Performance of 18S rDNA helix E23 for phylogenetic relationships

C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
© 2000 Académie des sciences/Éditions scientifiques et médicales Elsevier SAS. Tous droits réservés
S0764446900012300/FLA
Taxonomy / Taxinomie
Performance of 18S rDNA helix E23 for
phylogenetic relationships within and between the
Rotifera–Acanthocephala clades
Anne Miquelisa, Jean-François Martinb, c, Evan W. Carsond, Guy Bruna, André Gillesa*
a
Laboratoire d’hydrobiologie, UPRES Biodiversité 2202, université de Provence, 1, place Victor-Hugo,
13331 Marseille, France
b
Laboratoire de systématique évolutive, UPRES Biodiversité 2202, université de Provence, 1, place VictorHugo, 13331 Marseille, France
c
Rocky Mountain Biological Laboratory, Crested Butte, CO 81224, USA
d
Department of Biology, Arizona State University, Tempe, AZ 85287-1501, USA
Received 16 February 2000; accepted 19 June 2000
Communicated by André Adoutte
Abstract – The species diversity of the phylum Rotifera has been largely studied on the
basis of morphological characters. However, cladistic relationships within this group are
poorly resolved due to extensive homoplasy in morphological traits, substantial phenotypic plasticity and a poor fossil record. We undertook this study to determine if a
phylogeny based on partial 18S rDNA, which included the helix E23 of 18S rDNA
sequence, was concordant with established taxonomic relationships within the order
Ploimida (class: Monogononta). We also estimated the level of polymorphism within
clones and populations of Ploimida ‘species’. Finally, we included the Cycliophora
Symbion pandora as outgroup and the variable helix E23 region to examine the influence
of their signal on the evolutionary relationships among Acanthocephala, Bdelloidea and
Ploimida. Phylogenetic reconstruction was performed using maximum parsimony, neighbour joining and maximum likelihood methods. We found 1) that morphologically
similar Ploimida ‘species’ show vastly different 18S E23 rDNA sequences; 2) inclusion of
the helix E23 of 18S rDNA and its secondary structure analysis results in better resolution
of family level relationships within the Ploimida; 3) an impact of Symbion pandora as an
outgroup with inclusion of the helix E23 on the relationships between the Rotifera and
the Acanthocephala; and 4) partial incongruence and differential substitution rate
between conserved region and helix E23 region of the 18S rDNA gene depending on the
taxomic group studied. © 2000 Académie des sciences/Éditions scientifiques et médicales Elsevier SAS
Rotifera / Acanthocephala / 18S rDNA / Ploimida systematic / substitution rate
Résumé – Performance de l’hélice E23 du 18S ADNr pour les relations phylogénétiques entre et au sein du clade Rotifera-Acanthocephala. L’étude de la diversité spécifique des rotifères a longtemps reposé sur l’analyse des caractères morphologiques. Or, l’existence d’homoplasie au sein de ces caractères ainsi que l’importante
plasticité phénotypique et la rareté des fossiles ne permettent qu’une faible résolution
des relations phylogénétiques au sein de ce groupe. Notre étude a été réalisée afin de
confronter une phylogénie basée sur une portion du 18S ADNr (incluant l’hélice E23,
région variable) avec les relations taxinomiques préalablement définies sur la base des
* Correspondence and reprints: [email protected]
925
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
caractères morphologiques au sein de l’ordre des Ploimida (classe des Monogononta).
Nous avons, en outre, estimé le degré de polymorphisme entre clones et populations
« d’espèces » de Ploimida. Enfin, nous avons utilisé le Cycliophora Symbion pandora
comme groupe extérieur et nous avons inclus l’hélice E23, région variable, afin
d’examiner leur influence respective sur les relations phylogénétiques entre Acanthocephala, Bdelloidea et Ploimida. Les méthodes du « maximum de parcimonie », du
« neighbor joining » et du « maximum likelihood » ont été utilisées dans le cadre des
reconstructions phylogénétiques. Nous avons trouvé 1) que les « espèces» de Ploimida
morphologiquement identiques ont des séquences de 18S ADNr différentes ; 2) que
l’inclusion de l’hélice E23 du 18S ADNr et son analyse en structure bidimensionnelle
permettent de réincorporer l’information qu’elle contient, entraînant ainsi une meilleure
résolution des relations entre familles au sein des Ploimida ; 3) que le groupe extérieur
Symbion pandora et l’inclusion de l’hélice E23 ont un impact majeur sur les relations
entre rotifères et acanthocéphales ; et 4) qu’il y a une incongruence partielle ainsi que
des taux de substitution différents entre région conservée et hélice E23 au sein du 18S
ADNr suivant le groupe taxonomique étudié. © 2000 Académie des sciences/Éditions
scientifiques et médicales Elsevier SAS
Rotifera / Acanthocephala / 18S ADNr / systématique des Ploimida / taux de substitution
Version abrégée
Les 2 000 espèces constituant le phylum des Rotifera
sont réparties en trois classes : Monogononta, Bdelloidea et Seisonidea. Malgré l’existence de nombreuses
données morphologiques, ultrastructurales et allozymiques, les relations phylogénétiques ne sont que faiblement résolues dans ce groupe. Or, de récentes études
de phylogénie moléculaire réalisées au sein des Aschelminthes suggèrent l’existence d’un clade RotiferaAcanthocephala. D’autres analyses moléculaires font
des acanthocephales un sous taxon des rotifères.
La présente étude basée sur l’utilisation d’une portion de 500 pb du 18S ADNr a pour but d’analyser les
variations génétiques au sein de ce groupe. Cela inclut
une estimation du taux de polymorphisme observé
entre clones et populations appartenant à l’ordre des
Ploimida (classe des Monogononta) ainsi que, la définition des relations existant entre Bdelloidea, Ploimida
et Acanthocephala. Nous incluons dans l’analyse l’hélice
E23, région variable du 18S ADNr et nous utilisons
comme groupe extérieur le Cycliophora Symbion pandora.
Les Ploimida sont prélevés dans différents habitats
dans le sud-est de la France. Après identifications
réalisées sur la base de caractères morphologiques,
cinq espèces representées par dix clones issus chacun
d’une femelle parthénogénétique sont cultivés en laboratoire. L’ADN total de tous ces Ploimida est ensuite
extrait et un fragment de 500 pb du 18S ADNr est alors
amplifié par PCR. Les huit séquences d’acanthocéphales, ainsi que celles du Bdelloidea, de deux autres
Ploimida et du Cycliophora proviennent de GenBank.
Les séquences sont alignées manuellement puis comparées en structure secondaire. Cette procédure permet de localiser deux portions conservées (C1 = posi-
926
tions 1 à 186 et C2 = positions 432 à 500) ainsi qu’une
région variable (hélice E23 = positions 187 à 431). Trois
méthodes d’analyse sont utilisées : le neighbor-joining
(NJ), le maximum de parcimonie (MP) et le maximum
de vraisemblance (ML pour Maximum Likelihood en
anglais). Différentes méthodes sont utilisées pour tester
la topologie des arbres et la robustesse des nœuds.
La composition en bases des Ploimida est faiblement
biaisée (A+T = 56,41 %), mais aucune différence significative n’est observée entre les espèces. Le taux de
divergence des séquences de 18S ADNr des différents
genres de Ploimida peut atteindre 5 %. L’utilisation de
la structure secondaire du 18S ADNr montre que les
substitutions prédominent dans l’hélice E23. Le taux de
transitions par rapport aux transversions diminue rapidement avec l’augmentation de la divergence moléculaire totale, cependant aucun effet de saturation n’est
observé entre les différents profils de substitution. Afin
de tester l’influence des régions conservées et de
l’hélice E23 sur la reconstruction phylogénétique, ces
parties sont analysées séparément puis conjointement.
