Figure 1 - thèse - Université Toulouse III

THÈSE
En vue de l'obtention du
DOCTORAT DE L’UNIVERSITÉ DE TOULOUSE
Délivré par l'Université Toulouse III - Paul Sabatier
Discipline ou spécialité : Immunologie
Présentée et soutenue par
Kaoutar LEGHMARI
Le 6 Octobre 2008
Titre :
La protéine Tat du virus d’immunodéficience humaine (VIH) induit la production de
l’IL-10 et du TNF-alpha dans le monocyte/macrophage humain :
Etude des mécanismes d’activation de la voie NF-kappaB
JURY
Dr. Francisco VEAS
Dr. Roger LE GRAND
Dr. Marc MOREAU
Dr. Daniel GONZALEZ-DUNIA
Dr. Ara HOVANESSIAN
Pr. Elmostafa BAHRAOUI
Rapporteur
Rapporteur
Examinateur
Examinateur
Examinateur
Directeur de thèse
Ecole doctorale : Biologie Santé Biotechnologie
Unité de recherche : Laboratoire d'Immuno-Virologie, EA 3038
Directeur(s) de Thèse : Elmostafa BAHRAOUI
Rapporteurs : Ara HOVANESSIAN (Absent)
]x w°w|x vxààx à{¢áx…
A mes parents qui m’ont toujours soutenue pour aller jusqu’au bout de mes
ambitions. Qui m’ont fait confiance et m’ont donné confiance en moi. A toi
mon papa mon modèle d’ambition de persévérance et d’honnêteté. A toi ma
maman, ma source d’énergie et mon exemple de générosité et de courage. Que
cette thèse soit le fruit de votre patience et de l’éducation que vous m’avez
offert. Les mots sont faibles, j’espère seulement que vous êtes fières de moi.
Que dieu vous garde.
A mon mari wajih, qui a apporté à ma vie une belle brise de bonheur,
d’amour et de stabilité. Merci de m’avoir toujours soutenu et encouragé à
aller de l’avant et ne jamais baisser les bras. Ta kouka.
A mon frère Adil et mes sœurs Lamia et Loubna, pour qui j’ai toujours été la
petite sœur protégée, je vous aime. A mes petits neveux chéris que j’aime de
tout mon cœur. A Si Mohamed, un jour tu as dis que tu pourrais prendre en
charge mes études en France s’il le faut, je ne l’oublierais jamais. C’est comme
si s’était fait. A Amor, Merci pour tes encouragements.
A Meriem, qui m’a offert son amitié depuis que nous étions de petites
princesses à l’école. Nous avons grandies et notre amitié aussi, Merci d’avoir
cru en moi et comprise sans que je dise un mot. Merci Mima.
Au cher Professeur ENAJI, mon maitre, guide et ami. Je vous serais
éternellement reconnaissante pour m’avoir pris sous votre aile depuis mes
premières années de Fac, et d’avoir toujours été là pour moi. Votre fille
kaoutar.
A tous ceux que j’aime, morts ou vivants……
]x ÜxÅxÜv|x…
Monsieur le Professeur Elmostafa BAHRAOUI. Merci de m’avoir ouvert
votre laboratoire et m’avoir fait confiance pour mener ce sujet. Merci de
m’avoir toujours encouragé, orienté vers ce qu’il ya de mieux pour moi, et
d’avoir canalisé mon énergie, parfois un peu trop débordante. Je ne vous
remercierais jamais assez pour tout ce que vous avez fait.
Fabrice, je n’oublierais jamais les discussions où l’on refaisait le monde du
VIH, ni ta disponibilité à chaque fois que mon ordinateur était soufrant.
Merci pour les poches de sang. Merci pour ta gentillesse.
Corinne, merci pour ton amitié, ton écoute, et ton aide. Tu as apporté ta
touche de douceur au labo. Je te porte dans mon cœur.
Fabienne, pour ta gentillesse, ta disponibilité, tes critiques et ton amitié.
Cecile, pour tes conseils ta bonne humeur et ton dynamisme. Merci à toutes
les deux de m’avoir supporté pendant cette fin de thèse, et d’avoir su dissiper
mes doutes. Vous êtes superbes.
Merci à tous les gens qui ont contribués, de près ou de loin, à ce que cette
thèse commence, se déroule et finisse comme je le souhaitais. J’en oublie
forcement mais merci à Yvan, Xavier, Nathalie, Isabelle, Cathy, Martine,
Mme Becker…..
RÉSUMÉ
Chez les patients infectés par le virus de l’immunodéficience humaine de type 1, on
observe une modification progressive du réseau de cytokines avec une augmentation du taux
de l’IL-10, une cytokine immunosupressive, au cours de l’évolution vers le stade SIDA. Les
travaux précédents du laboratoire ont permis de montrer que la protéine Tat du VIH-1 via sa
région N-terminale 1-45, induit la production d’IL-10 et de TNF-α par les monocytes
humains du sang périphérique en agissant au niveau membranaire.
Dans mon sujet de thèse je me suis intéressée à la caractérisation des voies de
signalisations impliquées dans la production de l’IL-10 par la protéine Tat du VIH-1 dans le
monocyte/macrophage humain, et du rôle du TLR4 comme récepteur potentiel de Tat.
L’ensemble des résultats obtenus a permis de montrer que :
i) comme dans le monocyte, la protéine Tat est aussi capable d’induire la production de
l’IL-10 dans le macrophage de manière PKC dépendante.
ii) la présence du calcium, bien qu’elle soit essentielle pour la production du TNF-α,
induite par Tat, elle ne semble pas nécessaire pour la production de l’IL-10. Ce nouveau
mécanisme de production de l’IL-10 a été probablement développé par le VIH-1 afin
d’assurer un état d’immunosuppression, même en absence du TNF-α, cytokine
proinflammatoire, qui stimule la production de l’IL-10.
iii) Tat est capable de stimuler les deux voies, classique et alternative de NF-κB.
L’activation de NF-κB a été analysée au niveau moléculaire à l’aide de l’approche d’immunoprécipitation de la chromatine (ChIP), suivie de l’amplification de la séquence promotrice de
l’IL-10 par PCR. L’utilisation de différents anticorps a permis de mettre en évidence
l’acétylation et la phosphorylation de l’histone H3, ainsi que le recrutement d’IKKα,
CBP/p300, p65 et p52 au niveau du promoteur de l’IL-10.
iv) l’implication du TLR4 comme récepteur potentiel de Tat, dans la transduction des
signaux activés par Tat pour la production de l’IL-10 et du TNF-α. Nos résultats montrent que
la production de ces deux cytokines, peut être bloquée par des anticorps anti-TLR4 et que Tat
est capable d’interagir directement avec TLR4 via son domaine N-Terminal.
Mots clés :
Monocytes/macrophages, VIH-1, Tat, NF-κB, calcium, PKC, MAP kinases, IL-10, TNF-α
ABSTRACT
In human immunodeficiency virus infection, a progressive disturbance of cytokines
network is observed. Thus, increasing levels in of the immunosuppressive cytokine, IL-10 and
the pro-inflammatory cytokine, TNF-α, are secreted in the HIV-1+ patients sera, before T
lymphocytes decrease and seem to be linked in to AIDS progression and HIV associated
dementia. The mainly viral factor implicated in this immunodeficiency is the transcription
activating protein (Tat). Our previous results have shown that the N-terminal region of Tat
protein was able to induce both IL-10 and TNF-α production by human monocytes by acting
at the cell membrane.
In this thesis, we focused on the characterization of the signaling pathways involved on
IL-10 and TNF-α production, by monocytes/macrophages, and the role of TLR4 as a potential
Tat receptor. Our results have shown that:
i) Like in monocytes, Tat protein is also able to induce IL-10 production by human
macrophages, in a PKC dependent pathway.
ii) The calcium pathway is not required for IL-10 production, although it is essential in
Tat-induced TNF-α production. Our data suggest a new mechanism, implicating Tat protein,
by which HIV-1 may maintain a constant production of the immunosuppressive IL-10
cytokine, even in the absence of TNF-α production. In consequence, HIV-1 may escape
immune surveillance and thus promote the establishment of an immunosuppressive state.
iii) Tat is able to induce both classical and alternative NF-κB pathways. Interestingly,
we show that, , Tat stimulates nuclear translocation of IKKα. ChIP assay experiments, after
Tat treatment, revealed IKKα and CBP/p300 recruitment to the IL-10 promoter and histone
H3 phosphorylation (Ser 10) and acetylation (Lys 14) on this region, presumably leading to
chromatin remodeling.
iv) TLR4 is implicated as a potential Tat receptor, in the signal transductions activated
by Tat to induce IL-10 and TNF-α production. This cytokine production is completely
abolished by anti-TLR4 antibodies. Overall, we have shown that Tat interact directly with
TLR4 via its N-terminal 1-45 region.
