A molecular phylogeny shows the single origin of the Pyrenean
Transcription
A molecular phylogeny shows the single origin of the Pyrenean
Molecular Phylogenetics and Evolution 54 (2010) 97–106 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A molecular phylogeny shows the single origin of the Pyrenean subterranean Trechini ground beetles (Coleoptera: Carabidae) A. Faille a,b,*, I. Ribera b,c, L. Deharveng a, C. Bourdeau d, L. Garnery e, E. Quéinnec f, T. Deuve a a Département Systématique et Evolution, ‘‘Origine, Structure et Evolution de la Biodiversité” (C.P.50, UMR 7202 du CNRS/USM 601), Muséum National d’Histoire Naturelle, Bât. Entomologie, 45 rue Buffon, F-75005 Paris, France b Institut de Biologia Evolutiva (CSIC-UPF), Passeig Maritim de la Barceloneta 37-49, 08003 Barcelona, Spain c Museo Nacional de Ciencias Naturales (CSIC), José Gutiérrez Abascal 2, 08006 Madrid, Spain d 5 chemin Fournier-Haut, F-31320 Rebigue, France e Laboratoire Evolution, Génomes, Spéciation, CNRS UPR9034, Gif-sur-Yvette, France f Unité ‘‘Evolution & Développement”, UMR 7138 ‘‘Systématique, Adaptation, Evolution”, Université P. & M. Curie, 9 quai St–Bernard, F-75005 Paris, France a r t i c l e i n f o Article history: Received 16 March 2009 Revised 1 October 2009 Accepted 5 October 2009 Available online 21 October 2009 Keywords: Subterranean environment Convergence Endogean Troglobitic Trechinae Aphaenops a b s t r a c t Trechini ground beetles include some of the most spectacular radiations of cave and endogean Coleoptera, but the origin of the subterranean taxa and their typical morphological adaptations (loss of eyes and wings, depigmentation, elongation of body and appendages) have never been studied in a formal phylogenetic framework. We provide here a molecular phylogeny of the Pyrenean subterranean Trechini based on a combination of mitochondrial (cox1, cyb, rrnL, tRNA-Leu, nad1) and nuclear (SSU, LSU) markers of 102 specimens of 90 species. We found all Pyrenean highly modified subterranean taxa to be monophyletic, to the exclusion of all epigean and all subterranean species from other geographical areas (Cantabrian and Iberian mountains, Alps). Within the Pyrenean subterranean clade the three genera (Geotrechus, Aphaenops and Hydraphaenops) were polyphyletic, indicating multiple origins of their special adaptations to different ways of life (endogean, troglobitic or living in deep fissures). Diversification followed a geographical pattern, with two main clades in the western and central-eastern Pyrenees respectively, and several smaller lineages of more restricted range. Based on a Bayesian relaxed-clock approach, and using as an approximation a standard mitochondrial mutation rate of 2.3% MY, we estimate the origin of the subterranean clade at ca. 10 MY. Cladogenetic events in the Pliocene and Pleistocene were almost exclusively within the same geographical area and involving species of the same morphological type. Ó 2009 Elsevier Inc. All rights reserved. 1. Introduction The origin and evolution of cave organisms has fascinated evolutionists and biologists for more than two hundred years, since the discovery of the first troglobitic species (Proteus anguinus, described by Laurenti, 1768). Organisms living in a subterranean environment tend to show a highly modified morphology and biology, and a mixture of losses (eye degeneration, depigmentation) and adaptations (development of sensory organs, changes in the life cycle and metabolism, body shape modifications) (Racovitza, 1907; Vandel, 1964; Culver et al., 1990). Troglobitic invertebrates isolated in karstic areas are also very good models to study speciation and diversification, because of the isolation of populations in well-defined karstic units with highly restricted gene flow * Corresponding author. E-mail addresses: [email protected], [email protected] (A. Faille), igna [email protected] (I. Ribera), [email protected] (L. Deharveng), Lionel.Gar [email protected] (L. Garnery), [email protected] (E. Quéinnec), deuve @mnhn.fr (T. Deuve). 1055-7903/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2009.10.008 (Caccone, 1985). Amongst insects, many groups of Coleoptera have repeatedly colonised subterranean habitats, but two of them are particularly diverse: Leiodidae (especially subfamily Cholevinae) in the suborder Polyphaga, and Carabidae of the subfamily Trechinae in the suborder Adephaga (Casale et al., 1998). Subterranean species of both groups share morphological modifications considered to be adaptations to a subterranean lifestyle: loss of metathoracic wings, eyes and pigment, similar changes in body shape and size (Jeannel, 1926a,b; Vandel, 1964; Barr and Holsinger, 1985), and modifications in their way of life (Deleurance, 1958). The extensive convergence in morphological characters obscures the phylogenetic relationships among species (Marquès and Gnaspini, 2001; Desutter-Grandcolas et al., 2003), which has resulted in a high number of taxonomic arrangements with non-monophyletic taxa (see e.g. Fresneda et al., 2007 for an example with a lineage of Leiodidae cave beetles). The Pyrenean Chain is known to be one of the main world hotspots for subterranean invertebrate fauna (Culver et al., 2006). The phylogenetic relationships among the subterranean species of Pyrenean Trechini, one of the groups which have experienced 98 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 extensive diversification in the area (Jeannel, 1941), are poorly known, and studies have so far been based on morphological characters only (Jeannel, 1941; Casale et al., 1998; see below). The subterranean Trechini of the Pyrenees include ca. 80 species in three genera, Geotrechus, Aphaenops and Hydraphaenops (Moravec et al., 2003; see Appendix for nomenclatorial remarks). All the species are Pyrenean endemics (most of them with very narrow distributions), with different adaptations for life in subterranean habitats. They are all completely blind and apterous, with a slender body form, and (in some species) an extreme elongation of the head, pronotum and appendages (Jeannel, 1941; Casale et al., 1998), resulting in a very characteristic appearance, the ‘‘aphaenopsian” morphological type (Jeannel, 1941; Vandel, 1964) (Fig. 1). Many subterranean insects around the world have independently developed similar characteristics, and ‘‘aphaenopsian”, ‘‘aphaenopsoid” or ‘‘Aphaenops-like” is commonly used to refer to this syndrome in other groups of Carabidae (Barr, 1979; Deuve, 2001; Ortuño et al., 2004; Uéno and Clarke, 2007), and even other insects (e.g. Hymenoptera, Roncin and Deharveng, 2003). In this study we provide for the first time a phylogenetic framework obtained with numerical algorithms to study the origin and diversification of the subterranean species of Pyrenean Trechini, based on a combination of nuclear and mitochondrial genes. We include a broad sample of the three subterranean genera (51 species, some with repeated examples), plus a representation of other troglobitic species and potential relatives living on the surface in the Pyrenees and other west Mediterranean areas. Our specific aims were to (1) determine the origin of the subterranean genera and their relationships with epigean species, (2) investigate the monophyly of traditional taxa (genera and subgenera), established on external morphological characters, and (3) investigate the relationship between endogean and cave species. 2. Materials and methods 2.1. Historical and taxonomic background of Pyrenean subterranean Trechini The first known Pyrenean cave ground-beetles were included in the genus Anophthalmus, created for an eastern Alpine hypogean species (A. schmidtii Sturm). Putzeys (1870) transferred these species to the genus Trechus Clairville, which also includes epigean species. Bonvouloir (1862) erected the genus Aphoenops for the subterranean species A. leschenaulti Bonvouloir on the basis of the non-dilated protarsi of the male, a character currently considered of reduced phylogenetic relevance (Bedel and Simon, 1875). See the appendix for the use of Aphaenops in place of Aphoenops. The current concept of the genus Aphaenops includes 41 species on both sides of the Pyrenees, all of them highly modified and exclusive to karst areas, living either in deep cavities or, in some cases, in the Superficial Hypogean Compartment (‘‘Milieu souterrain superficiel”, MSS, Juberthie and Bouillon, 1983). Diagnostic characters are the presence of incomplete frontal furrows (vs. complete in Geotrechus), very elongated legs and antennae, body pale, completely depigmented, and a pronounced narrowing (a ‘‘neck”) at the base of the head (Coiffait, 1962) (Fig. 1). It is subdivided in six subgenera (for the taxonomic ordination of the group we follow the recent catalogue of Moravec et al., 2003, although we do not consider subspecies unless otherwise stated): (1) Aphaenops Bonvouloir, 1862: 10 species, mainly found in the western Pyrenees. (2) Geaphaenops Cabidoche, 1965: 7 species, also in the western Pyrenees. All the species of this group seem to be endogean, and their external morphology is very homogeneous. (3) Cerbaphaenops Coiffait, 1962: 16 species, mainly found in the central and eastern Pyrenees, between Bagnères-de-Bigorre and the Ariège River. This is also a group with a very homogeneous morphology, although no clear diagnostic characters were given by Coiffait (1962) (pubescent head, short mandibles). (4) Pubaphaenops Genest, 1983: a single species from a cave in Ariège, A. laurenti Genest, fully pubescent. (5) Arachnaphaenops Jeanne, 1967: three species, one in the western Pyrenees, two in Ariège and Haute-Garonne respectively, all with very long legs and antennae, which give them the appearance of an arachnid. (6) Cephalaphaenops Coiffait, 1962: two species, one in the western Pyrenees, the other in Ariège and Haute-Garonne, with a large and pubescent head and long mandibles. Fig. 1. Habitus of (1) Aphaenops alberti Jeannel (troglobitic), (2) Aphaenops pluto Dieck (troglobitic), (3) Hydraphaenops navaricus Coiffait & Gaudin (troglobitic), (4) Geotrechus seijasi Español (endogean), and (5) Trechus quadristriatus (Schrank) (epigean). Scale bars, 1 mm. Photos 1–3 P. Déliot, 4 A. Faille, 5 U. Schmidt. 