Pour la région conservée (nucléotides 1 à 186 et 432
à 500), seules 62 positions sont informatives. La valeur
du g1 est de –1,175, ce qui indique que ce jeu de
données contient un signal phylogénétique significatif.
Les valeurs du IC (indice de cohérence) et du IR (indice
de rétention) sont respectivement de 0,762 et 0,836,
indiquant un faible taux d’homoplasie. Le test du taux
de vraisemblance montre que les topologies obtenues
par chacune des trois méthodes d’analyses (MP, NJ et
ML) ne sont pas significativement différentes.
Pour l’hélice E23 (nucléotides 187 à 431), 127 sites
sont informatifs pour la parcimonie. Les valeurs de IC
et de IR sont respectivement de 0,716 et 0,792. Les trois
méthodes d’analyse donnent là encore des topologies
ne présentant pas de différence significative. On
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
observe pour cette région variable une plus grande
homogéneité, des longueurs de branche entre les
groupes, que celle obtenue avec les parties conservées.
Si on considère l’intégralité de la portion du 18S
ADNr séquencée (nucleotides 1 à 500), le test d’homogénéite des partitions indique une incongruence entre
région conservée (C1-C2) et hélice E23 (hE23). Un
retrait itératif des taxa démontre que cette incongruence est due à un manque de signal phylogénétique
dans la région conservée (C1-C2) chez les Ploimida
mais pas chez les Acanthocephala. Ce manque de
signal phylogénétique n’est pas détecté par le g1.
Nous démontrons dans cette étude que, la suppression de l’hélice E23 n’est pas justifiée dans le cadre
d’une analyse des liens phylogénétiques entre Rotifera
et Acanthocephala. Nous démontrons, en outre, que
l’hélice E23 contient une information phylogénétique
plus grande que celle des regions conservées pour la
résolution des genres de Ploimida. Nous observons
également que l’hélice E23 et les régions conservées
n’évoluent pas au même taux aussi bien à l’intérieur
des groupes (Ploimida, Bdelloidea, et Acanthocephala)
que entre eux, augmentant de ce fait l’hétérogéneite
dans les longueurs de branches entre les différents
taxa. Les régions conservées montrent une violation de
l’uniformité du taux de substitution plus grande que
celle observée dans la partie variable. Notre étude
montre des résultats nouveaux et robustes sur les liens
phylogénétiques entre Rotifera et Acanthocephala qui
redeviendraient deux clades distincts tout en restant
des groupes frères. Ces résultats demandent à être
complétés par l’étude de nouveaux gènes nucleaires
afin de confirmer le fort signal phylogénétique contenue dans l’hélice E23.
1. Introduction
cephala. However, due to alignment difficulties, some of
these studies have excluded the variable helix E23 region
of 18S rDNA and obtained an unstable position of the
Bdelloidea (Rotifera) [33, 34]. On the other hand, Garey et
al. [32, 35] obtained a stable position of the Bdelloidea
grouped with Acanthocephala but with a very long branch.
Finally, Near et al. [36] analysed the phylogenetic relationships of the Acanthocephala by including no new
rotifer species and no outgroup. So it was impossible for
instance to confirm (or infirm) the monophyly of Rotifera.
Because the helix E23 may provide critical phylogenetic
information for resolving the position of the Bdelloidea,
removal of this region may not be justified. Therefore, we
have included the helix E23 to determine if its inclusion
increases phylogenetic resolution and we have chosen
Symbion pandora (Cycliophora) as outgroup, a close relative of the Rotifera–Acanthocephala clade [37].
The phylum Rotifera contains approximately 2 000
aquatic, semi-aquatic and ectoparasitic species [1], which
are divided into three classes: Monogononta, Bdelloidea
and Seisonidea [2]. Establishment of systematic relationships within this phylum has been challenging due to high
levels of phenotypic plasticity, asexual mode of reproduction (strict or not), succession of sibling species in the same
environment over time [3, 4] and introgression between
species of the same group [5]. Several character sets have
been used to examine the phylogenetic relationships of
this group, including ultrastructure [6–12], mating behaviour [13–16] and allozymes [3, 17–19], yet relationships
among ‘species’ remain uncertain.
Molecular phylogenetic studies of Aschelminthes have
suggested a clade consisting of Rotifera and the endoparasitic phylum Acanthocephala [20, 21]. This clade contains
at least 1 150 endoparasitic species divided into three
classes: Archiacanthocephala, Palaeacanthocephala and
Eoacanthocephala [22, 23]. Even though this relationship
has also been supported by morphological and comparative ultrastructural studies, it is still controversial [24–31].
More recent molecular studies have even placed Acanthocephala within the Rotifera [32–35]. In order to gain a
better understanding of the evolution of Rotifera and Acanthocephala, it is critical that the systematic position of the
Bdelloidea be resolved with more certainty.
In this study, we used a 500-bp region of 18S rDNA to
examine patterns of genetic variation within and among
various rotifer groups. This included estimation of levels of
polymorphism within clones and populations of the order
Ploimida (class: Monogononta), and reconstruction of relationships among taxa within and between Ploimida, Bdelloidea and Acanthocephala. Earlier studies [32, 33] have
used this gene in an attempt to resolve the position of
Bdelloidea relative to other Rotifera and the Acantho-
2. Materials and methods
2.1. Biological samples
Rotifers of the order Ploimida were sampled from different habitats in southeast France (table I). Morphological
characters were measured for 30 individuals from each
clone (see below) to identify specimens to species [38].
Ten clones descended from a single parthenogenetic
female (for each of the five putative species), were maintained in 2 mL of low-mineral water at 17 °C under a
15L/9D photoperiod. Food used for cultures were algal
(Chlorella vulgaris and Dunaliella tertiolecta) or rotifer
(Brachionus angularis – clone from Saint-Gilles, France)
depending on natural diet. Frequent sub-cultures were
made to prevent production of males. Exclusion of males
prevented genetic recombination, which only occurs during the sexual phase of the Monogononta life cycle [39].
Rotifers were sampled within each clone at regular inter-
927
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Table I. List of species and Genbank accession numbers.