Keywords:
Monocytes/macrophages, VIH-1, Tat, NF-κB, calcium, PKC, MAP kinases, IL-10, TNF-α
TABLE DES MATIERES
INTRODUCTION
I- LE VIRUS DE L'IMMUNODEFICIENCE HUMAINE (VIH)
1- HISTOIRE DU VIH…………………………………………………………………...3
1-1- L’origine simienne du VIH………………………………………………....5
1-2- Modes de transmission du VIH………………………………………….....5
1-3- Classification et Nomenclature………………………………………….....7
2- STRUCTURE DU VIH.……………………………………………………………..12
2-1- Protéines de structure……………………………………………………...12
2-2- Protéines enzymatiques…………………………………………………….14
2-3- Constituants cellulaires associés à la particule virale……………………15
2-4- Protéines de régulation…………………………………………………….15
2-5- Génome viral………………………………………………………………..23
3- CYCLE VIRAL……………………………………………………………………...27
3-1- Vue générale du cycle viral………………………………………………27
3-2- Fixation et Internalisation………………………………………………..27
3-2-1- Récepteurs viraux……………………………………………….....27
3-2-2- Entrée du virus………………………………………………….....32
3-3- Transcription inverse du génome viral et intégration dans le génome de la
cellule hôte…………………………………………………………….....32
3-3-1- Transcription inverse……………………………………………...32
3-3-2- Intégration de l’ADN proviral…………………………………....35
3-4- Expression du provirus et bourgeonnement de nouveaux virions…….38
3-4-1- Transcription………………………………………………………41
3-4-2- Traduction………………………………………………………....44
3-4-3- Assemblage et bourgeonnement………………………………….47
3-5- Clivage protéique et maturation du virion……………………………...49
4- TROPISME ET PERSISTANCE VIRALE……………………………………….....50
4-1- Les cellules cibles du VIH………………………………………………....50
4-2- Latence et persistance……………………………………………………..53
II- IMMUNOPATHOLOGIE DE L’INFECTION VIH-1
1- INFECTION VIH-1…………………………………………………………………...56
1-1- La primo-infection………………………………………………………….56
1-2- La phase asymptomatique………………………………………………….56
1-3- La phase SIDA……………………………………………………………....59
2- LES MOLECULES ANTIRETROVIRALES………………………………………...59
2-1- Inhibiteurs de fusion………………………………………………………...61
2-2- Inhibiteurs de la transcriptase inverse………………………………….....61
2-3- Inhibiteurs de l’intégrase…………………………………………………...62
2-4- Inhibiteurs de protéase……………………………………………………...62
2-6- Les vaccins anti-VIH………………………………………………………...63
III- DEREGULATION DU RESEAU DE CYTOKINES PENDANT
L’INFECTION VIH-1
1- LES CYTOKINES PRO-INFLAMMATOIRES…………………………………....65
1-1- L’interleukine-1…………………………………………………………...65
1-2- L’interleukine-6…………………………………………………………...66
1-3- Tumor necrosis factor (TNF-α)…………………………………………..67
1-3-1- Caractérisation génétique et moléculaire du TNF-α..................67
1-3-2- Récepteurs du TNF-α…………………………………………....68
1-3-3- Signalisation du TNF-α…………………………………………..70
1-3-4- Rôle biologique du TNF-α……………………………………….70
1-3-5- TNF-α et VIH……………………………………………………..71
2- LES CYTOKINES ANTI-INFLAMMATOIRES…………………………………....73
2-1- L'interleukine-2……………………………………………………………..73
2-2- L'interleukine-12…………………………………………………………....74
2-3- Les interférents……………………………………………………………...74
2-4- L'interleukine-4……………………………………………………………..75
2-5- L'interleukine-10…………………………………………………………....76
2-5-1- Les récepteurs IL-10……………………………………………...76
2-5-2- Les effets de l’IL-10 sur l’immunité innée et adaptatives……....78
2-5-3- IL-10 chez les patients VIH+…………………………………......79
2-5-4- l’IL-10 viral……………………………………………………......81
IV- LA PROTEINE TAT DU VIH-1
1- LA PROTEINE TAT ENDOGÈNE…………………………………………………..83
1-1- Phosphorylation de Tat…………………………………………………….83
1-2- Acétylation de Tat…………………………………………………………..84
1-3- Désacétylation de Tat…………………………………………………….....85
1-4- Ubiquitinylation de Tat……………………………………………………..85
1-5- Méthylation de Tat……………………………………………………….....85
2- LA PROTEINE TAT EXOGÈNE…………………………………………………....87
2-1 Interaction avec des récepteurs cellulaires………………………………...87
2-2- Internalisation de la Tat exogène…………………………………………..88
2-2-1- Par endocytose……………………………………………….......88
2-2-2- Rôle du domaine de transduction de Tat dans l’internalisation.90
2-3- Effet sur le système immunitaire…………………………………………...92
2-4- Effet sur le système nerveux central…………………………………….....92
2-5- Tat et le sarcome de Kaposi………………………………………………...93
3- TAT CANDIDAT VACCIN ET CIBLE THERAPEUTIQUE……………………...95
3-1- Anticorps anti-Tat et molécules antagonistes…………………………….....95
3-2- Les ARN interférents………………………………………………………....96
V- VOIES DE SIGNALISATION ET PRODUCTION DE CYTOKINES
1- LES TOLL-LIKE-RÉCEPTORS: TLR…………………………………………........98
1-1- Généralités……………………………………………………………………98
1-2- Les TLR endosomaux……………………………………………………….100
1-3- Les TLR de la membrane plasmique……………………………………....103
1-4- TLR et voies de signalisation……………………………………………….106
1-4-1- Signalisation dépendante du MyD88………………………….106
1-4-2- Signalisation MyD88-indépendante…………………………...108
1-4-3- Signalisation via d’autres protéines adaptatrices…………….109
1-5- TLR et remodelage de la chromatine……………………………………....110
2- LA VOIE CALCIQUE………………………………………………………………...111
2-1- Le calcium, libre, lié ou piégé……………………………………………….111
2-2- Maintien de l’homéostasie calcique………………………………………...113
2-2-1- Réduction du calcium intracellulaire…………………………113
2-2-2- Augmentation du calcium intracellulaire…………………….113
2-3- Influx calcique et expression de gènes……………………………………...118
3- LA VOIE DES PROTÉINES KINASES C (PKC)…...……………………………...120
3-1- Distribution des PKC dans l’organisme…………………………………....120
3-2- Structure des PKC……………………………...…………………………...121
3-3- Activation des PKC et leur régulation.…………………………………….123
3-4- Protéines d'ancrage et localisation subcellulaire des PKC.……………....125
3-5- Substrats et fonctions des PKC.…………………………………………….127
3-6- PKC et agents infectieux………………………………………………….....128
4- LA VOIE DES MAP KINASES……………………………………………………...130
4-1- La famille des MAPK.…………………………………………………….....130
4-2- MAPK et agents infectieux.………………………………………………....133
5- LA VOIE NF-κB……………………………………………………………………...136
5-1- Les protéines NF-κB………………………………………………………...136
5-2- Les protéines IκB Kinases : IKK…………………………………………..138
5-2-1- Les protéines kinases IKKα et IKKβ………………………...138
5-2-2- La protéine IKKγ……………………………………………....141
5-3- La protéine NIK……………………………………………………………..143
5-4- Les protéines IκB.…………………………………………………………...143
5-5- Les voies de signalisations NF-κB………………………………………….148
5-6- Régulation de l’activité transcriptionnelle des protéines NF-κB………...150
5-6-1- Activation optimale de NF-κB par phosphorylation de p65...150
5-6-2- Rôle de la phosphorylation dans l’activité de RelB et c-Rel...152
5-6-3- Les sous-unités p50 et p52 sont des phosphoprotéines……....154
5-6-4- Régulation par modification des histones…………………….154
PROBLEMATIQUE……………………………………………………………………..160
RÉSULTATS……………………………………………………………………………...161
DISCUSSION ……………………………………………………………………………172
BIBLOGRAPHIE………………………………………………………………………...183
INTRODUCTION 1
Figure 1: Histoire du VIH
1959
1er cas connu d ’infection à HIV-1
à Kinshasa, RD Congo
1981
Premiers cas de SIDA
identifiés
1983
identification
du VIH-1
1986
identification
du VIH-2
2003
infection à HIV-1 > 40 % de la population
générale dans certains pays
2
I- LE VIRUS DE L'IMMUNODEFICIENCE HUMAINE (VIH)
1- HISTOIRE DU VIH
En 1980, le premier rétrovirus humain a été isolé chez des patients souffrant d’ATL
« Adult T-cell Leukemia», et a été nommé « Human T-Lymphotropic virus type-1 » (HTLVI). Plus tard, un autre virus (HTLV-II) isolé chez des patients ateints de « T-hairy cell
leukemia » a été identifié. En 1981, les premières descriptions du Syndrome d'ImmunoDéficience Acquise « SIDA » sont apparues dans la littérature médicale (Fig.1). Ces premiers
rapports décrivent l’existence d’infections opportunistes causées par des micro-organismes
tels que Pneumocystis carinii, qui normalement ne causent pas de maladies chez les personnes
dont le système immunitaire est fonctionnel, d’où le terme « Acquise ». En 1983, une équipe
de l’Institut Pasteur à Paris, a isolé un virus chez des patients souffrant du syndrome
lymphadénopatique, et l’ont nommé « Lymphadenopathy-associated-virus » (LAV) (BarreSinoussi et al., 1983). Ce nouveau virus infecterait et tuerait de manière sélective les
lymphocytes T CD4+. En 1984, une équipe de l’Institut National de la Santé du Maryland
(USA), rapporte qu’un rétrovirus nommé HTLV-III, qui s’est révélé plus tard être le même
que le LAV isolé à l’Institut Pasteur, cause le SIDA (Popovic et al., 1984). En mai 1986, le
comité international de la nomenclature des virus et de la taxonomie attribue à ce même virus
son nom actuel « Virus de l’Immunodéficience Humaine » (VIH). Enfin, un second type du
VIH, le VIH-2 a été isolé en 1986 à l’Institut Pasteur chez des patients d’Afrique de l’Ouest
(Clavel et al., 1986). Le VIH est désormais connu comme l’agent étiologique du SIDA.