99 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 The genus Geotrechus was created by Jeannel (1919) for some blind species with an ‘‘Anophthalmus-like” habitus, in opposition to the species of Aphaenops. Diagnostic characters of Geotrechus are the presence of frontal furrows and their more robust appearance, with short legs and antennae (Coiffait, 1962; Fig. 1). Jeannel (1919) considered the genera Aphaenops and Geotrechus as two closely related but distinct lineages. Most of the 22 known species of Geotrechus are endogean, and although some populations can be locally abundant in caves, most of them seem to be more common in the ground at the entrance of the cavities (Jeannel, 1926b, 1941). Some species can also be found under large stones in forests, when hydric conditions are favourable. Hydraphaenops was first described as a subgenus of Aphaenops by Jeannel (1926a), and subsequently upgraded by Coiffait (1962). Currently it includes 18 species, characterised by an elongated and parallel-sided, almost cylindrical head, sharp, sickleshaped mandibles, short appendages and the body at least partially covered with pubescence (Jeannel, 1941; Coiffait, 1962) (Fig. 1). Most species are exceedingly rare, some of them being known from only one or two specimens, and their biology is virtually unknown (Cabidoche, 1966). They do seem to be highly hygrophilous, requiring a water-saturated atmosphere to colonise karstic areas (Deleurance-Glaçon, 1963). Some species are known at low altitude (e.g. H. galani Español, found at sea level), while others have only been found in high altitude shafts in direct contact with ice (e.g. H. penacollaradensis Dupré, H. mouriesi Genest) (Español, 1968; Dupré, 1991; Genest, 1983). As happens with Aphaenops, Hydraphaenops-like species are known in other lineages of subterranean Trechinae (Deuve, 2000; Casale, 2004). 2.2. Taxon sampling Trechini species were collected in caves, shafts and MSS from the Pyrenean chain, in France and Spain as listed in Suppl. Table 1. Single individuals were used for amplification and sequencing. We included as outgroups several examples of Trechus from the Pyrenees (mainly epigean, some of them hypogean), plus some other genera from different geographical areas, including both epigean and subterranean species (Suppl. Table 1). To root the tree we used one species of Anillini (Typhlocharis Dieck) and two of Bembidiini (Porotachys Netolitzky and Philochthus Stephens), which are clearly outside Trechini (Grebennikov and Maddison, 2005; Grebennikov, 2008). In total, we sampled 50 specimens of 32 species of Aphaenops, 11 specimens of 9 species of Hydraphaenops and 12 specimens of 10 species of Geotrechus (Table 1; Suppl. Table 1). 2.3. DNA extraction, PCR amplification and sequencing Specimens were collected alive in the field and directly killed and preserved in 96% ethanol. DNA was extracted from whole specimens by a standard phenol–chloroform extraction (Blin and Stafford, 1976). DNA extraction was usually non-destructive, to preserve voucher specimens for subsequent morphometric and morphological study (Pons, 2006; Gilbert et al., 2007; Rowley et al., 2007). Specimens were incubated overnight in a mix of 500 ll of buffer (10 mM Tris, pH 8.0; 0.5% SDS; 0.1 M EDTA, pH 8.0) and 25 ll of proteinase K (20 mg/ml) at 55 °C, with the abdominal ventrites slightly opened to facilitate the action of the digestion enzyme. The use of non-destructive methods allowed the molecular study of very rare species, as even fragile structures of taxonomic importance, like the chaetotaxy or the internal structures of the aedeagus, were perfectly preserved after extraction (Pons, 2006; Gilbert et al., 2007; Rowley et al., 2007). Voucher specimens are kept in the MNHN (Paris), DNA aliquots are kept in the tissue collections of the MNHN and IBE (CSIC-UPF, Barcelona). Table 1 Checklist of genera and subgenera of subterranean species of Pyrenean Trechini, with total number of species and species included in the study. Taxonomy follows Moravec et al. (2003) updated. a Genus Subgenus N. spp. Sampled spp. Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Hydraphaenops Geotrechus Geotrechus Trechus Aphaenops Geaphaenops Cerbaphaenops Cephalaphaenops Arachnaphaenops Pubaphaenops Hydraphaenops Geotrechus Geotrechidius Trechus 10 7 16 2 3 1 18 8 15 17a 8 2 14 1 3 1 8 4 6 7 Species occurring in the Pyrenees, 11 of them endemic. We sequenced three mitochondrial (50 end of cytochrome c oxidase subunit 1, cox1; cytochrome b, cyb, 50 end of large ribosomal unit plus the Leucine transfer plus the 30 end of NADH dehydrogenase subunit 1, rrnl+tRNA-Leu+nad1) and two nuclear (small ribosomal unit, SSU, large ribosomal unit, LSU) gene fragments (see Table 2 for the primers used). Sequences were assembled and edited with Bioedit v. 7.00 (Hall, 1999) or Sequencher 4.6 (Gene Codes, Inc., Ann Arbor, MI). New sequences have been deposited in GenBank with Acc. Nos. GQ293502–GQ293896 (395 sequences) (Suppl. Table 1). For some species, the final sequence is a chimera of sequences obtained from different specimens (labelled with the two voucher numbers in all Figures, see Suppl. Table 1). Protein coding genes were not length variable, and the ribosomal genes were aligned with the online version of MAFFT v.6 using the GINS-i algorithm and default parameters (Katoh et al., 2002; Katoh and Toh, 2008). 2.4. Phylogenetic analyses Bayesian analyses were conducted on a combined data matrix with MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001), using five partitions corresponding to the five sequenced fragments. Evolutionary models were estimated prior to the analysis with ModelTest 3.7 (Posada and Crandall, 1998). MrBayes ran for 6 106 generations using default values, saving trees each 500. ‘‘Burn-in” values were established after visual examination of a plot of the standard deviation of the split frequencies between two simultaneous runs. We used two additional phylogenetic approaches for comparative purposes, maximum likelihood with a genetic algorithm implemented in Garli v0.9 (Zwickl, 2006), using an estimated GTR+I+G model for the combined sequence and the default settings, and parsimony in PAUP v4.b10 (Swofford, 2002), with 10,000 random replicates, swapping on best trees only and not saving multiple trees. Node support was measured with the posterior probabilities in MrBayes, and 1000 bootstrap replicates (Felsenstein, 1985) in Garli and PAUP. To reduce computation time in Garli, the number of generations without improving the topology necessary to complete each replica was reduced to 5000 instead of the default 10,000. In PAUP we performed heuristic searches with random addition of taxa with 10 repetitions for each of 1000 replications. Differences between alternative topologies were evaluated using the tests of Templeton (1983) for parsimony and Shimodaira and Hasegawa (1999) for maximum likelihood. To check for possible topological incongruences we did maximum likelihood analyses in Garli with the nuclear sequence alone, using the GTR+I+G evolutionary model and estimating node support with 1000 bootstrap replicas as above. 100 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 Table 2 Primers used in the study. Marker Primer Sequence Ref. 0 0 cox1 RON HOBBES TONYA NANCY JERRY PAT 5 GGATCACCTGATATAGCATTCCC3 50 AAATGTTNGGRAAAAATGTTA30 50 GAAGTTTATATTTTAATTTTACCGG30 50 CCCGGTAAAATTAAAATATAAACTTC30 50 CAACATTTATTTTGATTTTTTGG30 50 TCCAATGCACTAATCTGCCATATTA30 Simon et al. (1994) Monteiro and Pierce (2001) Monteiro and Pierce (2001) Simon et al. (1994) Simon et al. (1994) Simon et al. (1994) cyb CB1 CP1 TSERco 50 TATGTACTACCATGAGGACAAATATC30 50 GATGATGAAATTTTGGATC30 50 TATTTCTTTATTATGTTTTCAAAAC30 Simon et al. (1994) Kergoat (pers. comm., 2004) Simon et al. (1994) rrnl+tRNA-Leu+nad1 NDIA 16SaR 50 GGTCCCTTACGAATTTGAATATATCCT30 50 CGCCTGTTTATCAAAAACAT30 Simon et al. (1994) Simon et al. (1994) LSU D3 D1 50 GCATAGTTCACCATCTTTC30 50 GGGAGGAAAAGAAACTAAC30 Ober (2002) Ober (2002) SSU 18S-50 18S-b5.0 50 GACAACCTGGTTGATCCTGCCAGT30 50 TAACCGCAACAACTTTAAT30 Shull et al. (2001) Shull et al. (2001) 2.5. Estimation of divergence times To estimate the relative age of divergence of the lineages we used the Bayesian relaxed phylogenetic approach implemented in BEAST v1.4.7 (Drummond and Rambaut, 2007), which allows variation in substitution rates among branches (Drummond et al., 2006). We implemented a GTR+I+G model of DNA substitution with four rate categories using the mitochondrial data set only and pruning species with more than one missing gene fragment, with an uncorrelated lognormal relaxed molecular clock model to estimate substitution rates and the Yule process of speciation as the tree prior. The main nodes of the topology were constrained to match that of the tree obtained with the whole dataset (mitochondrial plus nuclear) in MrBayes. We ran two independent analyses for each group, sampling each 500 generations, and used TRACER version 1.4 to determine convergence, measure the effective sample size of each parameter, and calculate the mean and 95% highest posterior density interval (HPD) for divergence times. Results of the two runs were combined with LogCombiner v1.4.7 and the consensus tree compiled with TreeAnnotator v1.4.7 (Drummond and Rambaut, 2007). The analyses were run for 25 106 generations, with the initial 10% discarded as burn-in. Because of the absence of fossil record for both groups, to calibrate the trees we used as a prior a normal distribution with average equal to the standard rate of 2.3% MY, equivalent to a per-branch rate of 0.0115 substitutions/site/MY (Brower, 1994), and a standard deviation of 0.0001. This rate is lower to that obtained by Contreras-Díaz et al. (2007) for the genus Trechus, using calibration points based on the colonisation of the Canary islands (0.015 substitutions/site/MY), although the later was based on cox1 and cox2 only, which have faster evolutionary rates than the ribosomal rrnL (Ribera et al., 2001). 