Specimen name
Systematic position
Sequence name
Brachionus angularis
Monogononta, Ploimida, Brachionidae
B. angularis1
B. angularis2
Brachionus calyciflorus
Monogononta, Ploimida, Brachionidae
B. calyciflorus
Brachionus plicatilis1
Monogononta, Ploimida, Brachionidae
B. plicatilis1
Brachionus plicatilis2
Monogononta, Ploimida, Brachionidae
B. plicatilis2
Brachionus plicatilis3
Monogononta, Ploimida, Brachionidae
B. plicatilis3
Keratella quadrata1
Monogononta, Ploimida, Brachionidae
K. quadrata1
Keratella quadrata2
Monogononta, Ploimida, Brachionidae
K. quadrata2
Asplanchna priodonta1
Monogononta, Ploimida, Asplanchnidae
A. priodonta1
Asplanchna priodonta2
Monogononta, Ploimida, Asplanchnidae
A. priodonta2
Asplanchna priodonta3
Monogononta, Ploimida, Asplanchnidae
A. priodonta3
Asplanchna priodonta4
Monogononta, Ploimida, Asplanchnidae
A. priodonta4
Asplanchna priodonta5
Monogononta, Ploimida, Asplanchnidae
A. priodonta5
Synchaeta tremula1
Monogononta, Ploimida, Synchaetidae
S. tremula1
Synchaeta tremula2
Monogononta, Ploimida, Synchaetidae
S. tremula2
Synchaeta sp.1
Monogononta, Ploimida, Synchaetidae
S. sp.1
Synchaeta sp.2
Monogononta, Ploimida, Synchaetidae
S. sp.2
Philodina acuticornis
Bdelloidea,Bdelloida, Philodinidae
P. acuticornis
Macracanthorhynchus ingens
Archiacanthocephala, Oligacanthorhynchida, Oligacanthorhynchidae M. ingens
Moniliformis moniliformis
Archiacanthocephala, Moniliformida, Moniliformidae
M. moniliformis
Neoechinorhynchus pseudemydis Eoacanthocephala, Neoechinorhynchida, Neoechinorhynchidae
N. pseudemydis
Plagiorhynchus cylindraceus
Palaeacanthocephala, Polymorphida, Plagiorhynchidae
P. cylindraceus
Polymorphus altmani
Palaeacanthocephala, Polymorphida, Polymorphidae
P. altmani
Corynosoma enhydri
Palaeacanthocephala, Polymorphida, Polymorphidae
C. enhydri
Centrorhynchus conspectus
Palaeacanthocephala, Polymorphida, Centrorhynchidae
C. conspectus
Echinorhynchus gadi
Palaeacanthocephala, Echinorhynchida Echinorhynchidae
E. gadi
Symbion pandora
Cycliophora
S. pandora
vals, then placed in three successive 45-min baths to clear
the intestinal tract [40]. This procedure ensured that each
individual used in subsequent analyses had an empty
digestive tract during final harvest (checked with 50×
power dissecting scope), before being stored at –80 °C.
Because the genus Asplanchna is carnivorous, individuals
were starved for 24 h prior to harvesting to minimize
genetic contamination from their rotifer food, B. angularis.
Suitable food for the Synchaetidae was not available for
culture; therefore, field collections of Synchaetidae species (Synchaeta tremula, Synchaeta sp1 and Synchaeta
sp2) were made, individuals identified, and stored at
–80 °C.
Origin
Rhône river
Rhône river
‘Landre’ mere
U29235
U49911
‘Bolmon’ mere
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
‘Grans’ pond
U41281
AF001844
Z19562
U41400
AF001839
AF001838
AF001837
U41399
U88335
Y14811
Fragments were directly sequenced from the purified PCR
products using an automated sequencer (Genome Express
S.A.) and the PCR primers. Sequences were obtained from
GenBank for the following taxa (see table I for accession
codes): Bdelloidea (Philodina acuticornis), two Ploimida
(Brachionus plicatilis1 and Brachionus plicatilis2), eight
Acanthocephala and the Cycliophora (Symbion pandora).
2.2. Molecular data
For Ploimida individuals, total DNA was extracted
according to the method of Taberlet and Bouvet [41] and a
500-bp segment of 18S rDNA gene was amplified by
standard PCR techniques using the following primers: 5’
CCACATCCAAGGAAGGCAGCAGGC 3’ (forward) and 5’
CCCGTGTTGAGTCAAATTAA 3’ (reverse). Thermal cycle
parameters were as follows: 2 min at 92 °C (1 cycle); 15 s
at 92 °C, 45 s at 48 °C, 1 min 30 s at 72 °C (5 cycles); 15 s
at 92 °C, 45 s at 52 °C, 1 min at 72 °C (30 cycles); 7 min at
72 °C (1 cycle). A second, higher annealing temperature
of 52 °C was used for more stringent annealing conditions
when necessary. The PCR products were purified following the Gelase protocol (EpicentreT) and stored at –20 °C.
928
Figure 1. Relationships of two distance measures with the proportion
of nucleotide differences (p distance) for the positions 1–500.
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
2.3. Data analysis
All 18S rDNA sequences were aligned manually using
MUST [42] and compared with the secondary structure
alignment [43]. Visualization of the secondary structure
was made using RNAviz [44], which allowed for identification of the three distinct regions described by Winnepenninckx et al. [21] and Garey et al. [32]: two conserved segments (C1 = positions 1 to 186 and C2 = 432 to
500), separated by a variable stretch corresponding to
helix E23 (helix E23 = positions 187 to 431).
Phylogenetic analyses were performed using three different methods: 1) the neighbour-joining (NJ) method [45]
based on a matrix of the Jukes and Cantor distance [46]
and the Jukes and Cantor distance with an estimation of
alpha parameter equal to 1.22; in Mega [47]. These two
distance measures showed similar relationships with the
proportion of nucleotide differences (p distance) (figure 1);
2) A cladistic approach following the maximum parsimony (MP) criterion (Branch and bound search of PAUP*);
and 3) maximum likelihood (ML) framework was used to
choose a model which best explains the data [48, 49].
Figure 2. Part of the secondary structure of the 18S rRNA gene of Brachionus plicatilis showing the complete helix E23. Nucleotides that are
polymorphic in Ploidmida are shown in bold.
929
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Table II. Position of substitutions for the different Ploimida clones. See figure 1 for the structural links (* represents a gap).
Figure 3. Saturation curves for transitions versus transversions (positions 1–500).
General time reversible with a gamma distribution was the
best fit model, but the likelihood of this tree was not
significantly different to the tree obtained by the Felsenstein’s method [50] using PAUP*. So, due to the computer
time calculation, robustness of nodes was estimated by
bootstrap with 100 replicates for ML analysis on Felsenstein’s method [50] (using FastDNAML version 1.0 [51],
1 000 replicates for NJ (using Mega) and 1 000 replicates
for MP trees (heuristic search of PAUP* with ten random
additions of taxa and TBR branch-swapping).
Incongruence between partition based on conserved
and/or helix E23 of 18S rDNA sequences was assessed by
the partition homogeneity test (PHT) [52] as implemented
in PAUP* with alpha = 0.01 and 0.001. To test the robustness of deep branches in the tree two constraint trees were
built, with each one defining monophyly for one of the
930
groups, and the following statistics were computed: Bremer’s decay index [53]; differences in topology between
trees were assessed by Templeton’s test (Wilcoxon signrank tests [54]) and the likelihood ratio test [55]. Relative
rate tests were conducted using Phyltest [56].
3. Results
3.1. Evolutionary patterns of 18S rDNA for Ploimida
The Ploimida exhibited slight base composition bias in
A + T content (56.41%); however, there were no significant differences in individual nucleotide compositions
within or between species. Base frequencies (in percent)
were A: 26.7, C: 16.6, G: 27.0 and T: 29.7. Different
genera within Ploimida show 18S rDNA sequences that
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
differ by up to 5% (appendix). For instance, the level of
differentiation (mean of pair-wise nucleotide differences
and standard error) within Brachionus plicatilis was very
low (0.0028 ± 0.0012, appendix), while it was very high
for the two clones of Keratella quadrata (0.0211 ± 0.0066,
appendix). For Synchaeta sp. (the only specimens not
cloned), levels of variation between the sequences were
0.09–1.7% (appendix). For Asplanchna priodonta, we
found considerable variation among the five clones, ranging from 0.00422 to 0.0211. To ensure that this variation
was not due to genetic contamination, one or two additional amplifications were examined for each cloned specimen. These sequences were identical to the original in all
cases except B. angularis, where we found two different
sequences with a level of variation of 0.0063. Furthermore, no differences were found among sequences from
amictic females (i.e. produce diploid egg by mitosis),
males and mictic females of the K. quadrata1 clone,
indicating that no genetic recombination occurred during
cloning.