Depuis, il s’est répandu sur tout le globe, infectant des millions de personnes en un temps
relativement court.
Plus de 25 ans et 25 millions de décès ont été estimés après le premier diagnostic du
VIH en 1981 (UNAIDS/WHO, AIDS epidemic update, Décembre 2007). En 2007, près de 33
millions de personnes vivent avec le VIH, et entre 3,4 et 6,2 millions de personnes ont été
nouvellement infectées par le VIH, le chiffre annuel le plus élevé depuis le début de
l’épidémie. Sur les 16 000 nouvelles infections quotidiennes en 2004, 95% surviennent dans
les pays en développement. Cette même année, près de 3 millions de personnes sont mortes
du SIDA (ONUSIDA, chiffres publiés en 2006 par United Nations Programme on HIV/AIDS,
Repport on the global AIDS epidemic 8). Selon le rapport de l’ONU sida, malgré
l’augmentation du financement, de l’engagement politique et les progrès accomplis pour
3
Figure 2: Origine simienne du VIH
A) Le VIH-1 est originaire d’un seul sous type de chimpanzés, Pan troglodytes.
B) Le VIH-2 est originaire du sooty mangabey, Cercocebus atys .
C) Le phénograme radial démontre l’étroite relation entre VIH et SIV. Les distances
indiquent le degré relatif d’évolution.
Stebbing, J. et al., 2004;
New england journal of medecine
4
élargir l’accès aux traitements du VIH, l’épidémie continue d’avancer plus vite que la riposte
mondiale. Aucune région dans le monde n’a été épargnée. L’épidémie reste très dynamique,
en particulier dans les pays en développement, et le virus continu à muter sans arrêt.
1-1- L’origine simienne du VIH
Plusieurs
données
confirment
que
le
VIH-1
a
pour
origine
le
virus
d’immunodéficience simien (SIVcpz) qui infecte le chimpanzé (Pan troglodytes) (Gao et al.,
1999; Santiago et al., 2002). Quant au VIH-2, dont le génome possède 40 à 60 % d’homologie
avec le VIH-1, il a pour origine le SIVsm du stooty mangabey (Cercocebus atys), singe de la
côte ouest africaine, du Sénégal à la côte d’Ivoire, régions qui constituent l’épicentre
endémique du VIH-2 (Hahn et al., 2000; Weiss and Wrangham, 1999) (Fig. 2). Sur la base
des études moléculaires et de la distribution des séquences génomiques, le VIH serait passé
du chimpanzé à l’Homme entre 1915 et 1941 (Korber et al., 2000; Lemey et al., 2003).
Notons que cette estimation ne coïncide pas avec l’hypothèse d’une transmission à partir des
vaccins anti-poliovirus, administrés par le Dr Koprowski à un million d’africains au Congo
belge à la fin des années 50, et qui seraient contaminés par SIVcpz (Blancou et al., 2001).
Curieusement chez son hôte naturel, le SIV ne provoque ni le SIDA, ni une déplétion
des cellules T CD4+ même en présence d’une forte charge virale (Hahn et al., 2000; Silvestri
et al., 2003). En revanche, la transmission du SIV à une autre espèce telle que le macaque
rhésus (Macaca mulatta) ou l’Homme, engendre une perte progressive des cellules T CD4+ et
une forte prédisposition aux infections opportunistes.
1-2- Modes de transmission du VIH
Le VIH-1 est transmissible d’une personne infectée à une autre par exposition directe
à des liquides organiques contaminés. On retrouve le virus dans le sang, le sperme, les
sécrétions vaginales et aussi dans le lait maternel. De façon globale, 70 à 80% des cas de
contamination sont imputables à une transmission sexuelle (Quinn, 1989). Lors de chaque
contact, le risque de transmission est de l’ordre de 0,1 à 1% (Cohen, 2004; Galvin and Cohen,
2004). La transmission sanguine peut avoir lieu par l’échange d’aiguilles contaminées chez
les toxicomanes, ou bien de façon accidentelle chez les personnels de santé et les chercheurs
ou encore au cours d’une transfusion sanguine ou suite à une transplantation. Enfin, la
5
Figure 3: Exemples de rétrovirus
Micrographie électronique des particules virales représentatives des rétrovirus.
Le diamètre de toutes les particules est d’environ 100 nm.
A- Particule type A dans le reticulum endoplasmique
B- Betarétrovirus: MMTV, morphologie type B (haut: intracytoplasmique, milieu: bourgeonnant,
bas: mature extracellulaire)
C- Gammarétrovirus: MuLV, morphologie type C (haut: bourgeonnant, bas: mature extracellulaire)
D- Alpharétrovirus: ALV, morphologie type C (haut: bourgeonnant, bas: mature extracellulaire)
E- Betarétrovirus: Mason-Pfizer monkey virus, morphologie type D (haut: intracytoplasmique,
milieu: bourgeonnant, bas: mature extracellulaire)
F- Deltarétrovirus: BLV (haut: bourgeonnant, bas: mature extracellulaire)
G- Lentivirus: Bovine immunodeficiency virus (haut: bourgeonnant, bas: mature extracellulaire)
H- Spumavirus: Bovine syncytial virus (haut: intracytoplasmique, milieu: bourgeonnant, bas: mature )
Field’s Virology, 2007
6
transmission verticale (mère-enfant) peut avoir lieu à trois stades : in utero, pendant
l’accouchement et lors de l’allaitement maternel. Actuellement, cette transmission mèreenfant est fortement contrôlée grâce aux traitements antirétroviraux administrés aux femmes
enceintes soit au début ou au dernier trimestre de la grossesse (Blanco et al., 2004). Ce
traitement semblerait diminuer le taux de transmission verticale à 10% comparé à 25% de
transmission en absence de traitement (Royce et al., 1997).
1-3- Classification et Nomenclature
Le VIH appartient à la famille des Retroviridae, famille de virus à ARN de polarité
positive, dont le génome est diploïde, et possédant une transcriptase inverse. Les Retroviridae
tiennent leur nom d’une caractéristique propre à leur cycle viral : la transcription inverse de
leur molécule d’ARN génomique en ADN double brin.
La famille des Retroviridae est actuellement subdivisée en 7 genres selon divers
critères tels que la pathogénicité, la morphologie, la structure du génome, les propriétés
antigéniques (d’après l’ICTV, the International Comitee on taxonomy of viruses,
www.virustaxonomyonline.com) (Fig. 3). On distingue :
Des rétrovirus simples qui codent uniquement pour des protéines de structure Gag « Groupe
antigène », Pro « Protéase », Pol « Polymérase » et Env « Enveloppe » :
- les Alpharétrovius (virus type: Avian Leukosis Virus, ALV)
- les Betarétrovirus (virus type : Mouse Mammary Tumor Virus, MMTV)
- les Gammarétrovirus (virus type : Murine Leukemia Virus, MLV)
Des rétrovirus complexes qui, en plus des protéines Gag, Pro, Pol et Env, codent pour des
petites protéines régulatrices possédant un grand nombre de fonctions :
- les Deltarétrovirus (virus type : Bovine Leukemia Virus, BLV), contiennent les gènes
régulateurs comme tax ou rex exprimés à partir d’un épissage alternatif de l’ARNm.
- les Epsilonrétrovirus (virus type : Walleye Dermal Sarcoma Virus, WDSV),
contiennent un à trois gènes ORF A, B et C. Le gène ORFa est un homologue viral du
gène de la cycline D de l’hôte et permet ainsi la régulation du cycle cellulaire.
Ces cinq genres sont impliqués dans des leucémies et des cancers.