3. Results 3.1. Phylogenetic analysis The aligned data matrix had 3653 characters, of which 932 were parsimony informative. There was no length variation in the protein coding genes, and variation in the ribosomal genes was mostly concentrated in the LSU, ranging from 862 (Typhlocharis) to 909 bp (Perileptus), both among the outgroups. Length variation in the ingroup LSU was reduced to between 867 (G. saulcyi, G. seijasi) and 898 bp (Hydraphaenops galani, H. delicatulus). For the SSU fragment there was only three bp maximum length difference, and for the rrnL+tRNA-LEU fragment the maximum length difference was 14 bp between Geotrechus vandeli and some species of Aphaenops (A. alberti, A. cabidochei, A. ochsi). The optimal evolutionary model for the mitochondrial genes, as measured with Modeltest under the Akaike information criterion, was GTR+I+G. For the SSU the optimal model was TVMef+I, and for the LSU TVM+I+G. The runs of MrBayes converged at ca. 2 106 generations, with a standard deviation of the split frequencies between the two runs of ca. 0.015. The two runs were interrupted at 5 106 generations (see the estimated parameters in Suppl. Table 2). A heuristic search using PAUP and assuming an equal weight for all characters resulted in 2151 trees of 4537 steps (consistency index, CI = 0.41, retention index, RI = 0.60). The topology of the tree, and the support for the main nodes, were very similar for the three reconstruction methods (Bayesian probabilities, maximum likelihood and parsimony) (Fig. 2, Suppl. Fig. 1). In all cases the three subterranean genera of the Pyrenees (Aphaenops, Hydraphaenops and Geotrechus) formed a clade with exclusion of all epigean species, with strong support (Fig. 2, Suppl. Fig. 1). The Pyrenean subterranean lineage was sister to a poorly supported clade including all species of Trechus of different areas (including the Pyrenees), plus some other subterranean taxa outside the Pyrenees (Apoduvalius, Cantabrian mountains; Duvalius, Alps; Paraphaenops, Iberian System) (Suppl. Table 1; Fig. 2, Suppl. Fig. 1). Basal relationships within this clade were not supported. Within the Pyrenean subterranean clade, the three genera were polyphyletic under all reconstruction methods, with at least one well-supported node determining the polyphyly in each case (Fig. 2). We constrained the monophyly of the three genera and searched the best topology compatible with this constrain both in PAUP using parsimony and in Garli with maximum likelihood. The search in PAUP with the constraint of the monophyly of the three subterranean genera resulted in 227 trees of 4691 steps (CI = 0.39; RI = 0.57). The resulting topologies were significantly worse, as tested both for parsimony (Templeton test, p < 0.0001) and maximum likelihood (Shimodaira–Hasegawa test, p < 0.0005). The basal nodes of the subterranean clade were not well-supported, but the best topologies in Bayesian analyses and maximum likelihood placed a paraphyletic series of species of Geotrechus from the Eastern Pyrenees at the base (Fig. 2), included in the subgenus Geotrechidius (the ‘‘vulcanus group” sensu Coiffait, 1962). The rest of the species were included in two main well-supported clades (pp = 1, bootstrap >70% in all analyses) plus some western lineages of Hydraphaenops and Geotrechus (Figs. 2 and 3). The two well-supported main lineages were (1) species of Aphaenops distributed in the western Pyrenees (clade W), and (2) a clade of species of Aphaenops and Hydraphaenops from the eastern Pyrenees 101 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 69/0.97/78 80/1/84 x/0.77/63 A. vandeli MNHN-AF43 A. vandeli MNHN-AF44 A. vandeli MNHN-AF45 59/0.96/67 A. bouiganensis MNHN-AF46 54/0.74/x A. crypticola MNHN_AF52 84/0.99/79 A. parallelus MNHN_AF53 97/1/95 A. crypticola MNHN_AF49 61/0.72/70 A. crypticola MNHN_AF47 67/0.96/80 A. crypticola MNHN_AF48 76/1/69 A. crypticola MNHN_AF51 72/1/70 A. bouilloni MNHN_AF56 75/0.98/87 A. mariarosae MNHN_AF57 x/1/59 A. crypticola MNHN_AF50 85/-/71 A. sp MNHN_AF133 68/0.62/67 A. sioberae MNHN_AF54 A. pluto MNHN_AF58 x/0.99/A. carrerei MNHN_AF34 x/0.57/x A. laurenti MNHN_AF63 x/0.9/A. michaeli MNHN_AF35 x/0.94/A. bonneti MNHN_AF38 97/1/95 A. delbreili MNHN_AF37 100/1/99 A. cerberus MNHN_AF20_AF30 56/0.77/x A. jauzioni MNHN_AF33 57/0.79/x A. crypticola MNHN_AF135 x/0.64/61 A. hustachei MNHN_AF39 52/1/53 A. aeacus MNHN_AF40 86/1/x A. crypticola MNHN_AF134 95/1/97 A. sp MNHN_AF42 x/0.88/69 83/1/73 A. bucephalus MNHN_AF62 A. chappuisi MNHN_AF61 100/1/100 Eastern clade A. tiresias MNHN_AF59_AF60 98/1/89 H. bourgoini MNHN_AF68 x/1/H. bourgoini MNHN_AF69 100/1/100 H. ehlersi MNHN_AF64 x/0.55/H. pecoudi MNHN_AF72 H. elegans MNHN_AF120 H. penacollaradensis MNHN_AF121 86/0.99/69 A. abodiensis MNHN_AF4 100/1/99 A. bessoni MNHN_AF122 100/1/100 A. loubensi MNHN_AF3 59/0.95/A. ludovici MNHN_AF15 100/1/100 A. rhadamanthus MNHN_AF13_AF14 98/1/96 A. jeanneli MNHN_AF11 66/0.99/63 A. orionis MNHN_AF9_AF10 97/1/88 A. alberti MNHN_AF12 A. cabidochei MNHN_AF5_AF6 58/0.95/Western clade 100/1/100 A. ochsi MNHN_AF7_AF8 74/0.99/76 A. catalonicus MNHN_AF2 x/0.63/A. leschenaulti MNHN_AF1 63/1/57 H. galani MNHN_AF67 77/1/78 H. vasconicus MNHN_AF65 99/1/93 G. jeanneli MNHN_AF77 71/0.92/x G. gallicus MNHN_AF76 x/0.63/x H. pandellei MNHN_AF70 100/1/99 100/1/100 H. pandellei MNHN_AF71 x/1/99/1/97 G. discontignyi MNHN_AF92 G. orcinus MNHN_AF85 59/0.81/x G. trophonius MNHN_AF83 H. delicatulus MNHN_AF66 G. orpheus MNHN_AF79_AF81 99/0.78/100 Pyrenean hypogean G. saulcyi MNHN_AF86 100/1/x G. saulcyi MNHN_AF87 clade G. vandeli MNHN_AF88 92/1/80 G. vulcanus MNHN_AF91 G. seijasi MNHN_AF89 64/0.94/x T. escalerae MNHN_AF104 x/0.53/x T. saxicola MNHN_AF100 68/1/58 A. alberichae MNHN_AF105 72/0.99/70 T. navaricus MNHN_AF103 x/0.53/T. uhagoni MNHN_AF102 53/1/92 x/0.84/x Apoduvalius sp MNHN_AF106 T. fulvus MNHN_AF98 x/0.61/x 94/1/97 T. barnevillei MNHN_AF97 86/1/71 T. obtusus MNHN_AF126 87/1/71 T. ceballosi MNHN_AF128 100/1/100 T. distigma MNHN_AF94 T. quadristriatus MNHN_AF96 x/1/51 S. mayeti MNHN_AF107 73/0.98/97 100/1/99 T. comasi MNHN_AF127 T. schaufussi MNHN_AF101 x/0.91/x P. breuilianus MNHN_AF108 x/0.68/x Agostinia gaudini MNHN_AF116 90/1/x x/0.6/x D. berthae MNHN_AF114_AF115 100/1/100 D. roberti MNHN_AF129 A. robini MNHN_AF112 x/0.86/x I. bolivari MNHN_AF111 L. deharvengi MNHN_AF117 . . . P. areolatus MNHN_AF113 P. bisulcatus MNHN_AF131 x/0.7/x x/1/x P. lunulatus MNHN_AF118 Typhlocharis MNHN_AF119 0.09 Fig. 2. Phylogram of subterranean Trechini of the Pyrenees obtained with maximum likelihood in Garli, using the combined data matrix. Number in nodes, ML bootstrap/ Bayesian posterior probability, obtained in MrBayes/parsimony bootstrap (see Section 2 for details). ‘‘Western” and ‘‘Eastern” clades marked with ‘‘W” and ‘‘E” respectively (see text). In red, species of Aphaenops; in green, species of Hydraphaenops; in blue, species of Geotrechus. Habitus, from top to bottom: Aphaenops pluto, A. bessoni, A. alberti, Hydraphaenops galani, Geotrechus gallicus, G. seijasi, Trechus sp., Paraphaenops breuilianus, Duvalius berthae (see Suppl. Table 1). (For interpretation of colour mentioned in this figure the reader is referred to the web version of the article.) 102 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 Fig. 3. Distribution of the main clades of subterranean Trechini of the Pyrenees, according to the phylogeny in Fig. 2. ‘‘Western” and ‘‘Eastern” clades marked with ‘‘W” and ‘‘E” respectively (see text). (clade E). The Eastern group of Aphaenops species corresponds mostly to the subgenus Cerbaphaenops sensu Coiffait (1962), plus some morphologically characteristic species so far placed in the subgenera Arachnaphaenops, Cephalaphaenops and Pubaphaenops (A. bucephalus, A. laurenti, A. chappuisi, A. pluto and A. tiresias; Suppl. Table 1). The Western clade of Aphaenops included all species of the subgenus Geaphaenops (forming a monophyletic lineage) plus species of Aphaenops s.str. and A. (Arachnaphaenops) alberti. The easternmost species of this clade is Aphaenops catalonicus, which is also the southern-most species of Aphaenops, with records from the Pre-Pyrenees in the Ribagorza valley (Fig. 3). It has morphological affinities to the northern species and in particular to its sister A. leschenaulti (specially the male genitalia, Faille et al., 2006). Within the Eastern clade (Cerbaphaenops sensu lato), what is currently known as A. crypticola is polyphyletic, with some lineages associated to other Aphaenops species according to their geographic distribution. These affinities are also supported by morphological characters (see Section 4). Similarly, the only species of Pubaphaenops (Genest, 1983), A. laurenti, with a peculiar morphology, is grouped in a clade (albeit with low support) with the species in the same geographical area, between the Lez and the Vicdessos valleys, at the eastern limit of the distribution of Aphaenops (Figs. 2 and 3). In all trees the genera Hydraphaenops and Geotrechus (and the subgenera Geotrechus and Geotrechidius of the later) were polyphyletic, with strong support (Fig. 2, Suppl. Fig. 1). The two Aphaenops lineages were sister to some species of Hydraphaenops, while Geotrechus was split between a paraphyletic basal series and some species in a lineage with Hydraphaenops (Fig. 2). In the analyses of the nuclear sequence we excluded six specimens because of missing data (see Suppl. Table 1). The tree obtained with Garli with the combined SSU + LSU had the same basic topology as the combined tree (Suppl. Fig. 2), with a wellsupported monophyletic lineage for all subterranean species from the Pyrenees, and the polyphyly of all three genera. The main subterranean clades found in the combined tree (including the basal paraphyly of species of Geotrechus) were also present with bootstrap values above 70%, although, due to the lower variability of the nuclear genes, relationships within the two main clades (W and E in Figs. 2 and 3) were not recovered. 3.2. Divergence time estimates We combined the results of the two independent runs of Beast, with a final estimation of the rate at 0.0115 ± 0.0002 substitutions/ site MY. The estimated age of the origin of the subterranean clade was 9.7MY, with a 95% interval of confidence between 7.6 and 12.2MY (Fig. 4). The origin of the main clades (Eastern and Western), and that of the different lineages within each genus, was estimated to be in the Upper Miocene, before the end of the Messinian (Fig. 4). Cladogenetic events within the Pliocene and Pleistocene were almost exclusively within the same geographical area and involving species of the same morphological type (i.e. within lineages of each of the traditional genera) (Fig. 4). 