We also examined the variation in 18S sequences by
localizing substitutions with respect to secondary structure using the Vawter and Brown [57] nomenclature to
name the different structures. In Ploimida sequences, there
were 51 substitutions, one deletion in a loop region and
two insertions (B. plicatilis2 was used as reference for the
secondary structure). All these substitutions appear predominantly in the helix E23. We observed eight substitutions (= 17.02%) in loops (47 bases) and twenty-seven
substitutions (= 10.03%) in stems (269 bases), three pairs
of which were compensational. The bulges (82 bases)
contained six substitutions (= 7.31%) and the ‘other’ (75
bases) showed eleven substitutions plus two nucleotide
insertions (= 17.33%). Only two multiple substitutions
occurred in loops and three in stems (table II and figure 2).
In the C1 region 2.68% of the positions were phylogenetically informative (number of informative positions/length
of the region), 2.89% in C2, and 8.16% in the helix E23
region. It can also be seen that all non-homoplasic sites are
located in the helix E23 region. Therefore, for the remainder of the study we partitioned the 500-bp segment of the
18S rDNA gene in conserved (C1–C2) and helix E23 (hE23)
regions.
Many studies have shown that stem, loop and bulge
regions of the ribosomal DNA structure exhibit nearly
equivalent rates of evolution [57], although structureassociated biases in base composition do exist (G/C rich
Figure 4. A. Ratio of transitions to transversions versus percentage
divergence for all pair-wise comparisons except those between identical taxa (positions 1–500).
B. For the conserved zone (positions 1–186 and 432–500).
C. For the helix E23 region (positions 187–431). Saturation curves for
transitions versus transversions (positions 1–500).
for stem and A/T rich for the loops and ‘other’). Our
analysis of base composition revealed no significant differences between regions or taxa. The A + T bias in
Ploimida was similar to that in Acanthocephala, Cycliophora and Bdelloidea. The ratio of transitions to transversions showed a rapid decline (figure 3) with increasing
total molecular divergence, but no saturation effects were
Table III. Characteristics of the phylogenetic data from partial 18S rDNA sequences.
Segment
hE23
C 1 + C2
C1 + C2 + hE23
Number
of trees
11
24
236
Number
of steps
395
181
592
CI
RI
g1
0.72 0.79 –0.97
0.76 0.84 –1.18
0.71 0.79 –1.04
Parsimony
Estimation of gamma
shape parameter*
Informative
characters
Other variable Constant
characters
characters
127
62
189
50
46
96
68
147
215
α = 2.69
α = 0.99
α = 1.22
* Yang-Kumar method 1996 [72].
931
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. A. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the conserved region (positions 1–186
and 432–500) among 26 ‘species’ of Ploimida, Acanthocephala and Bdelloidea, with Cycliophora as an outgroup: using maximum parsimony
(bootstrap value on the top left and branch length value at the bottom), neighbour joining on a matrix of the Jukes and Cantor model (middle
bootstrap value) and maximum likelihood (right bootstrap value) on a matrix of the Jukes and Cantor model. The likelihood ratio test and
Templeton’s test indicate that the three trees are not significantly different in topology so only the maximum parsimony tree is shown. The decay
index value is in bold next to the nodes.
observed between different substitution patterns (figure 4).
Therefore, the entire 500-bp segment of 18S rDNA was
used to study phylogenetic relationships between Rotifera
and Acanthocephala, with Cycliophora as an outgroup. In
order to test the influence of conserved regions and helix
E23 on phylogenetic reconstruction, we also analysed
these regions separately (sequences descriptions are found
in table II.
932
3.2. Phylogenetic analysis
3.2.1. Conserved region (nucleotides 1–186 and 432–500)
Of the 254 positions in the conserved region, only 62
were informative for standard unweighted parsimony. The
g1 value was –1.175, suggesting that the 18S rDNA data
set contains significant phylogenetic signal, and the CI
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. B. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the helix E23 (positions 187–431). The
likelihood ratio test and Templeton’s test indicate that the three trees are not significantly different in topology so we show only the maximum
parsimony tree.
(consistency index) and RI (retention index) (0.762 and
0.836, respectively) indicated a low level of homoplasy
(table III).
The three tree-making methods (MP, NJ and ML) produced similar topologies, and the likelihood ratio test
(LRT) shows that the three trees are statistically indistinguishable. These topologies all displayed a basal
dichotomy with Bdelloidea and Acanthocephala forming
one cluster and Ploimida forming a large, separate group
(figure 5.a). The statistical support for this branching pattern is high (BP > 50 %; decay index = 11) but the branch
of the Bdelloidea is extremely long in comparison with the
other taxa (46–69 steps in parsimony). However, separate
analyses conducted using maximum parsimony for
Ploimida and Acanthocephala (using successive addition
or removal of Philodina acuticornis) produced no significant difference in the internal structure of the Ploimida or
Acanthocephala. The unresolved topology in the Ploimida
is not surprising, as there are few parsimony informative
sites. In fact, all Ploimida species clustered into a basal
polytomy,
except
Brachionus
calyciflorus
and
K. quadrata2, which apparently grouped together due to
stochastic homoplasy.
3.2.2. Helix E23 (nucleotides 187–431)
There are 127 parsimony informative sites, which produce a tree (figure 5.b) with CI and RI values of 0.716 and
0.792, respectively (table III). The three methods produced
similar topologies and the likelihood ratio test (LRT) did
not reject the null hypothesis of topological congruence
933
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Table IV. Alpha values obtained from the test for incongruence of Farris et al. [52] implemented in Paup*
Partitions
Total data set
Ploimida + Acanthocephala
Ploimida
Ploimida + Bdelloidea
Acanthocephala
Acanthocephala + Bdelloidea
Number of
iterations
C1/helix E23
C2/helix E23
C1/C2
C1/C2/helix E23
100
1000
100
1000
100
1000
100
1000
100
1000
100
1000
0.010
0.001
0.010
0.007
0.110
0.127
0.110
0.138
0.250
0.199
0.570
0.583
0.060
0.054
0.050
0.039
0.010
0.010
0.020
0.017
0.820
0.824
0.380
0.367
0.540
0.531
0.420
0.398
0.230
0.265
0.310
0.336
1.000
1.000
1.000
1.000
0.010
0.002
0.010
0.003
0.020
0.008
0.050
0.011
0.620
0.616
0.580
0.564
Table V. Relative rate test (Takezaki et al. [73] implemented in Phyltest [56]). We used Symbiom pandora as outgroup.
C1 + C2**
∆L = La – Lb
Rotifera
Ploimida/Ploimida
B. plicatilis–K. quadrata
A. priodonta–B. plicatilis
S. tremula–B. plicatilis
A. priodonta–S. tremula
K. quadrata–S. tremula
K. quadrata–A. priodonta
Rotifera
Bdelloidea/other
P. acuticornis–Ploimida
P. acuticornis–Archiacanthocephala
P. acuticornis–Eoacanthocephala
P. acuticornis–Palaeacanthocephala
Rotifera
Ploimida/Acanthocephala
Ploimida–Archiacanthocephala
Ploimida–Eoacanthocephala
Ploimida–Palaeacanthocephala
Rotifera
Acanthocephala/Acanthocephala
Archiacanthocephala–Eoacanthocephala
Archiacanthocephala–Palaeacanthocephala
Eoacanthocephala–Palaeacanthocephala
hE23***
Z value
∆L = La – Lb
C1 + C2 + hE23****
Z value
∆L = La – Lb
Z value
–0.011 7
0.011 3
0.003 8
0.007 5
0.015 5
0.023 0
–
–
–
–
–
*
–0.022 3
–0.013 1
0.005 1
–0.018 2
0.017 2
0.035 4
–
–
–
–
–
–
–0.016 3
–0.013 0
–0.000 9
–0.012 1
0.017 3
0.029 4
–
–
–
–
–
*
0.231 2
0.191 7
0.150 8
0.038 8
*
*
*
–
0.174 7
0.148 8
–0.020 5
–0.149 5
*
–
–
–
0.224 5
0.186 1
0.096 6
–0.363 6
*
*
–
–
–0.039 5
–0.080 4
–0.192 4
–
*
*
–0.025 9
–0.195 3
–0.324 2
–
*
*
–0.038 4
–0.127 9
–0.260 9
–
*
*
–0.040 9
–0.152 9
–0.112 0
–
*
*
–0.169 3
–0.298 3
–0.129
*
*
–
–0.089 5
–0.222 5
–0.133 0
*
*
*
1
* Indicates significant deviation at the null hypothesis (5 % level) from a constant rate molecular clock (–: Indicates non significant deviation);
**distance used: Juke and Cantor distance alpha = 0.99; ***distance used: Juke and Cantor distance alpha = 2.69; ****distance used: Juke and
Cantor distance alpha = 1.22.
among trees. Interestingly, we established for this region a
homogeneity in the branch lengths (figure 5.b) between
the different groups. This pattern was due to a better
uniformity of the rate of substitution for the whole data set
than that obtained for the conserved regions alone (table
V).