- les Spumavirus (virus type : Human Foamy Virus, HFV). Le génome viral code pour
au moins deux gènes accessoires (tas/bel-1, et bet) (Flugel et al., 1987; Mergia et al.,
1991). Le gène tas code pour un transactivateur transcriptionnel.
7
- les Lentivirus (Latin : Lenti=lent), sont des virus responsables d'infections virales à
développement lent, non oncogènes. Ils incluent des virus responsables d’arthrites
(chèvre) et d’anémies infectieuses équines (cheval). Le VIH en fait également partie et
code pour plusieurs gènes régulateurs (vif, vpr, vpu, tat, rev et nef) qui contrôlent la
transcription, l’assemblage des virions, l’expression des gènes de l’hôte et d’autres
fonctions de la réplication.
Les virus VIH sont classés en deux types : le VIH-1, type majoritaire et le VIH-2,
type endémique localisé en Afrique de l'Ouest.
Le VIH-1 est divisé en trois groupes :
° Le groupe M « majeur » ou groupe majoritaire qui lui même a été sous-divisé durant
son expansion mondiale jusqu’à au moins 10 sous-types de (A à D, A/E, A/G, F, H, J et K)
(Korber et al., 1995; Robertson et al., 2000). L’analyse de la distribution actuelle du VIH-1
dans le monde montre que les sous-types A/E et C sont prévalents et sont responsables de la
grande majorité des infections VIH globales (Burke, Dhopesh, and Lainfester, 1996; Montano
et al., 1997). Le sous-type C prédomine dans l’Afrique subsaharienne ; le sous-type B, dans le
nord de l’Amérique et l’Europe et le sous-type E, dans le sud-est de l’Asie. Le sous-type C
semble être transmis plus efficacement que les autres (Essex et al., 1997). En effet, on estime
actuellement que plus de la moitié des personnes infectées par le VIH dans le monde porte le
virus de sous-type C (Esparza and Bhamarapravati, 2000), et présentent une forte charge
virale plasmatique et un taux significativement faible de lymphocytes T CD4+ (Neilson et al.,
1999).
° Le groupe O « Outlier » a été isolé chez des individus vivant au Cameroun, Gabon et
Guinée équatoriale. Son génome présente 65% d’homologie avec le virus groupe M (Takehisa
et al., 1999).
° Le groupe N « New ou Non M, Non O » identifié par Simon et al., en 1998 dans un
prélèvement
datant
de
1995
chez
une femme du Cameroun. Ce groupe est
phylogénétiquement lié au virus de l’immunodéficience simienne (SIV) qui infecte les
chimpanzés (Roques et al., 2004).
La relation entre le sous-type du virus, ses propriétés biologiques et sa pathogénicité
reste à déterminer, en partie du fait que la réplication virale ait été étudiée presque
exclusivement dans le sous-type B.
Le VIH-2 présente 40 à 50% d’homologie avec le VIH-1 au niveau des gènes gag et
pol. Le VIH-2 compte 5 sous-types de A à E (UNAIDS, 2000, AIDS epidemic update.
Geneva : UNAIDS. www.unaids.org). En comparaison avec le VIH-1, le VIH-2 est moins
8
facilement transmissible (moins infectieux) et possède une longue période d’incubation entre
la primo-infection et la manifestation de la maladie. De plus, les patients infectés par le VIH-2
montrent une faible charge virale et une progression plus lente de la maladie (Cunningham et
al., 1997).
9
Figure 4: Structure du VIH
A)
B)
A) Représentation schématique du virion VIH-1 mature (adaptée de Freed et al., 1998)
B) Micrographie électronique des particules virales du VIH (Kuby, J., 2003; Immunology)
10
Figure 5: Structure des glycoprotéines d’enveloppe
A)
Interne
B)
externe
C)
A) Structure primaire des glycoprotéines d’enveloppe gp120 et gp41: sites de clivage; C1-C5 régions
constantes; V1-V5 régions variables; FD domaine de fusion; HR1, HR2 Heptad repeat; TM domaine
transmembranaire.
B) Diagramme de la gp120: dans cette orientation la membrane virale est en haut et la membrane cellulaire
est en bas. Les domaines interne et externe sont connectés par un pont de 4 feuillets beta.
C) Structure trimérique de gp41: N36 et C34 régions fonctionnelles formant une structure en α hélice stable.
Les hélices N36 et C34 pointent dans des directions différentes (gauche). Vue du haut, N36 forme le core
interne entouré des hélices C34.
Modifiée d’après Prabakaran, P. et al., 2007;
Advances in pharmacology
11
2- STRUCTURE DU VIH
Le VIH-1 est un virus enveloppé, de 80 à 120 nm de diamètre, dont l’enveloppe
renferme une matrice, une capside et 2 molécules d’ARN de polarité positive (Fig. 4).
2-1- Les protéines de structure
- Les protéines de l’enveloppe virale (Fig. 5) sont synthétisées sous forme d’un
précurseur de 160 kDa (gp160), qui est ensuite maturé par une endoprotéase cellulaire de la
famille des « subtilisine-like » endoprotéases, de type furine, pour donner les glycoprotéines
gp120 et gp 41. Ces molécules s’associent par des liaisons non covalentes et forment un
complexe trimérique à la surface de la particule virale et des cellules infectées (Chan et al.,
1997; Weissenhorn et al., 1997). Le précurseur gp160 fait environ 840-860 aa selon les
isolats dont au moins 480 résidus appartiennent à la gp120 fortement glycosylée. L’analyse de
la séquence de la glycoprotéine de surface gp120 montre l’existence de 5 régions relativement
conservées (C1-C5) et 5 régions significativement variables de 60 à 80% (V1-V5)
(Prabakaran et al., 2007). La glycoprotéine transmembranaire gp41 est plus conservée et
comporte un domaine de fusion (FD) constitué d’une région hydrophobe d’environ 20 aa du
côté N-terminal, deux domaines en hélice « Heptad Repeats » HR1 et HR2, un domaine
transmembranaire et une queue cytoplasmique (Prabakaran et al., 2007).
La gp120 en se liant aux cellules hôtes via les récepteurs membranaires CD4 et
CXCR4 ou CCR5 joue un rôle indispensable dans la pénétration du virus. Ces interactions
conduisent à des changements de structure de la gp41, lui permettant de s’ancrer, grâce à son
domaine de fusion, dans la membrane de la cellule cible. Cette étape est suivie par
l’interaction entre les domaines HR1 et HR2, dans leur forme trimérique, permettant ainsi le
rapprochement puis la fusion des membranes virale et cellulaire.
- Les protéines de la matrice MA (17 kDa), produits de maturation du précurseur Gag,
tapissent l’intérieur de l’enveloppe virale en interagissant avec la membrane lipidique interne
grâce à leur groupement myristate. Une région MA (54-68 aa) de Gag correspondant à
l’hélice α4 (Hill et al., 1996; Massiah et al., 1994) a été impliquée dans l’assemblage de la
particule virale en permettant la formation de trimères MA (Cannon et al., 1997).
12
Figure 6: La transcriptase inverse (RT)
Diagramme de la protéine hétérodimérique la transcriptase inverse du VIH-1, montrant les deux sous
unités p66 et p51 qui portent les activités: ‘ADN polymérase’ et ‘Rnase H’
Field’s Virology, 2007
13
- Les protéines de la capside CA (24 kDa) sont les produits de maturation de Gag les
plus conservés et se caractérisent par la présence d’une région majeure d’homologie MHR
« Major Homology Region ». Sous forme dimérique, les CA du VIH-1 forment la capside du
virus mature qui lui confère une structure conique (Fields Virology, fifth edition, 2007).
- Les protéines de la nucléocapside NC (7 kDa) sont de petites protéines avec des
domaines en doigt de zinc type CCHH (Cys-His-Cys-X2-Cys-X4-His-X4-Cys) (Covey, 1986),
flanquées par des séquences basiques impliquées dans la liaison avec les acides nucléiques
(Cimarelli and Luban, 2000; Morellet et al., 1992). Les structures en doigt de zinc contribuent
à l’encapsidation de l’ARN viral et ainsi à son infectivité (Gorelick et al., 1990; Summers et
al., 1992).
2-2- Les protéines enzymatiques
- La transcriptase inverse RT catalyse la synthèse d’ADN à partir du génome d’ARN
viral (Baltimore, 1970). Il s’agit d’un hétérodimère constitué de deux sous-unités p66 et p51
(Fig. 6) douées de deux activités principales : une activité ADN polymérase capable
d’incorporer les déoxyribonucléotides aussi bien sur l’ADN que l’ARN, et une activité RNase
H ARN/ADN dépendante (Tanese and Goff, 1988).
L’activité ADN polymérase de la RT est généralement lente (1 à 100
nucléotides/seconde) et présente une faible fidélité (10-4 erreurs/base incorporée).
Contrairement à l’ADN polymérase de l’hôte, elle est incapable de corriger les bases erronées.