4. Discussion 4.1. Origin of the subterranean Pyrenean clade The most remarkable result of our work was the finding that all the highly modified species of subterranean Trechini from the Pyrenees share a common origin, to the exclusion of all sampled epigean species and all highly modified subterranean species considered by some authors to belong to the phyletic lineage of Aphaenops from other geographical areas (Apoduvalius, Speotrechus, Paraphaenops, Suppl. Table 1). Jeannel (1928) hypothesised a common origin for Aphaenops (plus Hydraphaenops) and Geotrechus, well separated from the epigean Trechus, but included in this subterranean ‘‘phyletic series” other genera from outside the Pyrenees. According to our results, these highly modified subterranean species from nearby areas, or less modified troglobitic species from the Pyrenees, were nested within Trechus sensu lato, and not directly related with the subterranean clade. This was the case of Speotrechus from the Cevennes (Jeannel, 1922), Apoduvalius from the Cantabrian chain (Vives, 1980; although see Faille, 2006 for a different view), Paraphaenops from the Iberian system, or the microphthalmous (but not blind) Trechus navaricus from the Pyrenees. Other subterranean genera, such as Duvalius and Agostinia, have traditionally being considered as part of a distinct lineage (the ‘‘Duvalius phyletic lineage”), not directly related to Aphaenops, in agreement with our results (e.g. Jeannel, 1928; Casale et al., 1998). There are several obvious possible caveats to this conclusion: (1) there could be some un-sampled epigean species which could belong to this clade, (2) there could be some un-sampled Pyrenean subterranean species outside this clade (i.e. sharing a most recent common ancestor with other epigean species, not with the subterranean clade), or (3) there could be some un-sampled non-Pyrenean subterranean species inside this clade. Based on previous morphological analyses there are no obvious candidate species for the first two cases, but for the third only the study of potential candidates (e.g. Sardaphaenops, Italaphaenops, Allegrettia; Casale 103 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 0.2 [0.05,0.38] [0.12,0.57] 0.33 [0.39,1.11] 0.73 0.27 [0.07,0.51] [0.72,1.75] 1.2 [1.17,2.51] [0.84,3.32] 3.35 A_laurenti_MNHN_AF63 A_cerberus_MNHN_AF20_AF30 A_jauzioni_MNHN_AF33 [0.72,2.51] [2.3,4.38] A_bucephalus_MNHN_AF62 [3.26,5.22] 0.67 5.19 2.6 [4.02,6.4] [0.14,1.37] [1.25,4.07] 1.05 [0.29,1.98] 4.76 [6.28,9.16] 7.69 H_penacollaradensis_MNHN_AF121 3.54 H_elegans_MNHN_AF120 [0.84,6.96] 0.86 [0.25,1.64] 3.71 W [0.35,2.11] 6.29 1.45 [5.07,7.52] 7.93 [6.65,9.25] A_loubensi_MNHN_AF3 A_jeanneli_MNHN_AF11 1.16 5.82 [0.52,2.53] 4.33 7.26 A_abodiensis_MNHN_AF4 A_alberti_MNHN_AF12 [2.27,5.23] [5.97,8.6] H_bourgoini_MNHN_AF69 H_pecoudi_MNHN_AF72 [0.81,3.39] [4.59,7.07] H_bourgoini_MNHN_AF68 H_ehlersi_MNHN_AF64 2.02 [2.99,6.47] 9.69 [7.62,12.25] A_crypticola_MNHN_AF135 A_tiresias_MNHN_AF59_AF60 [5.47,8.13] [7.11,9.83] A_hustachei_MNHN_AF39 A_sp_MNHN_AF42 6.73 8.41 A_vandeli_MNHN_AF45 A_delbreili_MNHN_AF37 2.1 1.55 E A_vandeli_MNHN_AF44 A_sp_MNHN_AF133 [2.4,4.16] 4.01 [3.06,4.95] 4.24 A_crypticola_MNHN_AF47 A_pluto_MNHN_AF58 [1.66,3.2] 3.26 A_crypticola_MNHN_AF49 A_mariarosae_MNHN_AF57 1.81 2.4 A_parallelus_MNHN_AF53 A_ludovici_MNHN_AF15 A_rhadamanthus_MNHN_AF13_AF14 A_cabidochei_MNHN_AF5_AF6 A_ochsi_MNHN_AF7_AF8 A_leschenaulti_MNHN_AF1 [2.27,6.12] A_catalonicus_MNHN_AF2 6.28 H_vasconicus_MNHN_AF65 H_galani_MNHN_AF67 [4.3,8.12] H_delicatulus_MNHN_AF66 6.01 G_gallicus_MNHN_AF76 G_trophonius_MNHN_AF83 [4.1,7.78] H_pandellei_MNHN_AF70 3.05 7.7 [0,7.35] [5.12,10.12] G_vulcanus_MNHN_AF91 G_saulcyi_MNHN_AF86 G_orpheus_MNHN_AF79_AF81 1.0 Fig. 4. Ultrametric tree of the Phylogeny of subterranean Trechini of the Pyrenees obtained with Beast, using a standard mitochondrial rate (0.0115 substitutions/site/MY). Number above nodes, estimated age (in MY); numbers below nodes, 95% confidence intervals. and Laneyrie, 1982) can establish their phylogenetic relationships with certain confidence. The sister lineage of the subterranean clade was not well-defined in our analyses, as support for the basal nodes of the lineage including Trechus and related (mostly subterranean) genera was low. What seems clear from our analyses is that, under its current concept, Trechus, with more than 440 species distributed in the northern Hemisphere and the mountains of sub-Saharan Africa (Casale and Laneyrie, 1982), includes epigean or weakly modified subterranean species with a plesiomorphic morphology, forming a largely paraphyletic series with numerous genera of highly modified species nested within. A thorough taxonomic revision of Trechus sensu lato (including the Pyrenean subterranean taxa) would be highly desirable, but impossible until a more comprehensive phylogeny is available. The monophyly of all the highly modified subterranean species of the Pyrenees strongly suggests a single origin of their shared character states: loss of eyes, apterism, depigmented body, a subterranean life, and a requirement for high levels of humidity (e.g. Jeannel, 1926a; Vannier and Thibaud, 1971). These are also traits that have been linked with a reduced dispersal ability (Kane et al., 1992; Barr and Holsinger, 1985; Caccone, 1985), and thus run against the interpretation of a single origin of subterranean adaptations with subsequent diversification over a relatively large geographical area (ca. 360 km, from the Puigmal massif, Geotrechus puigmalensis Lagar, 1981, to Guipuzcoa, Hydraphaenops galani Español, 1968). The traditional solution to this dilemma was the assumption that there have been multiple independent active colonisations of the subterranean environment restricted to a very limited geographical area, each derived from different epigean ancestors and with a secondary reduction of gene flow (the ‘‘adaptive shift hypothesis”, Howarth, 1982; Peck and Finston, 1993; Chapman, 1993; Desutter-Grandcolas and Grandcolas, 1996; Rivera et al., 2002). 104 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 Under this scenario, one would expect to find multiple instances of species with ‘‘intermediate” morphologies (e.g. partly depigmented bodies, reduced eyes) interspersed among the highly modified or epigean ones. Although still based on a limited number of species, this seems to be the case for the Cantabrian chain, with species of Apoduvalius intermixed with epigean Trechus (Fig. 2), and also of the Trechus radiation in the Canary islands, where the subterranean species of the archipelago are closely related to the epigean species from the same geographical area (Contreras-Díaz et al., 2007; Borges et al., 2007). Recent molecular work on other cave-dwelling species also suggests frequent multiple colonisations of the subterranean environment in the same geographic area (Crustacean isopods, Rivera et al., 2002; Amphipods, Fišer et al., 2008). In our case, this interpretation would require the complete extinction of all species with intermediate morphologies which could be included in the Pyrenean subterranean clade. This has been hypothesised for areas subjected to strong fluctuating climate, in particular in areas subjected to dry periods which could result in the extinction of epigean hygrophilous species: the ‘‘climatic relict hypothesis” of Jeannel (1943) and Peck and Finston (1993). According to our estimations based on a standard mitochondrial rate, the origin of the Pyrenean subterranean clade would be mid-late Miocene, a time in when the general climate in the area seems to have been warmer and wetter than today, with extensive forested areas (Bruch et al., 2007; Jiménez-Moreno and Suc, 2007). A possible dry period producing this generalised extinction, and the separation between the main Eastern and Western clades, could have been the Messinian salinity crisis at the Miocene–Pliocene boundary, although recent data suggest that the vegetation of the north Mediterranean area may not have been deeply affected (e.g. Bertini, 2006). In any case, it must be stressed that these dates are based on a fixed rate estimated from a combination of genes in several arthropod groups (0.0115 substitutions/ site/MY, Brower, 1994), and thus have to be considered as merely orientative. The only estimate of mitochondrial evolutionary rate of a closely related group (0.015 substitutions/site/MY for the genus Trechus) is based on the colonisation of the Canary islands, (Contreras-Díaz et al., 2007). As already noted, this was based on a combination of cox1 and cox2, known to have faster rates than ribosomal genes, and thus not directly applicable to our dataset. 4.2. Diversification of the subterranean Pyrenean clade Within the subterranean Pyrenean clade, the three currently recognised genera (Aphaenops, Hydraphaenops and Geotrechus) were found to be polyphyletic. These genera were originally defined according to their general body shape, especially the head and elytra (Jeannel, 1926b; Coiffait, 1962; see Section 2 above). These are likely to be characters reflecting different adaptations to the subterranean environment: even if most species are only known from caves, species of Geotrechus are mostly endogean, living in deep humid soil, while species of Aphaenops live in more open subterranean spaces, such as caves or the interstices of the MSS (Jeannel, 1926b; Juberthie and Bouillon, 1983). A particularly interesting case is the apparently highly specialised habit of most of the species of the genus Hydraphaenops, which seem to live in the cracks of karstic massifs and are only occasionally found in caves. They have a cylindrical head and long and sickled mandibles, likely to be adapted to an unknown prey (Jeannel, 1926b; Deleurance-Glaçon, 1963). According to our results, it seems that the general body shape is associated with the particular ecological and physical conditions of the subterranean environment colonised by these species, with a high degree of homoplasy and convergence (Marquès and Gnaspini, 2001; Fišer et al., 2008). The main lineages within the subterranean clade seem to be geographically well differentiated, with successive splits between the eastern and western Pyrenees resulting in several geographically well-defined clades (Fig. 3). Relationships among closely related species reflect geographical proximity more than general morphological similarities, with morphologically highly divergent species found in close proximity, as found for other subterranean organisms (Fišer et al., 2008). This is for example the case of Hydraphaenops pandellei and Geotrechus gallicus, of very different morphology and ecology, or Aphaenops jeanneli and A. alberti. The latter (Fig. 1) is a very distinct and scarce species endemic to