Acanthocephala are monophyletic and represented by
the
two
distinct
clades
ArchiacanthocephalaEoacanthocephala and Palaeacanthocephala (figure 5.b).
These relationships were highly supported in bootstrap
tests of MP, NJ and ML trees. Within Palaeacanthocephala,
there are clearly two orders: Echinorhynchida and Polymorphida. Phylogenetic relationships within Polymorphida remained largely unresolved.
934
The Bdelloidea representative clustered with Ploimida
in MP, NJ and ML trees. The Ploimida consists of four
monophyletic groups: Brachionus, Keratella, Synchætidae
and Asplanchnidae. Phylogenetic relationships between
B. angularis and B. calyciflorus indicate a paraphyletic
grouping (figure 5.b). The position of Bdelloidea as a sister
group of Ploimida was supported by a decay index of 9.
Similarly, monophyly of the class Monogononta is supported (figure 5.b). Templeton’s test indicated that the
Bdelloidea position in the (Acanthocephala, (Bdelloidea,
Ploimida)) topology was significantly different from both a
((Acanthocephala, Bdelloidea), Ploimida) topology and a
(Acanthocephala, Bdelloidea, Ploimida) trichotomy. Suc-
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. C. Bootstrap analyses carried out with 1 000 iterations (only 100 for maximum likelihood) using the conserved and helix E23 (positions
1–500).
cessive addition or removal of the three different groups
did not change the internal topology of the remaining
phyla.
3.2.3. Conserved + helix E23 (nucleotides 1–500)
The partition homogeneity test (PHT) between conserved (C1–C2) and helix E23 (hE23) segments of 18S
rDNA indicated incongruence between these two regions
(table IV). By iteratively removing taxa, we observed that
this incongruence was because of a lack of phylogenetic
signal in the Ploimida conserved region (C1–C2). Therefore, we combine the two conserved stretches (C1 and C2)
and helix E23 (hE23) to study the impact of the incongruence of these two regions (detected for the Ploimida) on
the topology and the branch length of the tree based on the
whole data set.
Regardless of the phylogenetic inference method used,
both the Rotifera and Acanthocephala were monophyletic. There are, however, topological differences within
groups, depending on the sequence segment used (i.e.
C1 + C2, hE23, C1 + C2 + hE23). We find that within Acanthocephala, the main difference between trees based on
conserved regions and those based on the helix E23 is the
position of Eoacanthocephala. In this case, a combined
analysis produced a tree similar to that obtained using
only the helix E23 stretch (figure 5.b and c). In the case of
the order Ploimida, A. priodonta clones and the family
Synchaetidae are monophyletic; however, monophyly of
the genus Brachionus is not supported. Interestingly, we
observed that the helix E23 and conserved regions do not
evolve at the same rate within and among Ploimida,
935
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. D. Strict consensus of the eleven most parsimonious trees (395 steps with a C.I. = 0.72 and a R.I. = 0.79) using the helix E23 (positions
187–431).
Bdelloidea and Acanthocephala (table V), increasing the
heterogeneity in the branch lengths between the different
taxa (figure 5.e). The conserved regions show more violation of rate uniformity than the more variable regions.
4. Discussion
Species determination and phylogenetic reconstruction
of Ploimida–Bdelloidea–Acanthocephala has been a challenge due to: 1) high levels of morphological homoplasy
among extant species [1, 22]; and 2) a scarcity of positively identified fossil Rotifera [58–60]. Therefore, molecular phylogenetics provides an additional avenue of
research. This approach has been used previously in the
936
study of Rotifera and Acanthocephala [32, 35]; but many
questions remain unanswered about Rotifera polyphyly
due to a possible long branch attraction to Bdelloidea. We
have attempted to resolve these questions by analysing a
previously excluded helix E23 with the 18S rDNA. We
also used the helix E23 to address family level relationships of the Ploimida (Rotifera) and ordinal and familial
relationships of the Acanthocephala.
4.1. Differentiation in Ploimida clones
and phylogenetic utility of 18S rDNA for Ploimida
The extensive 18S rDNA polymorphism observed in
clones for different Ploimida species (Asplanchna sp.,
Keratella sp., Brachionus sp., Synchæta sp.) is in agreement with previous findings from allozyme [3, 17–19],
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. E. Bootstrap analyses carried out with 1 000 iterations using neighbour joining on a matrix of the Jukes and Cantor model with gamma
shape parameter α = 1.22 for the conserved and helix E23 (positions 1–500).
genetic [61, 62] and morphological studies ([63], Rougier,
pers. comm.). Also, a strict consensus of the eleven most
parsimonious trees (figure 5.d) indicated a Brachionidae
clade (Brachionus + Keratella) closely related to the Synchaetidae. This clade was the sister group of the A. priodonta clones. The existence of the Brachionidae clade is
not surprising since the genus Keratella has traditionally
been included within the Brachionidae family (Keratella
was originally considered to be in a distinct family due to
absence of a foot, but this distinction was considered too
tenuous to warrant classification as a separate family [64]).
However, these results have bootstrap support only in
neighbour joining. Brachionus and Keratella were found
in a polytomy with Synchaeta and Asplanchna in parsimony.
We found an unexpected 18S sequence difference
between two sequences of 18S rDNA from the same
cloned B. angularis individual (0.00634). This result is
easily reproduced experimentally and may be due to
hybridization or ancestral polymorphism. Distinguishing
between these possibilities would require further experi-
mentation, though doing so was not necessary for the
purposes of this study since this divergence within the
clone did not affect the tree topology.
While phylogenies based on the helix E23 and conserved plus helix E23 regions were consistent with the
accepted relationships, only those based on the helix E23
region had high bootstrap support. The weakly supported
nodes (based on conserved plus helix E23 regions) could
result from non-constant rates of evolution within and
among families (table V), and between conserved and
helix E23 regions. The high disparity of evolutionary rates
was observed in the foraminifera for which an extreme
difference was found in rates of molecular evolution [65].
The observed variation in rates of evolution could be
erroneous if some species in Ploimida are actually more
closely related to basal taxa than to other Ploimida; however, this would suggest that well-supported topologies
based on the helix E23, as well as results from morphological, allozyme and other genetic studies, are all grossly
and concordantly incorrect.
937
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Figure 5. F. Bootstrap analyses carried out with 1 000 iterations using neighbour joining on a matrix of the Jukes and Cantor model with gamma
shape parameter α = 2.69 for the conserved and helix E23 (positions 187–431).
