte
Empreintes à la DNase
Résultats:

Documents pareils