the Arbailles massif, in the western Pyrenees, previously assumed to be related to some species from the Eastern clade (Cerbaphaenops sensu lato), such as A. bucephalus (Jeannel, 1939; Coiffait, 1962) or A. pluto (Jeanne, 1967). It occurs in the same caves with A. jeanneli, to which it is closely related according to our molecular data despite its very different body shape, suggesting an ecological differentiation. On the other hand, species that were previously considered to be closely related based on their general appearance, but occurring in different geographical areas, were found to be included in their local clades. Thus, the species of the subgenera Arachnaphaenops (A. pluto, A. tiresias and A. alberti), with a very similar appearance, were included in three different clades with other Aphaenops species according to their distributions. Similarly, according to our results what is currently considered as Aphaenops crypticola, distributed from caves between Haute-Garonne and Hautes-Pyrénées, would be polyphyletic. The populations of the western part of the range (Aure valley, Mont Né) are very close to A. crypticola aeacus and A. hustachei from the same area, while populations from the eastern part are subdivided in two groups delimited by the Garonne valley: a western (A. crypticola MNHN-51 and 48) and an eastern group (A. crypticola MNHN-47, 49, 52, 136). Due to the lack of resolution of the nuclear data (Suppl. Fig. 2) it is not possible to discard the possibility of local introgression among some of these closely related species, but there is no evidence of incongruence between the nuclear and mitochondrial genomes in any of the lineages for which there is enough resolution, contrary to what happens in other groups of Carabidae, in which introgression through hybridisation is common (e.g. Sota and Vogler, 2001; Deuve, 2004; Streiff et al., 2005; Zhang and Sota, 2007). A re-examination of the morphology of the different populations of A. crypticola in the light of our results revealed differences in the shape of the aedeagus and some male secondary sexual characters consistent with this geographical split (Faille, 2006). We found clear differences in the pattern of diversification between the Western and Eastern clades. The Western clade, between Bagnères-de-Bigorre and the Arbailles massif (clade W, Aphaenops s.str. plus A. (Arachnaphaenops) alberti and Geaphaenops), seems to be the oldest lineage of troglobitic species, with an estimated Late Miocene basal diversification (Fig. 4). Some of the species within this group have secondarily developed endogean habits, with a reverse to a more stout (i.e. less ‘‘aphaenopsian”) body shape (A. ludovici, A. rhadamanthus). They were included in the subgenus Geaphaenops by Cabidoche (1965), together with other endogean species of more uncertain relationships not included in our study (A. linderi Jeannel, 1938, A. rebereti Gaudin, 1947, and also A. cissauguensis Faille and Bourdeau, 2008). The main clade of the Eastern Pyrenees, between Bagneres-deBigorre and the Ariege River (Cerbaphaenops plus the morphologically distinct species A. laurenti, A. bucephalus, A. chappuisi, A. pluto and A. tiresias), seems to be of more recent origin, with a Pliocene– Pleistocene diversification (Fig. 4) and species with a more homogeneous morphology (Coiffait, 1962). The sampling of this clade was complete, with two exceptions: (1) A. bourdeaui Coiffait, 1976, considered as part of Cerbaphaenops despite being found in A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 the area of distribution of the W clade. It is only known from two females collected the same day (Coiffait, 1976), but never found again despite numerous visits to the cave. The lack of males and its geographical distribution cast doubts about its affinities, which could only be solved with molecular data. (2) A. hidalgoi Español and Comas, 1985, also from the W Pyrenees. It was described as Cerbaphaenops (Español and Comas, 1985), but it is a Hydraphaenops-like species, apparently close to H. penacolladarensis—which is found in the same geographical area (Faille, unpublished observations). The Western and Eastern clades overlap in the Bigorre area, where one species of each group occur sympatrically in a few caves: Aphaenops leschenaulti (Eastern clade) and Aphaenops crypticola aeacus (Western clade) (Fresneda et al., 2009). A potential explanation for the differences between the eastern and western lineages of Pyrenean subterranean Trechini could be the different pattern of the limestone areas in which they are found. In the west, areas of suitable karstified habitat tend to be larger and more homogeneous, frequently with continuous patches of ca. 150 km2 (e.g. the Arbailles massif, Vanara, 2000). On the contrary, in the Eastern Pyrenees karstified limestone is highly fragmented, opening opportunities for the development of multiple isolated local populations leading to allopatric speciation (Culver, 1970; Crouau-Roy, 1986; Faille and Déliot, 2007). Acknowledgments We wish to thank J.P. Besson, F. Brehier, E. Dupré, F. Fadrique, J. Fresneda, G. Jauzion, J.M. Salgado, E. Ollivier, J. Raingeard, C. Vanderbergh and all the collectors mentioned in the Suppl. Table 1 for their help during field work, the members of the Groupe Spéléologique du Couserans and Groupe Spéléologique Minos, without whom visiting some particularly difficult cavities would have been impossible, G. Kergoat for the primer cp1, U. Schmidt (http://www.kaefer-der-welt.de/) for the photo of T. quadristriatus, A. Hassanin for help during the PhD of A.F., A. Cieslak, J. Fresneda, A. Casale for multiple discussions on the evolution of the subterranean beetles, D.T. Bilton for reading the manuscript, and three anonymous referees for useful comments on previous versions of our work. A.F. and C.B. thank the Subterranean laboratory of Moulis (currently Station d’écologie expérimentale du CNRS) for support during field work. This study was funded in part by the project Synthesys (ES-TAF-1540) to A.F. and I.R., the Société Entomologique de France (grants ‘‘Germaine Cousin”) to A.F., and the Spanish MICINN project CGL2007-61665 to I.R. We dedicate this work to Philippe Déliot, recently disappeared, without whom collecting all the species necessary to this study could not have been possible. Appendix A Bonvouloir (1862) described the genus Aphoenops for a species collected in a cave of the central French Pyrenees, A. leschenaulti Bonvouloir, 1862. Subsequently, the genus name was written as Aphaenops by Grenier (1864), and this has been the spelling used afterwards by all authors with the only exception of Abeille de Perrin (1872), Bedel and Simon (1875) and Peyerimhoff (1915). Recently Moravec et al. (2003) resurrected the original graphy Aphoenops, which has been subsequently used by Lorenz (2005) and some other authors. An opinion to the ICZN is in preparation to conserve Aphaenops, based on the acceptance by the ICZN of the equivalence of oe and ae for species-level names (not specified for genus-level names), and the prevalence of use for near 150 years, with hundreds of examples of the use of Aphaenops and virtually no use of Aphoenops. 105 Appendix B. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ympev.2009.10.008. References Abeille de Perrin, E., 1872. Etudes sur les Coléoptères cavernicoles suivies de la description de 27 Coléoptères nouveaux français. Marius Olive, Marseille, 41 p. Barr, T.C., 1979. The taxonomy, distribution, and affinities of Neaphaenops, with notes on associated species of Pseudanophthalmus (Coleoptera, Carabidae). Am. Mus. Novit. 2682, 1–20. Barr, T.C., Holsinger, J.R., 1985. Speciation in cave faunas. Ann. Rev. Ecol. Syst. 16, 313–337. Bedel, L., Simon, E., 1875. Liste générale des Articulés Cavernicoles de l’Europe. P. Gervais, Paris, IV, pp. 1–69. Bertini, A., 2006. The Northern Apennines palynological record as a contribute for the reconstruction of the Messinian palaeoenvironments. Sedim. Geol. 188– 189, 235–258. Blin, N., Stafford, D.W., 1976. A general method for isolation of high molecular weight DNA from Eucaryots. Nucleic Acids Res. 3, 2303. Bonvouloir, H. de, 1862. Description d’un genre nouveau et de deux espèces nouvelles de coléoptères de France. Ann. Soc. Entomol. Fr. 4 (1), 567–571 (1861). Borges, P.A.V., Oromí, P., Serrano, A.R.M., Amorim, I.R., Pereira, F., 2007. Biodiversity patterns of cavernicolous ground-beetles and their conservation status in the Azores, with the description of a new species: Trechus isabelae n. sp. (Coleoptera: Carabidae: Trechinae). Zootaxa 1478, 21–31. Brower, A.V.Z., 1994. Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proc. Natl. Acad. Sci. USA 91, 6491–6495. Bruch, A.A., Uhl, D., Mosbrugger, V., 2007. Miocene climate in Europe—Patterns and evolution. A first synthesis of NECLIME. Palaeogeog. Palaeoclim. Palaeoecol. 253, 1–7. Cabidoche, M., 1965. Sur les Aphaenops du groupe rhadamanthus (Col. Carab.). Ann. Spéléol. 20 (4), 523–528. Cabidoche, M., 1966. Contribution à la connaissance de l’écologie des Trechinae cavernicoles pyrénéens. Unpublished thesis. Paris, 228 pp. Caccone, A., 1985. Gene flow in cave arthropods: a qualitative and quantitative approach. Evolution 39, 1223–1234. Casale, A., 2004. Two new hypogean beetles from Sardinia, Sardaphaenops adelphus n. sp. (Coleoptera Carabidae) and Patriziella muceddai n. sp. (Coleoptera Cholevidae) and their biogeographical significance. Boll. Soc. Entomol. Ital. 136 (1), 3–31. Casale, A., Laneyrie, R., 1982. Trechodinae et Trechinae du monde. Tableau des sousfamilles, tribus, séries phylétiques, genres, et catalogue général des espèces. Mém. Biospéol. 9, 1–226. Casale, A., Vigna Taglianti, A., Juberthie, C., 1998. Coleoptera Carabidae. In: Juberthie, C., Decu, V. (Eds.), Encyclopaedia Biospeologica, tome II. Société Internationale de Biospéologie. Moulis, France, pp. 1047–1081. Chapman, P., 1993. Caves and Cave Life. Harper Collins, London. pp. 1–224. Coiffait, H., 1962. Monographie des Trechinae cavernicoles des Pyrénées. Ann. Spéléol. 17 (1), 119–170. Coiffait, H., 1976. Aphaenops (Cerbaphaenops) bourdeaui, nouvelle espèce des Pyrénées Atlantiques. Nouv. Rev. Entomol. 