Par conséquent, au moins une mutation/génome et par cycle de reverse transcription est
introduite (Battula and Loeb, 1976) (Fields Virology, fifth edition, 2007). Notons que cette
incapacité d’édition de la RT est à la base de la forte variabilité observée chez le VIH-1.
La RNase H est une exonucléase capable de dégrader uniquement l’ARN sous forme
hybride (ARN : ADN) dans les deux sens 5’Æ3’ et 3’Æ5’. Cette action engendre des
oligonucléotides, 3’OH et 5’-P de 6 à 10 résidus de long, qui servirons d’amorces pour
l’initiation de la synthèse d’ADN grâce à l’activité ADN polymérase de la RT
(Gopalakrishnan, Peliska, and Benkovic, 1992).
- L’intégrase IN est une protéine de 32 kDa codée par le gène Pol (Panganiban and
Temin, 1984), qui catalyse l’insertion du génome viral ADN dans le génome de la cellule
cible. La structure du site actif de l’intégrase, qui appartient à la famille des polynucléotidyl-
14
reductases, a été récemment résolue. La séquence primaire de la protéine présente du côté Nterminal un motif très conservé de type His-His-Cys-Cys (HHCC). Comparées
aux
caractéristiques canoniques des motifs en doigt de zinc, celles de l’intégrase diffèrent sur trois
points : l’orientation est HHCC au lieu de CCHH, la boucle liant le résidu H au résidu C
apparaît particulièrement longue (23 aa) et enfin, le motif est unique. Bien qu’indispensable à
l’activité enzymatique, ce motif ne semble pas être impliqué dans la fixation de la protéine sur
l’ADN.
- La protéase PR produit du gène Pol, est une petite enzyme (100 aa) de la famille des
aspartyl-protéases. Le premier clivage catalysé par PR se produit durant ou immédiatement
après la libération du virion. Ce clivage est vraisemblablement intramoléculaire (Pettit et al.,
2004) et permet la libération de PR de son précurseur Gag-Pol. La protéine active est sous
forme d’homodimère. Elle clive spécifiquement les liaisons Phe-Pro et Tyr-Pro, qui ne sont
pas hydrolysées par les protéases des mammifères. Ce clivage induit la maturation des
précurseurs Gag et Gag-Pro-Pol (Katoh, Ikawa, and Yoshinaka, 1989; Loeb et al., 1989) qui
participe au changement de la morphologie des virions et conduit à leur maturation.
2-3- Constituants cellulaires associés à la particule virale
En plus des protéines codées par le génome viral, on trouve entre autres, un ARN de
transfert (ARNtlysine) qui intervient comme amorce dans l’étape d’initiation de la réverse
transcription et la cyclophiline A qui participe au repliement de la protéine Gag lors de
l’assemblage des particules infectieuses. Lors du bourgeonnement viral, des protéines de la
membrane cellulaire sont insérées dans l’enveloppe virale tels que des molécules du complexe
majeur d’histocompatibilité (CMH) (Franke, Yuan, and Luban, 1994).
2-4- Les protéines de régulation et accessoires
- Tat (Activateur de transcription) est indispensable à la réplication virale. Elle permet
une élongation efficace de la transcription du génome viral. La protéine Tat (14 kDa) est
exprimée précocément dans la cellule, elle peut être aussi associée à la particule virale. Tat est
codée par 2 exons. L’exon 1 code pour la région (1-72 aa) et l’exon 2 code pour la région Cterminale (Bayer et al., 1995; Rubartelli et al., 1998).
La protéine Tat est composée de plusieurs domaines (Fig. 7) :
15
Figure 7: Structure de la protéine Tat
Séquence des acides aminés de Tat (Genbank :AAL12703)
16
- Domaine I (1-20 aa) en N-terminal. Une mutation dans cette région n’affecte pas trop
l’activité de transactivation.
- Domaine II (20-40 aa) contenant 7 cystéines hautement conservées important pour
l’activité de Tat.
- Domaine III (40-48 aa) ‘core’. Une seule mutation au niveau de la lysine 41 abolit
l’activité de Tat.
- Domaine IV (49-57 aa) basique contenant une séquence de localisation nucléaire et
impliqué dans l'interaction et la pénétration de Tat extracellulaire dans les différents types
cellulaires infectés ou non (Mann and Frankel, 1991).
- Domaine V (57-76 aa) riche en acides glutamiques permettant la liaison à l’ARN.
- Domaine VI (78-80 aa), un tripeptide arginine-glycine-acide aspartique RGD
impliqué dans l'interaction avec les intégrines αvβ3 et α1β5 (Zocchi, Poggi, and Rubartelli,
1997).
Des variations significatives ont été observées au niveau des acides aminés de la
protéine Tat entre différentes classes ou sous-types viraux.
Cependant, seule, la protéine Tat est peu structurée; elle ne possède pas d’hélice α ni
de feuillet β. En revanche, elle semble se structurer lorsqu’elle interagit avec ses partenaires
(Long and Crothers, 1999; Seewald et al., 1998). Contrairement à d’autres transactivateurs,
Tat a pour cible la région TAR de l’ARN localisée dans la région R du LTR « Long Terminal
repeat » (Voir génome viral). L’interaction avec la région TAR du génome viral
s’accompagne de la formation d’une hélice α courte dans la région 59-72 de Tat (Loret et al.,
1992). Tat recrute alors des kinases cellulaires qui phosphorylent l’ARN polymérase II,
permettant ainsi l’élongation de la transcription (Bannwarth and Gatignol, 2005).
- Rev (Protéine Régulatrice des gènes Viraux), est une phosphoprotéine de 19 kDa et
116 aa localisée majoritairement dans le nucléole. Cette protéine précoce est codée par deux
exons. Sa structure primaire contient deux régions fonctionnelles : un domaine riche en
arginines qui intervient dans la fixation à l’ARNm et la localisation nucléaire. Ce domaine est
flanqué par des séquences qui permettent la multimérisation de Rev et un segment
hydrophobe entre les résidus 73-84, responsable de
l’export nucléaire en mobilisant la
machinerie d’export cellulaire (Bartel et al., 1991; Malim et al., 1991). En se liant à l’élément
de réponse Rev (RRE) situé au niveau des ARN viraux mono-épissés ou non-épissés, Rev
permet leur transport du noyau vers le cytoplasme où a lieu leur traduction.
17
Figure 8: Rôle de la protéine Vif
Vif induit la dégradation de APOBEC3G par le protéasome: Vif fonctionne comme un adaptateur pour
connecter APOBEC3G au complexe Ubiquitine ligase E3. APOBEC3G est ubiquitynilée puis dégradée via
le protéasome.
Strebel K., et al., 2007;
Advances in pharmacology
18
- Nef (facteur Négatif) est une protéine myristylée de 25 à 27 kDa associée aux virions
et essentielle pour leur infectivité. Le gène codant pour Nef est localisé à l’extrémité 3’ du
génome viral et recouvre partiellement le début du LTR U3. Il existe quelques zones très
conservées dans la séquence de Nef : une séquence signal de myristylation à la partie Nterminale et une séquence répétée de prolines (PXXP) flanquée de résidus acides. Comme
Tat, Nef est exprimée immédiatement après l’infection, et certains ARNm sont détectés avant
même l’intégration du provirus (Wu and Marsh, 2001). Initialement, Nef était considérée
comme un élément de régulation négatif (d’où son nom) de l’expression des gènes viraux.
Cependant, il est bien établi actuellement que Nef a, au contraire, une action facilitatrice de la
réplication virale en particulier dans les lymphocytes primaires infectés en phase G0 puis
stimulés après infection (Chowers et al., 1994). La myristylation de Nef permet par ailleurs
son interaction avec les récepteurs CD4 et par conséquent leur internalisation et dégradation.
En diminuant le nombre de CD4 et de CMH-I de la cellule hôte, Nef d’une part, inhibe la
surinfection des cellules et facilite la dissémination de particules virales et d’autre part,
protège les cellules infectées de la destruction par les lymphocytes CD8 cytotoxiques
spécifiques du virus (Piguet et al., 1999). En plus de sa présence dans la particule virale, la
protéine Nef se trouve majoritairement associée à l’appareil de Golgi et à la membrane
plasmique au niveau des cellules infectées (Kestler et al., 1991). Nef est impliquée également
dans l’activation des cellules T (Geyer, Fackler, and Peterlin, 2001) et l’inhibition de
l’apoptose des cellules infectées par le VIH en inhibant ASK1 « Apoptosis Signal Regulating
Kinase 1 », une sérine thréonine kinase de la voie Fas (Geleziunas et al., 2001).