4.2. Systematics of Acanthocephala
Regardless of the data subset used for phylogenetic
reconstruction (hE23, C1 + C2 + hE23), our results were
consistent with the monophyly of Acanthocephala and
monophyly of two of the three currently recognized acanthocephalan classes (the third class, Eoacanthacephala,
was only represented by one species). Thus, greater phylogenetic resolution was obtained with molecular data
when the sequence from the helix E23 region was included,
as opposed to the sequence from conserved regions alone.
Inclusion of the helix E23 region still did not provide high
bootstrap support for inter-family relationships within the
order Polymorphida (samples for the other orders consisted of only one or two families). However, our topology
was in general agreement with that of Near et al. [36], in
which high bootstrap support was found for these relationships by using the complete 18S rDNA sequence.
938
4.3. Systematic position of Bdelloidea and Rotifera–
Acanthocephala relationships
We have demonstrated that removal of the helix E23 is
not justified because it is useful in reconstructing systematic relationships within both Rotifera and Acanthocephala, as separate analysis of the helix E23 provided
better intra-group resolution for Ploimida and Acanthocephala than that obtained by analysis of the conserved
regions alone. We observed that the helix E23 and conserved regions do not evolve at the same rate within and
among Ploimida, Bdelloidea and Acanthocephala (table
V, figure 5.e and f), inducing an heterogeneity in the
branch lengths between these three groups when we
combine the two regions. The fact that no saturation
effects were observed between different substitution patterns (figure 4) removes the possibility of an artefact in the
estimation of the substitution rate [66]. In this case using
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
Brachionus plicatilis1
Brachionus plicatilis2
Brachionus plicatilis3
Keratella quadrata1
Keratella quadrata2
Brachionus calyciflorus
Brachionus angularis1
Brachionus angularis2
Synchaeta sp.1
Synchaeta tremula1
Synchaeta tremula2
Synchaeta sp.2
Asplanchna priodonta1
Asplanchna priodonta 2
Asplanchna priodonta3
Asplanchna priodonta4
Asplanchna priodonta5
1
2
3
0.002 1
0.004 2
0.038 1
0.036 0
0.034 0
0.019 1
0.012 7
0.016 9
0.023 3
0.025 4
0.027 5
0.023 3
0.029 6
0.035 9
0.035 9
0.027 5
0.002 1 0.003 0
0.002 1
0.002 1
0.035 9 0.038 0
0.033 8 0.031 7
0.031 8 0.029 7
0.016 9 0.014 8
0.010 6 0.008 5
0.014 8 0.016 9
0.021 1 0.019 0
0.023 2 0.025 3
0.025 3 0.027 4
0.021 1 0.023 2
0.027 4 0.029 5
0.033 8 0.031 6
0.033 8 0.031 6
0.025 3 0.027 4
4
5
6
0.008 8 0.008 6 0.008 3
0.008 5 0.008 3 0.008 1
0.008 8 0.008 1 0.007 8
0.006 6 0.009 7
0.021 1
0.007 8
0.046 6 0.029 7
0.038 1 0.027 5 0.023 4
0.031 7 0.025 4 0.021 2
0.029 5 0.027 5 0.033 9
0.033 8 0.029 6 0.036 0
0.038 0 0.031 7 0.038 1
0.035 9 0.035 9 0.044 5
0.035 9 0.033 8 0.044 5
0.038 0 0.035 9 0.048 7
0.048 5 0.040 2 0.046 6
0.046 4 0.040 2 0.053 0
0.040 1 0.038 1 0.048 7
7
8
9
0.006 3
0.005 9
0.005 6
0.008 8
0.007 5
0.007 0
0.005 2
0.004 7
0.004 2
0.008 1
0.007 2
0.006 6
0.003 7
0.005 9
0.005 5
0.005 9
0.007 8
0.007 5
0.008 3
0.005 9
0.004 7
0.006 3
0.016 9
0.019 0
0.021 1
0.027 5
0.027 5
0.029 6
0.035 9
0.031 7
0.031 7
0.010 6
0.012 7
0.019 0
0.021 1
0.021 1
0.027 5
0.029 6
0.029 6
0.025 4
0.006 3
0.008 4
0.010 5
0.014 8
0.021 1
0.027 4
0.027 4
0.019 0
10
0.006 9
0.006 6
0.006 3
0.008 3
0.007 8
0.008 6
0.006 3
0.005 1
0.003 6
0.010 5
0.016 9
0.021 1
0.027 4
0.029 5
0.029 5
0.025 3
11
0.007 2
0.006 9
0.007 2
0.008 8
0.008 1
0.008 8
0.006 6
0.006 3
0.004 2
0.004 7
0.019 0
0.023 2
0.029 5
0.035 9
0.035 9
0.027 4
12
0.007 5
0.007 2
0.007 5
0.008 5
0.008 6
0.009 5
0.007 5
0.006 6
0.004 7
0.005 9
0.006 3
0.025 3
0.031 6
0.038 0
0.033 8
0.029 5
13
0.006 9
0.006 6
0.006 9
0.008 5
0.008 3
0.009 5
0.007 5
0.006 6
0.005 5
0.006 6
0.006 9
0.007 2
14
0.007 8
0.007 5
0.007 8
0.008 8
0.008 6
0.009 9
0.007 8
0.007 5
0.006 6
0.007 5
0.007 8
0.008 0
0.003 6
15
0.008 6
0.008 3
0.008 0
0.009 9
0.009 0
0.009 7
0.008 6
0.007 8
0.007 5
0.007 8
0.008 5
0.008 8
0.005 1
0.006 3
16
0.008 6
0.008 3
0.008 0
0.009 7
0.009 0
0.010 3
0.008 1
0.007 8
0.007 5
0.007 8
0.008 5
0.008 3
0.005 1
0.005 5
0.006 6
0.006 3
0.012 7 0.019 0
0.012 7 0.014 8 0.021 1
0.004 2 0.010 5 0.016 9 0.012 7
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
Appendix. Pairwise comparisons of nucleotide divergences (below the diagonal) and standard errors estimated according to p-distance (above the diagonal) for the different Ploimida clones
analysed.
939
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
the complete 18S rDNA without congruence test between
the regions could involve a long branch attraction phenomenon [67, 68]. Nevertheless, there was still sufficient
phylogenetic signal to allow reconstruction of evolutionary relationships within Acanthocephala but this phylogenetic signal decreased within Ploimida. Compared to a
strict consensus between incongruent data sets (conserved
versus helix E23), a combination of regions provided
greater resolution at the inter- and intra-phylum levels.
However, this procedure was not free of drawbacks. When
helix E23 and conserved regions were combined, it was
not possible to resolve the intra-Ploimida phylogeny, possibly due to dilution of phylogenetic signal contained in
the helix E23 by inclusion of homoplasic positions located
in conserved regions (this incongruence is well detected
by the partition homogeneity test, table V).
5. Conclusion
Several studies addressing Metazoan relationships with
18S rDNA have only used conserved regions because of
ambiguities encountered in aligning the helix E23 region
at high taxonomic level [21, 33, 37, 69]. This approach
has also been considered warranted since conserved
regions are generally considered less subject to saturation
than the faster evolving helix E23, which would have
accumulated greater levels of saturation over such long
References
[1] Nogrady T., Wallace R.L., Snell T.W., Rotifera Vol. 1: Biology,
ecology and systematics, in: Guides of the Identification of the Microinvertebrates of the Continental Waters of the World, SPB Academic Publishing, The Hague, The Netherlands, 1993.
[2] Wallace R.L., Snell T.W., Rotifera, in: Ecology and Classification of
North American Freshwater Invertebrates, Academic Press, Inc., 1991,
pp. 187–248.
[3] Gomez A., Temprano M., Serra M., Ecological genetics of a cyclical
parthenogen in temporary habitats, J. Evol. Biol. 8 (1995) 601–622.