6 (3), 247–248. Contreras-Díaz, H.G., Moya, O., Oromí, P., Juan, C., 2007. Evolution and diversification of the forest and hypogean ground-beetle genus Trechus in the Canary Islands. Mol. Phylogenet. Evol. 42, 687–699. Crouau-Roy, B., 1986. Population studies on pyrenean troglobitic beetles: local genetic differentiation and microgeographic variations in natural populations. Biochem. Syst. Ecol. 14 (5), 521–526. Culver, D.C., 1970. Analysis of simple cave communities. I. Caves as islands. Evolution 24, 463–474. Culver, D.C., Kane, T.C., Fong, D.W., Jones, R., Taylor, M.A., Sauereisen, S.C., 1990. Morphology of cave organisms—is it adaptative? Mém. Biospéol. 17, 13–26. Culver, D.C., Deharveng, L., Bedos, A., Lewis, J.J., Madden, M., Reddell, J.R., Sket, B., Trontelj, P., White, D., 2006. The mid-latitude biodiversity ridge in terrestrial cave fauna. Ecography 29, 120–128. Deleurance, S., 1958. La contraction du cycle évolutif des Coléoptères Bathysciinae et Trechinae en milieu souterrain. C. R. Séances Acad. Sci. 247, 752–753. Deleurance-Glaçon, S., 1963. Contribution à l’étude des coléoptères cavernicoles de la sous-famille des Trechinae. Ann. Spéléol. 18 (2), 227–265. Desutter-Grandcolas, L., Grandcolas, P., 1996. The evolution toward troglobitic life: a phylogenetic reappraisal of climatic relict and local habitat shift hypotheses. Mém. Biospéol. 23, 57–63. Desutter-Grandcolas, L., D’Haese, C., Robillard, T., 2003. The problem of characters susceptible to parallel evolution in phylogenetic reconstructions: a reply to Marquès & Gnaspini (2001) with emphasis on cave life phenotypic evolution. Cladistics 19, 131–137. Deuve, T., 2000. Nouveaux Trechidae cavernicoles chinois, découverts dans les confins karstiques du Sichuan, du Hubei et du Yunnan (Coleoptera, Adephaga). Rev. Fr. Entomol. (n.s.) 21, 151–161. Deuve, T., 2001. Le genre Eustra Schmidt-Goebel, 1846, insectes (Coleoptera, Paussidae, Ozaeninae) à genitalia femelles orthotopiques. Zoosystema 23 (3), 547–578. 106 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 Deuve, T., 2004. Illustrated catalogue of the genus Carabus of the world (Coleoptera: Carabidae). Pensoft Publ., Sofia, Moscow, x + 461 pp. Drummond, A.J., Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7, 214. Drummond, A.J., Ho, S.Y.W., Phillips, M.J., Rambaut, A., 2006. Relaxed phylogenetics and dating with confidence. PLoS Biol. 4 (5), e88. doi:10.1371/ journal.pbio.0040088. Dupré, E., 1991. Trechini nouveaux ou peu connus de France et d’Espagne (Coléoptères Carabidae). Mém. Biospéol. 18, 287–299. Español, F., 1968. Un nuevo Hydraphaenops de la provincia de Guipúzcoa (Col. Trechidae). Misc. Zool. 2 (3), 55–58. Español, F., Comas, J., 1985. Un nuevo Aphaenops Bonv. de la vertiente española de los Pirineos (Col., Carabidae, Trechinae). Misc. Zool. 9, 219–221. Faille, A., 2006. Endémisme et adaptation à la vie cavernicole chez les Trechinae Pyrénéens (Coleoptera: Carabidae). Approches moléculaire et morphométrique. Unpublished thesis. Muséum National d’Histoire Naturelle, Paris, 319 pp. Faille, A., Déliot, P., Quéinnec, E., 2007. A new cryptic species of Aphaenops (Coleoptera: Carabidae: Trechinae) from a French Pyrenean cave: congruence between morphometrical and geographical data confirm species isolation. Ann. Soc. Entomol. Fr. (n.s.) 43 (3), 363–370. Faille, A., Fresneda, J., Déliot, P., Bourdeau, C., 2006. Description du mâle d’Aphaenops catalonicus Escolà & Canció (Coleoptera, Trechinae). Bull. Soc. Entomol. Fr. 111 (2), 247–250. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fišer, C., Sket, B., Trontelj, P., 2008. A phylogenetic perspective on 160 years of troubled taxonomy of Niphargus (Crustacea: Amphipoda). Zool. Script. 37 (6), 665–680. Fresneda, J., Salgado, J.M., Ribera, I., 2007. Phylogeny of western Mediterranean Leptodirini, with an emphasis on genital characters (Coleoptera: Leiodidae: Cholevinae). Syst. Entomol. 32, 332–358. Fresneda, J., Bourdeau, C., Faille, A., 2009. Baronniesia delioti gen. n. sp. n., a new subterranean Leptodirini from the French Pyrenees (Coleoptera: Leiodidae: Cholevinae). Zootaxa 1993, 1–16. Genest, L.C., 1983. Nouvelles espèces d’Aphaenops et d’Hydraphaenops des Pyrénées Centrales (Coléoptères Trechinae). Mém. Biospéol. 10, 305–310. Gilbert, M.T.P., Moore, W., Melchior, L., Worobey, M., 2007. DNA extraction from dry museum beetles without conferring external morphological damage. PLoS ONE 2 (3), e272. doi:10.1371/journal.pone.0000272. Grebennikov, V.V., 2008. Tasmanitachoides belongs to Trechini (Coleoptera: Carabidae): discovery of the larva, its phylogenetic implications and revised key to Trechitae genera. Invertebr. Syst. 22, 479–488. Grebennikov, V.V., Maddison, D.R., 2005. Phylogenetic analysis of Trechitae (Coleoptera: Carabidae) based on larval morphology, with description of firstinstar Phrypeus and a key to genera. Syst. Entomol. 30, 38–59. Grenier, A., 1864. Description de nouvelles espèces de Coléoptères Français des genres Cionus, Raymondia et Anophthalmus et quelques réflexions sur les yeux de certaines espèces réputées aveugles. Ann. Soc. Entomol. Fr. 33, 133–140. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Howarth, F.G., 1982. Bioclimatic and geologic factors governing the evolution and distribution of Hawaiian cave insects. Entomol. Gen. 8 (1), 17–26. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Jeanne, C., 1967. Carabiques de la péninsule ibérique (5ème note). Actes Soc. Linn. Bordeaux, Sér. A 10 (104), 1–22. Jeannel, R., 1919. Diagnoses préliminaires de Trechinae [Col. Carabidae] cavernicoles nouveaux de France. Bull. Soc. Entomol. Fr., 253–255. Jeannel, R., 1922. Les Trechinae de France (Deuxième partie). Ann. Soc. Entomol. Fr. 90, 295–345 (1921). Jeannel, R., 1926a. Faune cavernicole de la France avec une étude des conditions d’existence dans le domaine souterrain. Lechevalier, Paris. 334 pp. Jeannel, R., 1926b. Monographie des Trechinae. Morphologie comparée et distribution d’un groupe de Coléoptères. L’Abeille 32, 221–550. Jeannel, R., 1928. Monographie des Trechinae. Morphologie comparée et distribution d’un groupe de Coléoptères. Troisième Livraison: les Trechini cavernicoles. L’Abeille 35, 1–808. Jeannel, R., 1939. Un nouvel Aphaenops de la grotte d’Oxibar. Rev. Fr. Entomol. 6 (3– 4), 83–85. Jeannel, R., 1941. Faune de France. Coléoptères Carabiques I, vol. 39. Lechevalier, Paris. 571 pp. Jeannel, R., 1943. Les fossiles vivants des cavernes. Gallimard, Paris. 321 pp. Jiménez-Moreno, G., Suc, J.P., 2007. Middle Miocene latitudinal climatic gradient in Western Europe: evidence from pollen records. Palaeogeog. Palaeoclim. Palaeoecol. 253, 208–225. Juberthie, C., Bouillon, M., 1983. Présence des Aphaenops (Coléoptères Trechinae) dans le milieu souterrain superficiel des Pyrénées françaises. Mém. Biospéol. 10, 91–98. Kane, T.C., Barr Jr., T.C., Badaracca, W.J., 1992. Cave beetle genetics: geology and gene flow. Heredity 68, 277–286. Katoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 9 (4), 286–298. Katoh, K., Misawa, K., Kuma, K., Miyata, T., 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30 (14), 3059–3066. Laurenti, J.N., 1768. Specimen Medicum, Exhibens Synopsin Reptilium Emendatam Cum Experimentis Circa Venena et Antidota Reptilium Austriacorum. Wien. 214 pp. Lorenz, W., 2005. A Systematic List of Extant Ground Beetles of the World. (Coleoptera ‘‘Geadephaga”: Trachypachidae and Carabidae incl. Paussinae, Cicindelinae, Rhysodinae), second ed. Tutzing, Germany. 530p.. Marquès, A.C., Gnaspini, P., 2001. The problem of characters susceptible to parallel evolution in phylogenetic reconstructions: suggestion of a practical method and its application to cave animals. Cladistics 17, 371–381. Monteiro, A., Pierce, N.E., 2001. Phylogeny of Bicyclus (Lepidoptera: Nymphalidae) inferred from COI, COII, and Ef-1a gene sequences. Mol. Phylogenet. Evol. 18, 264–281. Moravec, P., Uéno, S.-I., Belousov, I.A., 2003. Tribe Trechini. In: Löbl, Smetana (Eds.), Catalogue of Palaearctic Coleoptera, Archostemata, Myxophaga, Adephaga, vol. 1. Apollo Books, Stenstrup, pp. 288–346 Ober, K.A., 2002. Phylogenetic relationships of the carabid subfamily Harpalinae (Coleoptera) based on molecular sequence data. Mol. Phylogenet. Evol. 24, 228– 248. Ortuño, V.M., Sendra, A., Montagud, S., Teruel, S., 2004. Systématique et biologie d’une espèce paléoendémique hypogée de la péninsule Ibérique: Ildobates neboti Español 1966 (Coleoptera: Carabidae: Dryptinae). Ann. Soc. Entomol. Fr. (n.s.) 40 (3–4), 459–475. Peck, S.B., Finston, T.L., 1993. Galapagos islands troglobites: the question of tropical troglobites, parapatric distributions with eyed sister-species, and their origin by parapatric speciation. Mém. Biospéol. 20, 19–37. Peyerimhoff, P. de, 1915. Variations de contours et de la chétotaxie chez Trechus (Trechopsis) lapiei Peyer.; démonstration de sa parente phylogénique avec Aphoenops iblis Peyer. Bull. Soc. Entomol. Fr., 128–133. Pons, J., 2006. DNA-based identification of preys from non-destructive, total DNA extractions of predators using arthropod universal primers. Mol. Ecol. Notes 6, 623–626. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14 (9), 817–818. Putzeys, J., 1870. Trechorum oculatorum Monographia. Stett. Entomol. Zeit. 31 (1– 3), 7–48. 145–201. Racovitza, E.G., 1907. Essai sur les problèmes biospéologiques. Arch. Zool. Exp. Gén. 6 (4ème sér.), 371–488. Ribera, I., Hernando, C., Aguilera, P., 2001. Agabus alexandrae n.sp. from Morocco, with a molecular phylogeny of the western Mediterranean species of the A. guttatus group (Coleoptera: Dytiscidae). Ins. Syst. Evol. 32, 253–262. Rivera, M.A.J., Howarth, F.G., Taiti, S., Roderick, G.K., 2002. Evolution in Hawaiian cave-adapted isopods (Oniscidea: Philosciidae): vicariant speciation or adaptive shifts? Mol. Phylogenet. Evol. 25, 1–9. Roncin, E., Deharveng, L., 2003. Leptogenys khammouanensis sp. nov. (Hymenoptera: Formicidae). A possible troglobitic species of Laos, with a discussion on cave ants. Zool. Sci. 20, 919–924. Rowley, D.L., Coddington, J.A., Gates, M.W., Norrbom, A.L., Ochoa, R.A., Vandenberg, N.J., Greenstone, M.H., 2007. Vouchering DNA-barcoded specimens: test of a nondestructive extraction protocol for terrestrial arthropods. Mol. Ecol. Notes 7, 915–925. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Shull, V.L., Vogler, A.P., Baker, M.D., Maddison, D.R., Hammond, P.M., 2001. Sequence alignment of 18S Ribosomal RNA and the basal relationships of Adephagan beetles: evidence for monophyly of aquatic families and the placement of Trachypachidae. Syst. Biol. 50, 945–969. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651–701. Sota, T., Vogler, A.P., 2001. Incongruence of mitochondrial and nuclear gene trees in the Carabid beetles Ohomopterus. Syst. Biol. 50, 39–59. Streiff, R., Veyrier, R., Audiot, P., Meusnier, S., Brouat, C., 2005. Introgression in natural populations of bioindicators: a case study of Carabus splendens and Carabus punctatoauratus. Mol. Ecol. 14, 3775–3786. Swofford, D.L., 2002. PAUP*: Phylogenetic Analysis Using Parsimony ( and Other Methods) Version 4. Sinauer Associates, Sunderland, MA. Templeton, A.R., 1983. Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of man and the apes. Evolution 37, 221–224. Uéno, S.I., Clarke, A.K., 2007. Discovery of a new aphaenopsoid Trechine Beetle (Coleoptera, Trechinae) in northeastern Jiangxi, East China. Elytra, Tokyo 35 (1), 267–278. Vanara, N., 2000. Le karst des Arbailles (Pyrénées-Atlantiques, France). Karstologia 36, 23–42. Vandel, A., 1964. Biospéologie. La Biologie des Animaux Cavernicoles. GauthierVillars, Paris. 619 pp. Vannier, G., Thibaud, J.M., 1971. Relation entre l’activité motrice d’une espèce de Collemboles cavernicoles et les variations de température dans son biotope. Rev. Ecol. Biol. Sol. 8 (2), 261–286. Vives, E., 1980. Revision del género Apoduvalius Jeannel (Col. Trechinae). Speleon 25, 15–21. Zhang, A.-B., Sota, T., 2007. Nuclear gene sequences resolve species phylogeny and mitchondrial introgression in Leptocarabus beetles showing trans-species polymorphisms. Mol. Phylogenet. Evol. 45, 534–546. Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. dissertation. The University of Texas at Austin. Available from: <www.bio.utexas.edu/faculty/antisense/garli/Garli.html>. Supplementary Fig. 1. Phylogeny of subterranean Trechini of the Pyrenees obtained with parsimony in PAUP, using the combined data matrix. Number in nodes, bootstrap values (if above 50%). “Western” and “Eastern” clades marked with “W” and “E”, respectively (see text). Supplementary Fig. 2: Phylogeny of subterranean Trechini of the Pyrenees obtained with maximum likelihood in Garli, using only the nuclear sequences (LSU+SSU). Number in nodes, bootstrap values (if above 50%). “Western” clade marked with “W”; “E+” Eastern clade plus some additional species (see text). Suppl. Table 1. Sequenced specimens, with locality, collectors, sequence accession numbers and ecology (T: troglobitic, E: endogean, Ep: Epigean). Code of specimens used to build composite sequences marked with stars. No sp 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 Trechini Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Bonvouloir, 1862 Bonvouloir, 1862 (sensu stricto) leschenaulti Bonvouloir, 1861 catalonicus Escolà & Canció, 1983 loubensi Jeannel, 1953 abodiensis Dupré, 1988 bessoni Cabidoche, 1961 cabidochei Coiffait, 1959 Aphaenops ochsi Gaudin, 1925 Aphaenops jeanneli (Abeille de Perrin, 1905) Aphaenops orionis Fagniez, 1913 Geaphaenops Cabidoche, 1966 Aphaenops rhadamanthus (Linder, 1860) Aphaenops ludovici Colas & Gaudin, 1935 Cerbaphaenops Coiffait, 1962 Aphaenops cerberus (Dieck, 1869) Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops Aphaenops jauzioni Faille, Déliot & Quéinnec, 2007 carrerei Coiffait, 1953 michaeli Fourès, 1954 delbreili Genest, 1983 bonneti Fourès, 1948 hustachei Jeannel, 1916 sp. sp. crypticola aeacus (Saulcy, 1864) sp. vandeli Fourès, 1954 Aphaenops vandeli bouiganensis Fourès, 1954 Aphaenops crypticola (Linder, 1859) Aphaenops parallelus Coiffait, 1954 Aphaenops sioberae Fourès, 1954 Aphaenops bouilloni Coiffait, 1955 Aphaenops sp. Aphaenops mariaerosae Genest, 1983 Aphaenops chappuisi Coiffait, 1955 Arachnaphaenops Jeanne, 1967 Aphaenops pluto (Dieck, 1869) Aphaenops tiresias (Piochard de La Brûlerie, 1872) Aphaenops alberti Jeannel, 1939 Cephalaphaenops Coiffait, 1962 Aphaenops bucephalus (Dieck, 1869) Pubaphaenops Genest, 1983 Aphaenops laurenti Genest, 1983 Hydraphaenops Jeannel, 1926 Hydraphaenops ehlersi (Abeille de Perrin, 1872) Hydraphaenops vasconicus (Jeannel, 1913) Hydraphaenops vasconicus delicatulus Coiffait, 1962 Hydraphaenops galani Español, 1968 Hydraphaenops bourgoini (Jeannel, 1945) Hydraphaenops pandellei (Linder, 1859) locality collector Grotte de Castelmouly - Bagnères-de-Bigorre (France-65) Cova des Toscllosses - Bonansa (Spain-Huesca) Salle de la Verna - Sainte-Engrâce (France-64) Villanueva de Aezkoa - Sierra de Abodi - P70 (Spain-Navarra) Gouffre du Col d’Aran 3 - Bielle (France-64) Salle de la Verna - Sainte-Engrâce (France-64) Villanueva de Aezkoa - Sierra de Abodi - P70 (Spain-Navarra) Grotte d’Ayssaguer - Larrau (France-64) Sima de Garralda - P10 (Spain-Navarra) Aven d’Istaurdy - Aussurucq (France-64) Mine de Larrey - Montory (France-64) Gouffre EL71 - Château-Pignon (France-64) C. C. C. C. C. C. C. C. C. C. C. C. Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, Bourdeau, P. Déliot, A. Faille P. Déliot, J. Fresneda P. Déliot, A. Faille A. Faille, E. Quéinnec E. Ollivier P. Déliot, A. Faille A. Faille, E. Quéinnec P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille Doline de la Sablère - Castet (France-64) Aven de Nabails - Arthez d'Asson (France-64) Grotte d’Ambielle - Arette (France-64) C. Bourdeau C. Bourdeau, P. Déliot, A. Faille C. Bourdeau, P. Déliot, A. Faille Grotte du Sendé - Moulis (France-09) Grotte de L'Estelas - Cazavet (France-09) Grotte d’Artigouli - Estadens (France-31) Gouffre du Trapech d’en Haut - Bordes-sur-Lez (France-09) Grotte de Noël - Seix (France-09) Gouffre du Petit Mirabat - Ercé (France-09) Trou du Rantou - Suc-et-Sentenac (France-09) Grotte de l'Eglise - Nistos (France-65) Grotte de Frechet-Aure - Frechet-Aure (France-65) Grotte de la Cascade - Sarrancolin (France-65) Grotte de Castelmouly - Bagnères-de-Bigorre (France-65) Tuto de la Cigalero - Ferrère (France-65) Grotte de Payssa - Salsein (France-09) MSS S100 - Illartein (France-09) Grotte SL1 - Saint-Lary (France-09) Grotte de L'Ournas - Saint-Lary (France-09) Gouffre de Peyreigne - Tibiran-Jaunac (France-65) Grotte d’Aron - Portet d’Aspet (France-31) Grotte de Gouillou - Aspet (France-31) Grotte de Terreblanque - Aspet (France-31) Grotte de l’Haiouat de Pelou - Nistos (France-65) Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) Grotte de la Buhadère - Coulédoux (France-31) Grotte de Payssa - Salsein (France-09) Grotte de Pétillac - Bordes-sur-Lez (France-09) Grotte d'Aulignac - Bordes-sur-Lez (France-09) Gouffre du Trapech d’en Haut - Bordes-sur-Lez (France-09) Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille C. Bourdeau, P. Déliot, A. Faille C. Bourdeau, P. Déliot, P. Déliot, A. Faille C. Bourdeau, P. Déliot, C. Bourdeau, P. Déliot, C. Bourdeau, P. Déliot, C. Bourdeau, P. Déliot, P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille C. Bourdeau, P. Déliot, P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille A. Faille C. Bourdeau, P. Déliot, P. Déliot, A. Faille Grotte du Sendé - Moulis (France-09) Gouffre de la Peyrère - Balaguères (France-09) Grotte du Goueil-di-Her - Arbas (France-31) Aven prox. Istaurdy - Aussurucq (France-64) P. Déliot, A. Faille A. Faille C. Bourdeau, P. Déliot, A. Faille C. Bourdeau Gouffre de la Peyrère - Balaguères (France-09) A. Faille A. Faille A. A. A. A. Faille Faille Faille Faille A. Faille biology code T T T T T T T T T T T T MNHN-AF1 MNHN-AF2 MNHN-AF3 MNHN-AF4 MNHN-AF122 MNHN-AF5* MNHN-AF6* MNHN-AF7* MNHN-AF8* MNHN-AF11 MNHN-AF10* MNHN-AF9* E E E MNHN-AF14* MNHN-AF13* GQ293506 MNHN-AF15* T T T T T T T T T T T T T MSS T T T T T T T T MSS/T T T T T T MNHN-AF30* MNHN-AF20* MNHN-AF33 MNHN-AF34 MNHN-AF35 MNHN-AF37 MNHN-AF38 MNHN-AF39 MNHN-AF134 MNHN-AF135 MNHN-AF40 MNHN-AF42 MNHN-AF44 MNHN-AF43 MNHN-AF45 MNHN-AF46 MNHN-AF51 MNHN-AF52 MNHN-AF47 MNHN-AF50 MNHN-AF48 MNHN-AF49 MNHN-AF53 MNHN-AF54 MNHN-AF56 MNHN-AF133 MNHN-AF57 MNHN-AF61 SSU LSU GQ293593 GQ293508 GQ293555 cox1 rrnL tRNA-Leu nad1 GQ293629 GQ293739 GQ293757 GQ293822 GQ293674 GQ293699 GQ293756 GQ293821 cyb GQ293886 GQ293660 GQ293863 GQ293627 GQ293862 GQ293554 GQ293556 GQ293667 GQ293520 GQ293890 GQ293741 GQ293778 GQ293831 GQ293740 GQ293777 GQ293830 GQ293666 GQ293521 GQ293601 GQ293594 GQ293507 GQ293892 GQ293661 GQ293891 GQ293664 GQ293885 GQ293592 GQ293677 GQ293717 GQ293776 GQ293827 GQ293895 GQ293550 GQ293676 GQ293716 GQ293775 GQ293828 GQ293896 GQ293589 GQ293646 GQ293718 GQ293779 GQ293835 GQ293871 GQ293581 GQ293640 GQ293512 GQ293572 GQ293641 GQ293515 GQ293585 GQ293722 GQ293768 GQ293815 GQ293513 GQ293570 GQ293720 GQ293773 GQ293804 GQ293721 GQ293774 GQ293805 GQ293711 GQ293751 GQ293844 GQ293710 GQ293749 GQ293842 GQ293526 GQ293638 GQ293571 GQ293514 GQ293573 GQ293636 GQ293877 GQ293643 GQ293576 GQ293635 GQ293574 GQ293750 GQ293845 GQ293637 GQ293696 GQ293752 GQ293843 GQ293884 GQ293584 GQ293657 GQ293706 GQ293762 GQ293808 GQ293869 GQ293705 GQ293761 GQ293807 GQ293709 GQ293765 GQ293812 GQ293653 GQ293708 GQ293764 GQ293811 GQ293868 GQ293582 GQ293652 GQ293707 GQ293763 GQ293810 GQ293865 GQ293587 GQ293639 GQ293575 GQ293644 GQ293648 GQ293656 GQ293510 GQ293516 GQ293590 GQ293654 GQ293580 GQ293642 GQ293591 GQ293651 GQ293577 GQ293671 GQ293579 GQ293650 GQ293578 GQ293655 GQ293856 GQ293867 GQ293855 GQ293866 GQ293858 GQ293859 GQ293870 GQ293586 GQ293645 GQ293694 GQ293758 GQ293806 GQ293888 GQ293568 GQ293649 GQ293704 GQ293760 GQ293809 GQ293860 GQ293525 GQ293563 GQ293684 T T T T MNHN-AF58 MNHN-AF59* GQ293527 MNHN-AF60* MNHN-AF12 GQ293567 GQ293647 GQ293596 GQ293658 GQ293713 GQ293748 GQ293800 GQ293595 GQ293662 GQ293700 GQ293782 GQ293829 GQ293853 A. Faille T MNHN-AF62 GQ293588 GQ293675 GQ293693 GQ293747 GQ293814 GQ293876 Grotte de Bordes de Crues - Seix (France-09) A. Faille T MNHN-AF63 GQ293569 GQ293634 GQ293719 GQ293767 GQ293813 GQ293873 Goueil-di-Her - Arbas (France-31) Aven d’Istaurdy - Aussurucq (France-64) Salle de la Verna - Sainte-Engrâce (France-64) Guardetxe Koleccia - Usurbil (Spain-Guipuzcoa) Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) Grotte de l'Eglise - Nistos (France-65) Grotte d’Arréglade - Rébénacq (France-64) C. Bourdeau, P. Déliot, C. Bourdeau, P. Déliot, C. Bourdeau, P. Déliot, C. Bourdeau P. Déliot, A. Faille C. Bourdeau, P. Déliot, C. Bourdeau T T T T T T T MNHN-AF64 MNHN-AF65 MNHN-AF66 MNHN-AF67 MNHN-AF69 MNHN-AF68 MNHN-AF70 GQ293565 GQ293683 GQ293622 GQ293628 GQ293698 GQ293759 GQ293803 GQ293600 GQ293663 GQ293695 GQ293753 GQ293818 A. Faille A. Faille A. Faille A. Faille A. Faille GQ293509 GQ293883 GQ293712 GQ293583 GQ293511 GQ293530 GQ293524 GQ293864 GQ293889 GQ293602 GQ293875 GQ293872 GQ293697 GQ293746 GQ293817 GQ293553 GQ293672 GQ293734 