- Vif (Facteur d’Infectivité Virale) est une protéine de 23 kDa, ayant une localisation
essentiellement cellulaire (Fig. 8). Des anticorps anti-Vif sont détectés chez les patients
infectés par le VIH durant tous les stades de l’infection. Les virions n’exprimant pas cette
protéine présentent un caractère infectieux environ mille fois plus faible que les virions
sauvages (Park, Myrick, and Sodroski, 1994). Vif ne semble pas agir sur la transcription ou la
traduction des protéines virales mais plutôt sur la maturation ou l’assemblage des protéines de
structure. Elle stabiliserait le complexe de préintégration (Ohagen and Gabuzda, 2000). Elle
serait aussi impliquée dans l’étape d’encapsidation et favoriserait la réplication virale dans les
lymphocytes et macrophages (Bardy et al., 2001; Hassaine et al., 2001). Vif permettrait
d’effectuer une étape tardive du cycle viral en inhibant un processus antiviral naturel des
lymphocytes T induit par l’enzyme APOBEC3G (apoliprotein B mRNA-editing enzyme
catalytic polypeptide like 3G) (Sheehy et al., 2002). APOBEC3G est un facteur antiviral
19
Figure 9: Rôle de la protéine Vpr
A)
B)
A) Régulation putative du cycle cellulaire par Vpr: arrêt du cycle en phase G2/M. x indique que Vpr peut se
lier à d’autres protéines avant que le complexe résultant ne se lie et régule l’holloenzyme PP2A.
B) Transport nucléaire du complexe PIC du VIH par Vpr: Vpr se lie à l’importine a et active son interaction
avec les protéines PIC contenant le NLS, stimulant ainsi l’import nucléaire via la voie classique importine
α/β dépendante. D’autres molécules du complexe peuvent interagir directement avec la nucléoporine et
causent la destructuration dynamique de l’enveloppe nucléaire qui sert de site d’entrée du PIC. Vpr reste liée
à la membrane nucléaire par les nucléoporines.
Zhao, R. et al., 2007;
Advances in pharmacology
20
membre de la famille des « DNA cytosine deaminases », impliqué dans l’édition d’ARNm et
la diversification des gènes d’immunoglobulines (Petito and Cash, 1992). En absence de Vif,
APOBEC3G est incorporé dans les virions du VIH dans les cellules productrices.
APOBEC3G associée au virion convertit les cytosines en uraciles durant la synthèse du brin
d’ADN (Harris et al., 2003; Lecossier et al., 2003; Mangeat et al., 2003). La déamination des
cytosines durant la transcription inverse induit une hyper-mutation GÆA du génome viral et
par conséquent à la dégradation de l’ADN viral nouvellement synthétisé par l’uracil ADN
glycosidase cellulaire. En présence de Vif, APOBEC3G est dégradée via la voie ubiquitineprotéasome (Conticello, Harris, and Neuberger, 2003; Mehle et al., 2004; Sheehy, Gaddis,
and Malim, 2003; Yu et al., 2003).
- Vpr (Protéine Virale R) est une protéine de 14 kDa (96 aa) qui confère un avantage
de réplication significatif pour le virus (Fig. 9). Différentes fonctions ont été attribuées à Vpr
incluant : a) La stimulation de l’expression génique à partir du LTR (Cohen et al., 1990).
Cette activation est médiée par des interactions entre Vpr, Sp1 (Sawaya et al., 1998; Wang et
al., 1995), TFIIB (Kino et al., 1999) et TFIID (Kino et al., 1999). Vpr permet aussi
l’expression des gènes à partir des promoteurs cellulaires en activant les récepteurs aux
glucocorticoïdes (Kino et al., 1999). La liaison Vpr/CBP « p300/CREB binding protein »
pourrait jouer un rôle dans l’activation du LTR et des promoteurs cellulaires (Kino et al.,
2002). b) La facilitation du transport nucléaire du complexe de préintégration (PIC) via
l’interaction directe de Vpr avec les importines (Popov et al., 1998) et les nucléoporines
(Fouchier et al., 1998) c) L’arrêt du cycle cellulaire en phase G2 favorable à la réplication
virale et l’activation du LTR. Cet effet serait médié par l’interaction de Vpr avec de nombreux
facteurs de régulation du cycle cellulaire (Wang et al., 1995) et d’endommagement d’ADN
(Roshal et al., 2003). La déstructuration de l’architecture de l’enveloppe nucléaire et la perte
de compartimentation des protéines de régulation, induites par Vpr, seraient aussi à l’origine
de l’arrêt du cycle en phase G2. d) L’induction de l’apoptose via deux voies, dépendantes et
indépendantes des caspases (Muthumani et al., 2005b). Bien que ce mécanisme reste à
élucider, il semblerait que l’induction de la perméabilité mitochondriale y joue un rôle
important (Deniaud, Brenner, and Kroemer, 2004; Yedavalli et al., 2005).
Notons que Nef, Vpr et Vif seraient aussi présentes dans la particule virale (Kao et al.,
2003; Kotov et al., 1999; Wilk et al., 2001; Wu and Marsh, 2001).
21
Figure 10: Rôle de la protéine Vpu
Modèle représentant la dégradation du récepteur CD4 induite par Vpu. Vpu agit comme un adaptateur pour
connecter le domaine cytoplasmique de CD4 au complexe SCFTrcp (SKp1 de l’ubiquitine ligase + bTrcp). CD4 est
ubiquitynilé puisdégradéevia le protéasome.
Zhao, R. et al., 2007;
Advances in pharmacology
22
- Vpu (Protéine Virale U) est une phosphoprotéine multimérique de 16 kDa (81 aa),
intégrée à la membrane grâce à une séquence d’ancrage transmembranaire N-terminale et un
domaine cytoplasmique d’environ 50 aa. Vpu est présente uniquement dans le VIH-1. Dans le
VIH-2 elle est remplacée par la protéine Vpx. Deux fonctions principales sont associées à
Vpu (Fig. 10): a) au niveau du bourgeonnement des particules virales en augmentant la
vitesse de libération des particules virales de la membrane cellulaire (Schubert et al., 1996).
Cette propriété pourrait expliquer l’implication de Vpu dans la réduction de la formation de
syncytia. L’absence de Vpu, bien qu’elle ne soit pas associée à la particule virale, se traduit
par la production de virus d’architecture anormale et par le bourgeonnement de virions dans
des vacuoles intracellulaires. b) au niveau de la dégradation du récepteur CD4. Dans le
réticulum endopasmique, Vpu s’associe simultanément avec CD4 et β-TrCP « beta
Transducin-repeat Containing Protein ». Cette interaction évite la formation du complexe
gp160-CD4 qui séquestre le précurseur des protéines d’enveloppes gp160 dans le cytoplasme.
Le complexe ternaire Vpu-CD4- β-TrCP ainsi formé, est ubiquitinylé puis dégradé via le
protéasome suite à l’interaction de Skp1 avec le domaine F-box de β-TRCP (Margottin et al.,
1998). Grâce à ce mécanisme, le précurseur gp160 se trouve libre et les protéines d’enveloppe
peuvent ainsi continuer leur transport vers la surface cellulaire (Willey et al., 1992a; Willey et
al., 1992b).
2-5- Génome viral
Constitué de deux copies linéaires d'ARN simple brin (9,3 kb) de polarité positive,
associées à deux molécules de transcriptase inverse et à l’intégrase (Fig. 11). En partant de
l’extrémité 5’ à 3’ le long de l’ARN on retrouve : une coiffe ou « Cap » (m7G5’ppp5’Gmp) à
l’extrémité 5’-terminale ; une courte région R « repeat » qui se répète deux fois sur l’ARN,
appelée aussi « short terminal repeat » ; une séquence U5 « Unique 5’ » ; une région pbs
« primer binding site » de 18 nucléotides qui s’associe à l’extrémité 3’OH de l’ARNtlysine et
sert d’amorce pour l’initiation de la synthèse du petit brin d’ADN; « Ψ element » un site
majeur de reconnaissance pour l’empaquetage de l’ARN viral dans le virion ; les gènes gag,
pol et env ; une séquence polypurine ppt « polypurine tract » qui est le site d’initiation de la
synthèse du brin positif d’ADN ; une séquence U3 « Unique 3’ » ; une seconde copie de la
région R et enfin une séquence poly A à l’extrémité 3’. Durant la transcription inverse,
23
Figure 11: Structure du génome viral
A)
B)
C)
A) Organisation du génome rétroviral ARN simple brin (Field’s Virology, 2007)
B) Organisation du génome viral ADN pendant les différentes étapes de transcription (Field’s Virology, 2007)
C) Le génome viral ADN code pour des protéines de structure (Gag, Pol, Env), des protéines enzymatiques
et des protéines de régulation et accessoires (Rev, Nef, Vif, Vpr, Vpu et Tat) (Kuby, J., 2003; Immunology)
24
comme on le verra plus loin, les séquences U3 et U5 se dupliquent, formant ainsi une région
plus longue LTR « Long Terminal Repeat », constituée des séquences U3, R et U5, aux deux
extrémités de l’ADN double brin résultant. A partir de ce LTR en 5’ aura lieu l’initiation de la
transcription et les transcrits seront ensuite maturés et polyadénylés au niveau du LTR3’ pour
créer la structure exacte de l’ARN de départ. Il est important de noter que le génome du VIH1 contient une deuxième séquence ppt centrale (CPPT) suivie plus loin d’une séquence de
transcription stop (CTS). Cette séquence est responsable de la structure FLAP structure en
triple hélice du complexe de pré-intégration (PIC) (Voir partie cycle viral).