[4] Serra M., Galiana A., Gomez A., Speciation in Monogonont rotifers, Hydrobiologia 358 (1997) 63–70.
[5] Pejler B., Introgression in planktonic Rotatoria with some points of
view on its causes and conceivable results, Evolution 10 (1956) 246–261.
[6] Clément P., Ultrastructural research on Rotifers, Arch. Hydrobiol.
Beih. Ergebn. Limnol. 8 (1977) 270–297.
[7] Clément P., Phylogenetic relationships of Rotifers as derived from
photoreceptor morphology and other ultrastructural analyses, in:
Dumont H.J., Green J. (Eds.), Rotatoria, Developments in Hydrobiology I.
Dr W, Junk Publishers, The Hague, 1980, pp. 93–117.
[8] Clément P., Amsellem J., Cornillac A.M., Luciani A., Ricci C.,
Ultrastructural approach to feeding behaviour in Philodina roseola and
Brachionus calyciflorus (Rotifers), I- The buccal velum, in: Dumont H.J.,
Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk
Publishers, The Hague, 1980, pp. 127–131.
[9] Clément P., Amsellem J., Cornillac A.M., Luciani A., Ricci C.,
Ultrastructural approach to feeding behaviour in Philodina roseola and
Brachionus calyciflorus (Rotifers), II- The oesophagus, in: Dumont H.J.,
Green J. (Eds.), Rotatoria, Developments in Hydrobiology I. Dr W, Junk
Publishers, The Hague, 1980, pp. 133–136.
[10] Wallace R.L., Colburn R.A., Phylogenetic relationships within
phylum Rotifera: orders and genus Notholca, Hydrobiologia 186/187
(1989) 311–318.
940
time scales. However, we found that exclusion of the helix
E23 region introduces limitations to reconstruction of intraphylum relationships in the Rotifera. Consideration of only
conserved regions tends to produce basal polytomies,
compromising resolution of phyla-level relationships. Furthermore, combination of the helix E23 region with the
conserved region increases the resolution within the Acanthocephalans. Unfortunately, it is not the case for the
Rotifers, for which some incongruence was detected
between these two regions. On the other hand, even if
sites that have experienced an inordinate number of substitutions are eliminated, weak resolution still results due
to unintended removal of informative sites [34]. Our results
indicate that resolution of Rotifera, Bdelloidea and Acanthocephala inter-relationships will require analysis of additional nuclear genes, such as hox cluster [70, 71], to
corroborate the validity of the phylogenetic signal contained in the helix E23 region which has provided robust
inference of within-phylum relationships of the Rotifera–
Acanthocephalan clades.
Acknowledgements. We thank N. Angeli, P. Clément,
C. Cunningham, J. Deutsch, J.-L. d’Hondt, T.E. Dowling, S. Gadagkar, S. Kumar, H. Philippe, R. Pourriot, C.
Rougier, C. Secor and A. Vaquer for useful comments
and/or technical support. We are grateful to J. Garey for
sending us a preprint.
[11] Clément P., Wurdak E., Rotifera, in: Harrison F.W., Ruppert E.E.
(Eds.), Microscopic Anatomy of Invertebrates, Vol.4: Aschelminthes,
Wiley-Liss Inc, 1991, pp.219–296.
[12] Ahlrichs W.H., Epidermal ultrastructure of Seison nebalia and
Seison annulatus, and a comparison of epidermal structures within the
Gnathifera, Zoomorphology 117 (1997) 41–48.
[13] Snell T.W., Hawkinson C.A., Behavioral reproductive isolation
among populations of the rotifer Brachionus plicatilis, Evolution 37 (1983)
1294–1305.
[14] Rico-Martinez R., Snell T.W., Mating behavior and mate recognition pheromone blocking of male receptors in Brachionus plicatilis Müller
(Rotifera), Hydrobiologia 313/314 (1995) 105–110.
[15] Gomez A., Serra M., Mate choice in male Brachionus plicatilis
rotifers, Funct. Ecol. 10 (1996) 681–687.
[16] Rico-Martinez R., Snell T.W., Mating behavior in eight rotifer
species: using cross-mating tests to study species boundaries, Hydrobiologia 356 (1997) 165–173.
[17] Fu Y., Hirayama K., Natsukari Y., Genetic divergence between S
and L type strains of the rotifer Brachionus plicatilis O.F. Müller, J. Exp.
Mar. Biol. Ecol. 151 (1991) 43–56.
[18] Hagiwara A., Kotani T., Snell T.W., Assava-Aree M., Hirayama K.,
Morphology, reproduction, genetics, and mating behavior of small, tropical marine Brachionus strains (Rotifera), J. Exp. Mar. Biol. Ecol. 194 (1995)
25–37.
[19] Gomez A., Snell T.W., Sibling species and cryptic speciation in the
rotifer Brachionus plicatilis species complex (Rotifera), J. Evol. Biol. 9
(1996) 953–964.
[20] Raff R.A., Marshall C.R., Turbeville J.M., Using DNA sequences to
unravel the Cambrian radiation of the animal phyla, Annu. Rev. Ecol. Syst.
25 (1994) 351–375.
[21] Winnepenninckx B., Backeljau T., Mackey L.Y., Brooks J.M., De
Wachter R., Kumar S., Garey J.R., 18S rRNA data indicate that the
Aschelminthes are polyphyletic in origin and consist of at least three
distinct clades, Mol. Biol. Evol. 12 (1995) 1132–1137.
[22] Conway-Morris S., Crompton D.W.T., The origins and evolution
of Acanthocephala, Biol. Rev. 57 (1982) 85–115.
A. Miquelis et al. / C.R. Acad. Sci. Paris, Sciences de la vie / Life Sciences 323 (2000) 925–941
[23] Amin O.M., Classification, in: Crompton D.W.T., Nickol B.B.
(Eds.), Biology of the Acanthocephala, Cambridge University Press, Cambridge, 1985, pp. 27–72.
[24] Whitfield P.J., Phylogenetic affinities of Acanthocephala: an assessment of ultrastructural evidence, J. Parasitol. 63 (1971) 49–58.
[25] Storch V., Contributions of comparative ultrastructural research to
problems of invertebrate evolution, Am. Zool. 19 (1979) 637–645.
[26] Clément P., The relationships of rotifers, in: Conway Morris S.,
George J.D., Platt H.M. (Eds.), The Origins and Relationships of Lower
Invertebrates, System. Assoc. Clarendon Press, Oxford, 1985, pp. 224–
247.
[27] Lorenzen S., Phylogenetic aspects of pseudocoelomate evolution,
in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origins and
Relationships of Lower Invertebrates, System. Assoc. Clarendon Press,
Oxford, 1985.
[28] Ruppert E.E., Introduction to the Aschelminthes phyla: a consideration of mesoderm, body cavities and cuticle, in: Harrison F.W., Ruppert
E.E. (Eds.), Microscopic Anatomy of Invertebrates, Vol.4: Aschelminthes,
Wiley-Liss Inc., 1991, pp. 1–17.
[29] Schram F.R., Ellis W.N., Metazoan relationships: a rebutal, Cladistics 10 (1994) 331–337.
[30] Nielsen C., Animal Evolution, Oxford University Press, 1995.
[31] Nielsen C., Scharff N., Eibye-Jacobsen D., Cladistic analyses of the
animal kingdom, Biol. J Linn. Soc. 57 (1996) 385–410.
[32] Garey J.R., Near T.J., Nonnemacher M.R., Nadler S.A., Molecular
evidence for Acanthocephala as a subtaxon of Rotifera, J. Mol. Evol. 43
(1996) 287–292.
