Chap.2 : De l`ADN à la protéine. - SOS

Commentaires

Transcription

Chap.2 : De l`ADN à la protéine. - SOS
Chap.2 : De l’ADN à la protéine.
I. Deux molécules séquencées.
A. La molécule d’ADN.
OC : L’ADN, constituant des chromosomes, est une molécule séquencée. Rappel 2nd
Les chromosomes, qui sont dans le noyau, sont constitués d'une molécule d'ADN superenroulée sur elle-même et associée à des protéines.
Doc de l'ADN aux chromosomes, découverte de la structure de l'ADN.
L’ADN est une molécule séquencée :
Rappeler les 4 bases azotées de l’ADN ?Adénine, guanine, cytosine, thymine
Qu’est-ce qu’un nucléotide ?
Complémentarité.
Rappeler la structure 3D de cette molécule.
B. La protéine : une séquence d’aa.
Doc 4 p.51 Phénotype moléculaire des 2 exemples dans le tableau comparatif.
Les propriétés des protéines dépendent de leur séquence respective en acides
aminés.
Ces 2 molécules sont séquencées, quel est le lien entre elles ?
II. Quelle est la relation entre ADN et protéine ?
A. Un gène code pour une séquence d’aa.
OC : le gène est un segment d'ADN codant pour une protéine.
Individu sain
Individu drépanocytaire
Séquence nucléotidique d'une
partie du gène codant pour Hb.
GTGCACCTTACTCCAGAGGAG
GTGCACCTTACTCCAGTGGAG
Séquence
d'acides
aminés
correspondante.
Val-His-Leu-Thr-Pro-Glu-Glu
Val-His-Leu-Thr-Pro-Val-Glu
Comparer les séquences nucléotidiques d'un individu sain et d'un individu malade.
Vous retrouver l'aa différent dans la partie de l'hémoglobine étudiée.
Dégager un lien entre séquence de nucléotide et d'acides aminés.
Les gènes sont des segments de la molécule d’ADN codant pour des protéines.
Comment faire que 3 nucléotides correspondent à 1 acide aminé ?
B. Quel est le système de correspondance entre gène et protéine ?
OC : la séquence de nucléotides dans l'ADN gouverne la séquence des aa dans la protéine selon un
système de correspondance : le code génétique.
OM : utiliser le code génétique.
La séquence des nucléotides dans l’ADN gouverne la séquence des aa dans la
protéine selon un système de correspondance : le code génétique.
{ Rque : Il existe un intermédiaire entre ADN et protéines : l’ARN. Les nucléotides de l'ARN,
contiennent du ribose (ce sont des ribonucléotides). Les bases sont A, U, C et G. Donc l'Uracile
(U) remplace la Thymine (T).}
Activité : former la séquence d’AA exercice 2 p64 : le premier ensemble puis le second seul.
L’ocytocine :
TGC TAC ATC CAG AAC TGC CCC CTG GGC
Cys Tyr Ile Gln Asn Cys Pro Leu Gly
Séquence de l’ADH :
TGCTACTTCCAGAACTGCCCAAGAGGA
Cys Tyr Phe Gln Asn Cys Pro Arg Gly
Le message contenu dans la séquence des nucléotides est traduit en séquence
d’acides aminés, c'est-à-dire en protéine.
A un triplet de nucléotide ou codon correspond un seul acide aminé : c’est le
code génétique.
Les gènes sont des segments de la molécule d’ADN codant pour des protéines.
Les protéines, en régissant la structure (drépanocytose) et les activités
cellulaires (mucoviscidose), contribuent à l’établissement du phénotype.
Peut être exo sur redondance du code génétique.
III. Modifier le génotype pour modifier le phénotype.
A. Pourquoi modifier les gènes ?
OC : intérêt de la transgénèse. Universalité de la molécule d’ADN et du code génétique.
Les objectifs de la création d’OGM sont variés :





La production de médicament
L’amélioration des aliments
Une meilleure production en agriculture
L’obtention de modèles animaux pour l’étude de maladies humaines
La réalisation de greffes d’organes d’animaux chez l’Homme
Exemples page 56.
Citer quelle est l’espèce donneuse du gène.
l’espèce donneuse est l’homme
Citer quel est l’être vivant receveur qui exprime la protéine.
C’est une bactérie (Procaryote)
Justifier le choix de cet être vivant.
Rappel de seconde une bactérie se divise toute les 20mn donc en 24h on obtient
4,7.1021bactéries donc très productif et surtout culture très contrôlable.
Dire quelle(s) propriété(s) de l’information génétique est utilisée dans la transgénèse.
La transgénèse est possible grâce à l’universalité de la molécule d’ADN.
B. Comment modifier les gènes?
OC : principe de la transgénèse. Universalité de la molécule d’ADN et du code génétique.
OM : réaliser un schéma explicatif et fonctionnel.
Transgénèse = capacité à introduire un gène (modifié ou étranger) dans un organisme.
Arriver au schéma-bilan de la transgénèse pour l’exemple du maïs Bt.
Il est possible de modifier le génotype d’un organisme par transgénèse ce qui
permet de produire des protéines souvent en plus grande quantité. Ce
mécanisme repose sur l’universalité de l’ADN comme support de l’IG et sur
l’universalité du code génétique.
Nous avons vu le lien entre le génotype et le phénotype moléculaire : de l’ADN à la protéine,
voyons comment le génotype contrôle le phénotype aux autres échelles.