25
Figure 12: Cycle de réplication du VIH-1
CCR5
CXCR4
Rambaut, A., et al., 2004;
Nature reviews
26
3- CYCLE VIRAL
3-1- Vue générale du cycle viral
Comme tous les rétrovirus, le VIH a un cycle de réplication complexe comprenant les
étapes suivantes (Fig.12) :
- Fixation de la particule virale au récepteur cellulaire.
- Internalisation après fusion des membranes virales et cellulaires.
- Transcription inverse de l’ARN viral pour former un ADN double brin linéaire.
- Transport du complexe de pré-intégration (PIC) vers le noyau.
- Décapsidation et intégration de l’ADN linéaire dans le génome cellulaire pour former
le provirus.
- Transcription du provirus par l’ARN polymérase II pour former les différents ARN
messager (ARNm) viraux y compris l’ARN génomique.
- Epissage et export nucléaire des ARN.
- Traduction des ARN pour former des précurseurs de protéines virales.
- Assemblage de la particule virale et empaquetage du génome viral (ARN)
- Structuration et libération du virion.
- Maturation du virion pour générer une particule virale infectieuse.
3-2- Fixation et internalisation
3-2-1- Récepteurs viraux
La nature des récepteurs du VIH-1 définit non seulement la population des cellules
susceptibles d’être infectées par le virus, mais régule aussi la réplication du virus depuis
l’étape d’entrée (Fig. 13).
a- Le récepteur CD4
En 1986, Maddon et al. ont montré que l’expression de CD4 dans les cellules
humaines les rend sensibles à l’infection par le VIH-1 (Maddon et al., 1986). Il s’agit d’une
glycoprotéine monomérique, de la superfamille des immunoglobulines, exprimée par les
thymocytes et les lymphocytes T CD4+ et à plus faible taux par les monocytes/macrophages
et les cellules dendritiques.
27
Figure 13: Récepteurs du VIH
Modifiée d’après Bukrinsky, M., et a., 2001;
Hiv life cycle and coreceptors
28
cytoplasmique (Fig. 13). Le VIH utilise principalement les récepteurs CCR5 et CXCR4. La
liaison ligand-récepteur est accompagnée par un réarrangement des sept domaines
transmembranaires, suivi d’un changement conformationnel impliquant les ICLs. Cette forme
activée du récepteur stimule l’activation de l’hétérotrimère de protéines G (sous-unités α, β et
γ), induisant ainsi l’initiation d’une cascade de signalisation. Une fois initiés, ces signaux de
transduction activent entre autre, le réarrangement des filaments d’actine et la polarisation
cellulaire caractéristiques d’une réponse chimiotactique.
Tout comme le CD4, ces récepteurs aux chimiokines semblent localisés dans les
radeaux membranaires « lipid rafts » (Kozak, Heard, and Kabat, 2002; Raulin, 2002). Ces
microdomaines enrichis en cholestérol et sphingolipides de la membrane plasmique reflètent
la bicouche lipidique optimale du virus, fournissant ainsi l’environnement idéal pour la fusion
des membranes (Liao, Graham, and Hildreth, 2003).
c- Autres récepteurs cellulaires du VIH-1
Outre les lymphocytes T CD4+, la pathogenèse du VIH-1 implique divers types
cellulaires, qui n’expriment pas ou très peu de CD4 et des corécepteurs CCR5 et CXCR4
(Clapham and McKnight, 2002). Dans ce cas, le VIH-1 peut interagir directement via ses
glycoprotéines de surface avec d’autres type de récepteurs cellulaires (tels que DC-SIGN)
(Tableau). Pour élargir son tropisme, le virus peut aussi utiliser des molécules de l’hôte (tels
que CMH-I, CMHII, ICAM-1..etc) acquises lors de son bourgeonnement, pour interagir avec
leurs ligands naturels à la surface de différents types cellulaires (Tremblay, Fortin, and
Cantin, 1998).
Récepteur
Expression
Rôle dans l’attachement et l’infection
Référence
Gal-C
Neurones et cellules gliales
- Infection inefficace, aide à l’attachement
(Harouse et al., 1991)
DC-SIGN
Cellules Dendritiques
- Se lie à la gp120, présentation du VIH aux
(Pohlmann et al., 2001)
DC-SIGNR
Cellules endothéliales
cellules CD4
(Larkin et al., 1989)
Rcp d’endocytose
Macrophages
- Se lie à la gp120
à mannose
(Mondor, Ugolini, and
Héparanes
Plusieurs types cellulaires
- Attache le virus à la surface cellulaire via
Sattentau, 1998)
une interaction avec la boucle V3 et augmente
l’interaction avec CD4 et CXCR4.
LFA-1/ICAM-1
LFA-1 : cellules
- ICAM-1 incorporé dans le virion permet
(Fortin et al., 1999;
hématopoïétiques, ICAM-1 :
l’attachement et l’infections des cellules LFA-
Paquette et al., 1998)
différents types cellulaires
1
+
.
29
La protéine CD4 est composée de 4 domaines extracellulaires « Immunoglobulinrelated extracellular domains » (D1-D4), un domaine transmembranaire et une courte queue
cytoplasmique (Fig. 13). Le site de liaison du VIH-1 a été localisé dans l’ectodomaine distal
D1 du CD4. Le peptide CD4M33, qui mime le récepteur CD4 de l’hôte, est capable d’inhiber
l’interaction CD4-gp120 en se liant à la cavité interne de la gp120. De cette manière ce
peptide bloque aussi l’entrée du virus dans la cellule hôte (Stricher et al., 2005). Dans les
lymphocytes TCD4+, le CD4 interagit avec le complexe majeur d’histocompatibilité de classe
II (CMH-II), lors de la présentation antigénique par les cellules présentatrices d’antigènes
(CPA). Cette interaction active les cellules T via la tyrosine kinase p56LCK, associée à
l’extrémité cytoplasmique de CD4. Il est donc possible que la liaison du VIH-1du CD4, via
gp120, interfère avec la reconnaissance du CMH-II des CPA (Kwong et al., 1998), ce qui
pourrait contribuer à la dérégulation du système immunitaire chez les patients infectés.
Nous avions vu plus haut que le VIH-1 a élaboré deux stratégies indépendantes
impliquant trois protéines virales (gp160, Nef et Vpu) pour diminuer l’expression
membranaire de CD4 dans les cellules infectées. Cette stratégie préviendrait la capture des
virions bourgeonnant dans la cellule productrice via leur liaison au CD4 exprimé en surface.
Ce mécanisme contribue à faciliter la dissémination du virus aux cellules avoisinantes.
Le cycle réplicatif du VIH commence par l’adsorption des particules virales aux
molécules CD4 présentes à la surface des cellules cibles (principalement lymphocytes T
CD4+, monocytes et macrophages). Cette interaction de haute affinité (Kd=10-9M) est
réalisée par des complexes trimériques de glycoprotéine gp120 présents dans l’enveloppe
virale. Alors que la fixation des virions aux molécules CD4 est essentielle, leur interaction
avec un corécepteur, notamment les récepteurs aux chimiokines CXCR4 ou CCR5, est
indispensable à l’entrée dans la cellule hôte.
b- Récepteurs des Chimiokines
Les chimiokines sont de petites protéines (8-14 kDa), classées en deux sous familles
selon l’arrangement de leurs deux cystéines en position N-terminale (CC ou CXC) (Fig. 13).
Les chimiokines RANTES « Regulated on Activation Normal T cell Expressed and
Secreted », MIP « Macrophage Inflammatory Protein » 1-α et 1-β interagissent avec CCR5
(Baggiolini, Dewald, and Moser, 1994), et SDF « Stromal Cell-Derived factor »-1α est le
ligand naturel de CXCR4 (Kim and Broxmeyer, 1999).
Les récepteurs aux chimiokines, appartiennent à la famille des récepteurs à sept
domaines transmembranaires couplés aux protéines G, un domaine extracellulaire N-terminal,
trois boucles extracellulaires (ECL-1-3), trois boucles intracellulaires (ICL-1-3) et une queue
30
Figure 14: Etapes de fusion entre VIH-1 et cellule cible
Modifiée d’après Chan, DC. et al., 1998
Cell
31
3-2-2- Entrée du virus
L’entrée du virus se fait essentiellement par fusion entre les membranes virale et
cellulaire. Cette fusion se passe généralement au niveau des microdomaines membranaires
rafts (Kozak, Heard, and Kabat, 2002; Raulin, 2002) (Ono and Freed, 2005). Le processus
d’entrée se déroule en plusieurs étapes (Fig. 14) : la liaison de la protéine virale gp120 au
CD4 induit un changement de conformation qui permet à la gp120 de se lier au corécepteur
(CCR5 ou CXCR4). Suite à cette liaison, la gp41 change de conformation, conduisant à
l’accessibilité de la région N-terminale hydrophobe, qui correspond au domaine de fusion.