GQ293755 GQ293824 GQ293894 GQ293552 GQ293659 GQ293733 GQ293772 GQ293826 GQ293851 GQ293545 GQ293681 GQ293880 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 Hydraphaenops pecoudi (Gaudin, 1938) Hydraphaenops elegans Gaudin, 1945 Hydraphaenops penacollaradensis Dupré, 1991 Geotrechus Jeannel, 1919 Geotrechus Jeannel, 1919 (sensu stricto) Geotrechus discontignyi (Fairmaire, 1863) Geotrechus orcinus (Linder, 1859) Geotrechus orpheus (Dieck, 1869) Geotrechus trophonius (Abeille de Perrin, 1872) Geotrechidius Jeannel, 1947 Geotrechus gallicus (Delarouzee, 1857) Geotrechus jeanneli Gaudin, 1938 Geotrechus saulcyi (Argod-Vallon, 1913) Geotrechus seijasi Español, 1969 Geotrechus vandeli Coiffait, 1959 Geotrechus vulcanus (Abeille de Perrin, 1904) Trechus Clairville, 1806 Trechus distigma Kiesenwetter, 1851 Trechus quadristriatus (Schrank, 1781) Trechus barnevillei Pandellé, 1867 Trechus fulvus Dejean, 1831 Trechus saxicola Putzeys, 1870 Trechus schaufussi Putzeys, 1870 Trechus grenieri uhagoni Crotch, 1869 Trechus navaricus (Vuillefroy, 1869) Trechus escalerai Abeille de Perrin, 1903 Trechus obtusus Erichson, 1837 Trechus comasi Hernando, 2001 Trechus ceballosi Mateu, 1953 Apoduvalius Jeannel, 1953 Apoduvalius alberichae Español, 1971 Apoduvalius sp. Speotrechus Jeannel, 1922 Speotrechus mayeti (Abeille de Perrin, 1875) Paraphaenops Jeannel, 1916 Paraphaenops breuilianus (Jeannel, 1916) Iberotrechus Jeannel, 1920 Iberotrechus bolivari (Jeannel, 1913) Duvalius Delarouzée, 1859 Duvalius berthae (Jeannel, 1910) Duvalius roberti (Abeille de Perrin, 1903) Agostinia Jeannel, 1928 Agostinia gaudini (Jeannel, 1952) Laosaphaenops Deuve, 2000 Laosaphaenops deharvengi Deuve, 2000 Aepopsis Jeannel, 1922 Aepopsis robini (Laboulbène, 1849) Perileptus Schaum, 1860 Perileptus areolatus (Creutzer, 1799) Bembidiini Philochthus Stephens, 1828 Philochthus lunulatus (Fourcroy, 1795) Typhlocharis Dieck, 1869 Typhlocharis sp. Porotachys Netolitzky, 1914 Porotachys bisulcatus (Nicolaï, 1822) Grotte d' Ambielle - Arette (France-64) C. Bourdeau, A. Faille Gouffre du Barroti - Lacourt (France-09) A. Faille Subterranean river of Artigaléou-Arodets - Esparros (France-65) C. Bourdeau, E. Ollivier, E. Quéinnec Aven El Sinistro, Villanúa (Spain-Huesca) C. Bourdeau, E. Ollivier T T T T MNHN-AF71 MNHN-AF72 MNHN-AF120 MNHN-AF121 GQ293546 GQ293566 GQ293673 GQ293754 GQ293816 GQ293702 GQ293771 GQ293823 GQ293744 GQ293789 GQ293802 C. Bourdeau, P. Déliot, A. Faille C. Bourdeau, P. Déliot, A. Faille P. Déliot, A. Faille P. Déliot, A. Faille A. Faille E/T E/T E/T E/T E/T MNHN-AF92 MNHN-AF85 GQ293519 MNHN-AF81* GQ293528 MNHN-AF79* MNHN-AF83 GQ293560 Aven de Nabails - Arthez d'Asson (France-64) Grotte de la Bouhadère - Saint-Pé-de-Bigorre (France-65) Grotte du Ker - Rivérenert (France-09) Gouffre du Barroti - Lacourt (France-09) Cova d'en Manent - Isòvol (Spain-Girona) Aven d'Anglade - Couflens (France-09) Perte du Fustié - Saint-Martin-de-Caralp (France-09) C. Bourdeau, P. Déliot, A. Faille C. Bourdeau, P. Déliot, A. Faille P. Déliot, A. Faille A. Faille P. Déliot, A. Faille P. Déliot, A. Faille C. Bourdeau, A. Faille E E E/T E/T E/T E E/T MNHN-AF76 MNHN-AF77 MNHN-AF87 MNHN-AF86 MNHN-AF89 MNHN-AF88 MNHN-AF91 Aven de Nabails - Arthez d'Asson (France-64) Collau de la Plana del Turbón - Egea (Spain-Huesca) Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria) Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria) Braña Caballo - Piedrafita (Spain-León) Ciudad Real-Navas de Estena-"El Boqueron" (Spain-Toledo) Cueva de Orobe - Alsasúa (Spain-Navarra) Grotte de Sare - Sare (France-64) Cueva de Porro Covañona - Covadonga (Spain-Asturias) Saint-Pé-de-Bigorre (France-65) Cueva Basaura - Barindano (Spain-Navarra) Aven de Licie Etsaut, Lanne-en Barétous (France-64) C. Bourdeau, P. Déliot, A. Faille P. Déliot, A. Faille, J. Fresneda C. Bourdeau, P. Déliot, A. Faille C. Bourdeau, P. Déliot, A. Faille C. Bourdeau, P. Déliot, A. Faille A. Faille C. Bourdeau C. Bourdeau J.M. Salgado C. Bourdeau, A. Faille J. Fresneda C. Bourdeau, A. Faille Ep Ep Ep/T Ep/T Ep E/MSS T T T Ep T Ep MNHN-AF94 MNHN-AF96 MNHN-AF97 MNHN-AF98 MNHN-AF100 MNHN-AF101 MNHN-AF102 MNHN-AF103 MNHN-AF104 MNHN-AF126 MNHN-AF127 MNHN-AF128 Cova de Agudir - Cardano de abajo - Palencia (Spain-Asturias) Cueva Requexada - Piloñeta (Spain-Asturias) J.M. Salgado J.M. Salgado T T MNHN-AF105 GQ293536 MNHN-AF106 GQ293537 GQ293618 Perte du Rimouren - Saint-Montant (France-07) J-Y. Bigot T MNHN-AF107 GQ293535 GQ293547 Cova Cambra - Tortosa (Spain-Tarragona) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF108 GQ293541 GQ293551 GQ293685 Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria) C. Bourdeau, P. Déliot, A. Faille Ep/T MNHN-AF111 GQ293615 GQ293679 Cova d’en Xoles - Pratdip (Spain-Tarragona) Cova Massega - Llaberia (Spain-Tarragona) Grotte de Peïra Cava - Peïra Cava (France-06) C. Bourdeau, P. Déliot, F. Fadrique, A. Faille C. Bourdeau, P. Déliot, F. Fadrique, A. Faille A. Coache, J. Raingeard T T T MNHN-AF115* MNHN-AF114* GQ293531 MNHN-AF129 GQ293606 GQ293626 Puits des Bauges - Dévoluy (France-05) J-Y. Bigot T MNHN-AF116 GQ293543 GQ293604 Vang Vieng-Nam Xang Tai (Laos) A. Bedos, L. Deharveng T MNHN-AF117 GQ293542 GQ293621 Plage du Toëno - Trébeurden (France-22) A. Faille Ep MNHN-AF112 GQ293504 GQ293623 Immouzer des Ida Outanane (Maroc) P. Aguilera, C. Hernando, I. Ribera Ep MNHN-AF113 GQ293503 GQ293625 A. Cieslak, I. Ribera Ep MNHN-AF118 GQ293505 E MNHN-AF119 GQ293502 GQ293624 MNHN-AF131 GQ293544 Santa Almagrera (Spain-Almería) C. Andujar Grotte des Fées - Saint-Cricq-du-Gave (France-40) C. Bourdeau, A. Faille Ep/T GQ293878 GQ293703 GQ293564 Grotte du Tuco - Bagnères-de-Bigorre (France-65) Gouffre de Peyreigne - Tibiran (France-65) Grotte de la Quère - Mérigon (France-09) Grotte de Montespan - Ganties (France-31) Grotte de Tuto Heredo - Merigon (France-09) Guadalajara - El Pobo de Dueñas (Spain-Guadalajara) GQ293738 GQ293562 GQ293893 GQ293559 GQ293597 GQ293665 GQ293723 GQ293780 GQ293834 GQ293561 GQ293631 GQ293715 GQ293766 GQ293825 GQ293874 GQ293518 GQ293557 GQ293670 GQ293724 GQ293769 GQ293798 GQ293517 GQ293558 GQ293725 GQ293770 GQ293799 GQ293522 GQ293548 GQ293714 GQ293784 GQ293833 GQ293701 GQ293786 GQ293832 GQ293743 GQ293745 GQ293841 GQ293727 GQ293783 GQ293848 GQ293788 GQ293820 GQ293669 GQ293668 GQ293529 GQ293598 GQ293523 GQ293549 GQ293534 GQ293619 GQ293533 GQ293607 GQ293678 GQ293680 GQ293613 GQ293614 GQ293887 GQ293854 GQ293599 GQ293611 GQ293852 GQ293879 GQ293729 GQ293682 GQ293882 GQ293532 GQ293620 GQ293737 GQ293540 GQ293616 GQ293730 GQ293539 GQ293603 GQ293538 GQ293612 GQ293731 GQ293793 GQ293839 GQ293608 GQ293726 GQ293795 GQ293847 GQ293728 GQ293791 GQ293850 GQ293732 GQ293794 GQ293840 GQ293736 GQ293796 GQ293846 GQ293687 GQ293617 GQ293610 GQ293632 GQ293609 GQ293881 GQ293605 GQ293735 GQ293781 GQ293819 GQ293691 GQ293785 GQ293837 GQ293692 GQ293787 GQ293838 GQ293689 GQ293792 GQ293836 GQ293690 GQ293797 GQ293801 GQ293742 GQ293790 GQ293849 GQ293857 GQ293630 GQ293688 GQ293686 GQ293861 GQ293633 Suppl. Table 2. Estimated parameters in the MrBayes run. Partition Gene 1 LSU 2 cox1 3 cyb 4 SSU 5 rrnL-tRNA-Leu-nad1 Parameter TL{all} r(A<->C){1} r(A<->G){1} r(A<->T){1} r(C<->G){1} r(C<->T){1} r(G<->T){1} r(A<->C){2} r(A<->G){2} r(A<->T){2} r(C<->G){2} r(C<->T){2} r(G<->T){2} r(A<->C){3} r(A<->G){3} r(A<->T){3} r(C<->G){3} r(C<->T){3} r(G<->T){3} r(A<->C){4} r(A<->G){4} r(A<->T){4} r(C<->G){4} r(C<->T){4} r(G<->T){4} r(A<->C){5} r(A<->G){5} r(A<->T){5} r(C<->G){5} r(C<->T){5} r(G<->T){5} pi(A){1} pi(C){1} pi(G){1} pi(T){1} pi(A){2} pi(C){2} pi(G){2} pi(T){2} pi(A){3} pi(C){3} pi(G){3} pi(T){3} pi(A){5} pi(C){5} pi(G){5} pi(T){5} alpha{1} alpha{2} alpha{3} alpha{5} pinvar{1} pinvar{2} pinvar{3} pinvar{4} pinvar{5} Mean 4.559693 0.049424 0.315247 0.230424 0.021475 0.31653 0.066901 0.040399 0.311296 0.048516 0.118613 0.46844 0.012735 0.047638 0.411278 0.037981 0.060626 0.4055 0.036978 0.01421 0.05063 0.861162 0.003883 0.064736 0.005379 0.021898 0.62562 0.115637 0.024756 0.144934 0.067155 0.318408 0.229642 0.1729 0.27905 0.358209 0.099804 0.086904 0.455084 0.393645 0.123165 0.05234 0.430851 0.388421 0.058252 0.08781 0.465517 0.384221 0.666526 0.887375 0.65994 0.221579 0.693532 0.546503 0.592707 0.496361 Variance 0.063014 0.000068 0.000824 0.00033 0.000042 0.000831 0.000136 0.00011 0.001581 0.000052 0.000945 0.002121 0.00003 0.000106 0.003426 0.000054 0.000519 0.00329 0.000132 0.00008 0.000178 0.000686 0.000004 0.000298 0.000018 0.000096 0.001727 0.000267 0.000488 0.000931 0.000222 0.000161 0.000138 0.000108 0.000141 0.000261 0.000049 0.000125 0.000241 0.000368 0.000088 0.000123 0.000311 0.000215 0.000063 0.000081 0.000239 0.00168 0.005281 0.027705 0.011901 0.001691 0.000355 0.001226 0.000356 0.0011 Lower 4.07 0.034689 0.261275 0.196747 0.010314 0.262069 0.045651 0.022005 0.234833 0.03531 0.065049 0.377717 0.004212 0.030334 0.297987 0.025427 0.023866 0.302696 0.017882 0.001436 0.030033 0.800711 0.000898 0.037439 0.000194 0.006474 0.538516 0.086505 0.000957 0.092562 0.040165 0.293197 0.207182 0.152807 0.256189 0.326175 0.086864 0.067076 0.424815 0.35688 0.105748 0.034735 0.396442 0.359728 0.044143 0.071917 0.435488 0.312122 0.531185 0.595748 0.47105 0.134414 0.654392 0.470943 0.554866 0.42531 Upper 5.043 0.066694 0.37451 0.267916 0.035718 0.374831 0.091642 0.063336 0.392138 0.063409 0.184674 0.555796 0.025192 0.070141 0.521927 0.053689 0.112859 0.520306 0.06153 0.035942 0.081783 0.903696 0.00901 0.103357 0.015923 0.044816 0.703213 0.150775 0.082658 0.212862 0.098204 0.343815 0.25343 0.193682 0.302581 0.390413 0.113943 0.110516 0.485691 0.43187 0.142669 0.076711 0.465501 0.417285 0.074907 0.107191 0.496042 0.473951 0.81887 1.240414 0.89661 0.297168 0.728343 0.606305 0.628952 0.555367 Median 4.559 0.049003 0.314323 0.230173 0.020852 0.315589 0.066263 0.039562 0.310238 0.048136 0.116375 0.468631 0.012044 0.046778 0.413283 0.037463 0.058092 0.402505 0.035806 0.012656 0.04883 0.864183 0.003525 0.062386 0.004471 0.020428 0.627552 0.114925 0.018881 0.142116 0.066398 0.318377 0.229434 0.172902 0.279116 0.358168 0.09955 0.086183 0.454603 0.393724 0.122806 0.050999 0.430869 0.388326 0.057884 0.087314 0.465426 0.381721 0.66541 0.876048 0.652117 0.223342 0.694088 0.549672 0.592955 0.498523 PSRF * 1.018 1 1 1 1 1 1 1.002 1.005 1.01 1.003 1.005 1 1.003 1.01 1.015 1 1.008 1.002 1.003 1.001 1.003 1 1 1 1 1 1 1 1 1 1.001 1 1 1 1.001 1 1.01 1.002 1.003 1.006 1.013 1.002 1 1.001 1 1 1.002 1 1.002 1 1 1 1.001 1.001 1.002