[33] Zrzavy J., Mihulka S., Kepka P., Bezdek A., Phylogeny of the
Metazoa based on morphological and 18S ribosomal DNA evidence,
Cladistics 14 (1998) 249–285.
[34] Abouheif E., Zardoya R., Meyer A., Limitations of Metazoan 18S
rRNA sequence data: Implications for reconstructing a phylogeny of the
animal kingdom and inferring the reality of the Cambrian explosion,
J. Mol. Evol. 47 (1998) 394–405.
[35] Garey J.R., Schmidt-Rhaesa A., Near T.J., Nadler S.A., The evolutionary relationships of Rotifers and Acanthocephalans, Hydrobiologia
387/388 (1998) 83–91.
[36] Near T.J., Garey J.R., Nadler S.A., Phylogenetic relationships of
the Acanthocephala inferred from 18S ribosomal DNA sequences, Mol.
Phyl. Evol. 10 (3) (1998) 287–298.
[37] Winnepenninckx B., Backeljau T., Kristensen R.M., Relations of
the new phylum Cycliophora, Nature 393 (1998) 636–638.
[38] Koste W., Rotatoria, Die Rädertiee Citteleuropas, 2 vols, Gebrüder
Borntraeger, Berlin, 1978.
[39] King C.E., Snell T.W., Sexual recombination in rotifers, Heredity
39 (1977) 357–360.
[40] Starkweather P.L., Gilbert J.J., Radiotracer determination of feeding in Brachionus calyciflorus: influence of gut passage times, Arch.
Hydrobiol. Beih. Ergebn. Limnol. 8 (1977) 261–263.
[41] Taberlet P., Bouvet J., A single plucked feather as a source of DNA
for bird genetic studies, The AUK 108 (1991) 58.
[42] Philippe H., MUST: a computer package of management utilities
for sequences and trees, Nucleic Acids Res. 21 (1993) 5264–5272.
[43] Van de Peer Y., Caers A., De Rijk P., De Wachter R., Database on
the structure of small ribosomal subunit RNA, Nucleic Acids Res. 26
(1998) 179–182.
[44] De Rijk P., De Wachter R., RnaViz, a program for the visualisation
of RNA secondary structure, Nucleic Acids Res. 25 (1997) 4679–4684.
[45] Saitou N., Nei M., The neighbor-joining method: a new method
for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406–425.
[46] Jukes T.H., Cantor C.R., Evolution of protein molecules, in:
Munro H.H. (Ed.), Mammalian Protein Metabolism, Academic Press, New
York, 1969, pp. 21–132.
[47] Kumar S., Tamura K., Nei M., MEGA: Molecular Evolutionary
Genetics Analysis, Pennsylvania State University, University Park, PA,
1993.
[48] Cunningham C.W., Zhu H., Hillis D.M., Best-fit maximum likelihood models for phylogenetic inference: empirical tests with known
phylogenies, Evolution 52 (1998) 978–987.
[49] Kim J., Kim W., Cunningham C.W., A new perspective on lower
Metazoan relationships from 18S rDNA sequences, Mol. Biol. Evol. 16 (3)
(1999) 423–427.
[50] Felsenstein J., Evolutionary trees from DNA sequences: a maximum likelihood approach, J. Mol. Evol. 17 (1981) 368–376.
[51] Olsen G.J., Matsuda H., Hagstrom R., Overbeek R., FastDNAML:
a tool for construction of phylogenetic trees of DNA sequences using
maximum likelihood, Comput. Appl. Biosci. 10 (1994) 41–48.
[52] Farris J.S., Källersjö M., Kluge A., Bult C., Testing significance of
congruence, Cladistics 10 (1995) 315–320.
[53] Bremer K., The limits of amino acid sequence data in Angiosperm
phylogenetic reconstitution, Evolution 42 (1988) 795–803.
[54] Templeton A.R., Convergent evolution and non-parametric inferences from restriction fragment and DNA sequence data, in: Weir B. (Ed.),
Statistical Analysis of DNA Sequence Data, Marcel Dekker, New York,
1983, pp. 151–179.
[55] Kishino H., Hasegawa M., Evaluation of the maximum likelihood
estimate of the evolutionary tree topologies from DNA sequence data, and
the branching order of the Hominoidea, J. Mol. Evol. 29 (1989) 170–179.
[56] Kumar S., PHYLTEST: a program for testing phylogenetic hypotheses, Pennsylvania State University, University Park, PA, 1996.
[57] Vawter L., Brown W.M., Rates and patterns of base change in the
small subunit ribosomal RNA gene, Genetics 134 (1993) 597–608.
[58] Conway-Morris S., Non-skeletalized lower invertebrate fossils: a
review, in: Conway Morris S., George J.D., Platt H.M. (Eds.), The Origin
and Relationships of Lower Invertebrates, System. Assoc. Clarendon
Press, Oxford, 1985, pp. 343–359.
[59] Warner B.G., Chengalath R., Holocene fossil Habrotrocha angusticollis (Bdelloidea: Rotifera) in North America, J. Paleolimnol. 1 (1988)
141–147.
[60] Waggoner B.M., Poinar G.O., Fossil Habrotrochid rotifers in
Dominican amber, Experientia 49 (1993) 354–357.
[61] Birky C.W., Studies on the physiology and genetics of the rotifer
Asplanchna, III, Results of outcrossing, selfing, and selection, J. Exp. Zool.
165 (1967) 104–116.
[62] King C.E., Genetics of reproduction, variation, and adaptation in
rotifers, Arch. Hydrobiol. Beih. 8 (1977) 187–201.
[63] Pejler B., Variation in the genus Keratella, Hydrobiologia 73
(1980) 207–213.
[64] De Beauchamp P.M., Recherches sur les rotifères : les formations
tégumentaires et l’appareil digestif, Arch. Zool. Exp. Gen. 10 (1909)
1–410.
[65] Pawlowski J., Bolivar I., Fahrni J.F., de Vargas C., Gouy M.,
Zaninetti L., Extreme differences in rates of molecular evolution of foraminifera revealed by comparison of ribosomal DNA sequences and the
fossil, Mol. Biol. Evol. 14 (1997) 498–505.
[66] Philippe H., Laurent J., How good are deep phylogenetic trees?
Curr. Opin. Genet. Dev. 8 (6) (1998) 616–623.
[67] Brinkmann H., Philippe H., Archaea sister group of bacteria?
Indications from tree reconstruction artifacts in ancient phylogenies, Mol.
Biol. Evol. 16 (6) (1999) 817–825.
[68] Philippe H., Chenuil A., Adoutte A., Can the Cambrian explosion
be inferred through molecular phylogeny? Development Suppl., 1994,
pp. 15–25.
[69] Telford M.J., Holland P.W.H., The phylogenetic affinities of the
Chaetognaths: a molecular analysis, Mol. Biol. Evol. 10 (1993) 660–676.
[70] Adoutte A., Balavoine G., Lartillot N., de Rosa R., Animal evolution - the end of the intermediate taxa? Trends Genet. 15 (3) (1999)
104–108.
[71] De Rosa R., Grenier J.K., Andreeva T., Cook C.E., Adoutte A.,
Akam M., Carroll S.B., Balavoine G., Hox genes in brachiopods and
priapulids and protostome evolution, Nature 399 (1999) 772–776.
[72] Yang Z., Kumar S., Approximate methods for estimating the pattern of nucleotide substitution rates among sites, Mol. Biol. Evol. 13
(1996) 650–659.
[73] Takezaki N., Rzhetsky A., Nei M., Phylogenetic test of the molecular clock and linearized trees, Mol. Biol. Evol. (12) 5 (1995) 823–833.
941