Cette région s’insère alors dans la membrane de la cellule hôte. Commence alors un
phénomène dynamique médié par l’interaction entre les trimères HR1 (ou N36) et HR2 (ou
C34), formant une structure en épingle à cheveux. Grâce à l’interaction entre les domaines N
et C-terminaux de la gp41, une structure à 6 hélices se forme et permet de rapprocher les
membranes virale et cellulaire qui fusionnent. La nucléocapside virale peut alors être libérée
dans le cytoplasme de la cellule hôte pour initier les premières étapes de la transcription
inverse. Toutefois, le contact des virions avec les lymphocytes T CD4+ provoque, de façon
simultanée l’endocytose des particules virales. Seule l’entrée par fusion des virions semble
mener à une infection productive dans les lymphocytes T CD4+. L’entrée des virions par
endocytose semble une voie sans issue qui conduit à leur dégradation (Marechal et al., 1998;
Schaeffer, Soros, and Greene, 2004). Cependant, une étude récente a montré que les virus qui
rentrent par endocytose ne sont pas nécessairement dégradés et que cette voie d’entrée
pourrait aussi contribuer à la dissémination du virus in vivo (Blanco et al., 2004).
3-3- Transcription inverse du génome viral et intégration dans le génome de
la cellule hôte
3-3-1- Transcription inverse
La transcription inverse de l’ARN viral en ADN double brin est la caractéristique
principale des rétrovirus. C’est un processus complexe et ordonné, qui commence
immédiatement après l’entrée du core du virion dans le cytoplasme de la cellule infectée. La
réaction a lieu au sein d’un grand complexe contenant les protéines MA, NC, RT, IN, Vpr,
l’ARN viral et plusieurs protéines de la cellule hôte comme la cyclophiline A (Bowerman et
32
Figure 15: Etapes de transcription inverse
ARN
RH
ARNt
ARN
ADN-
ADN+ADN-
ADN+
ADN-
33
al., 1989). Plusieurs arguments semblent montrer que la transcription inverse a lieu dans la
capside virale à proximité immédiate de la membrane nucléaire en association avec les
filaments d’actine (Arhel et al., 2007). En effet, la capside semble rester associée au génome
viral jusqu’à ce que le complexe atteigne les pores nucléaires (Arhel et al., 2007; McDonald et
al., 2002).
La reverse transcription peut être divisée en plusieurs étapes successives (Fig. 15):
1- Formation du petit brin négatif d’ADN « strong stop DNA »
Cette étape est initiée grâce à l’ARNtlysine portant un groupement 3’OH utilisé comme
amorce pour la synthèse de l’ADN. Cet ARNt se fixe d’abord sur l’ARN viral au niveau du
site pbs « primer binding site ». La RT reconnait le complexe ARNt/ARN et initie la
transcription inverse en procédant à l’élongation de l’extrémité 3’ de l’amorce, synthétisant
ainsi le brin négatif d’ADN jusqu’à l’extrémité 5’ de l’ARN viral. L’ADN formé à cette étape
s’appelle brin négatif d’ADN « strong stop » contenant les séquences U5 et R. L’ARNt reste
attaché à l’extrémité 5’ de ce brin.
2- Premier transfert
Afin de continuer la synthèse du brin négatif, l’ADN formé « strong stop » doit être
transféré à l’extrémité 3’ de l’ARN génomique. Ce saut ou transfert, a lieu suite à la
dégradation du brin d’ARN rétrotranscrit (U5R) du complexe ARN : ADN par l’action de
l’activité RNase H. Cette étape expose le brin négatif d’ADN et facilite son hybridation à la
séquence R du côté 3’OH du génome viral (Chen et al., 2003). Les protéines NC semblent
faciliter cette étape de transfert (Topping et al., 1998).
3- Synthèse du long brin négatif d’ADN
L’hybridation du petit brin négatif d’ADN « strong stop » à la séquence R crée une
amorce d’initiation d’ADN et la RT peut alors continuer l’élongation du brin négatif pour
former un long brin négatif d’ADN. La synthèse s’arrête à proximité de la séquence pbs en 5’
terminal de l’ARN. Pendant la synthèse du long brin négatif, la RNase H procède à la
dégradation de l’ARN du complexe hybride ARN : ADN. Cependant, deux séquences
d’ARN, résistantes à la RNase H, sont épargnées. Il s’agit des séquences ppt « polypurin
tract». L’une à côté du U3 du LTR 3’ et l’autre au centre du génome nommée cppt (Charneau,
Alizon, and Clavel, 1992).
4- Initiation de la synthèse du brin positif d’ADN
Ces séquences d’oligonucléotides (ppt et cppt) restent liées au brin négatif d’ADN et
servent d’amorces pour la synthèse du brin positif d’ADN avant d’être éliminées. La synthèse
progresse vers l’extrémité 5’ du brin négatif, en commençant par copier les séquences U3, R
34
et U5 et continue pour copier la portion d’ARNt encore présente en 5’. L’élongation s’arrête
au niveau des bases modifiées qui se trouvent normalement en position 19 de l’ARNt. Le brin
d’ADN naissant s’appelle brin positif d’ADN formé des segments amont (D+) et aval (U+).
5- Suppression de l’ARNt
L’arrêt de l’élongation du brin positif est marqué par la dégradation de l’ARNt en 5’
par la RNase H. Cette suppression peut se dérouler en deux étapes : un premier clivage près
de la jonction ARN : ADN, et un second dans l’ARNt. Un seul ribonuléotide (la base A) est
laissé à l’extrémité 5’ du brin négatif (Pullen, Ishimoto, and Champoux, 1992; Smith, Kim,
and Roth, 1990; Whitcomb, Kumar, and Hughes, 1990), sans affecter les étapes suivantes. La
séquence de bases près de la jonction, peut affecter significativement l’action de la RNAse H
(Smith et al., 1998).
6- Deuxième transfert et achèvement de l’élongation
L’élimination de l’ARNt expose l’extrémité 3’ du brin positif d’ADN, pour permettre
son appariement avec l’extrémité 3’ du brin négatif. Cet appariement est réalisé grâce à la
complémentarité des deux séquences pbs pour former un intermédiaire circulaire, avec les
deux extrémités 3’ dans une structure appropriée à l’élongation. La synthèse du brin D+
continue jusqu’à la fin du brin négatif en U5. La synthèse du brin U+ continue jusqu’à ce
qu’il rencontre la séquence CTS « Central Termination Sequence » localisée au centre du
génome (Charneau et al., 1994). La séquence cppt en amont du CTS initie la synthèse d’un
court fragment d’ADN et provoque le déplacement d’environ 100 nt du brin positif d’ADN
(D+), créant un chevauchement de brins en triplex nommé « Central DNA Flap». La
conséquence clé des deux translocations qui ont lieu durant la transcription inverse est la
duplication des séquences : U5 durant la translocation du brin négatif et U3 durant la
translocation du positif. L’ADN résultant contient deux LTR. Chacun est constitué des
séquences U3-R-U5. A la fin de cette élongation, le cercle s’ouvre pour donner un
intermédiaire linéaire.
3-3-2- Intégration de l’ADN proviral
1- Entrée dans le noyau
Avant de pouvoir s’intégrer, le génome viral doit d’abord traverser la membrane
nucléaire. La structure « Central DNA Flap », que comporte l’ADN rétrotranscrit grâce à la
région cppt, semble jouer un rôle majeur dans l’import nucléaire du génome viral.
35
La
Figure 16: Transport intracellulaire du VIH
Modèle du transport intracellulaire du VIH-1 et de l’import nucléaire de l’ADN viral
Flap-dépendant: 1) après la fusion, le virus a besoin d’interagir avec le cortex d’actine sous jacent
la membrane plasmique (Campbell et al., 2004). A ce stade la décapsidation n’a pas encore lieu. 2) le core
la particule renfermant le complexe de RT, est dirigé par les microtubules vers le compartiment nucléaire
(Mc Donald et al., 2002; Arhel et al., 2006). 3) le complexe RT transite des microtubules vers les filaments
d’actine à proximité immédiate du compartiment nucléaire et 4) ces filaments permettent un mouvement lent vers
la membrane nucléaire (Arhel et al. 2006). 5) la nucléocapside renfermant le génome virale s’arrête au
complexe du pore nucléaire NPC. 6) on suppose que la majorité de la transcription inverse a lieu à proximité du
NPC. 7) le complexe de préintégration PIC, dépourvu du Flap s’accumule dans la NC intacte qui ne pourra pas
traverser le pore nucléaire. 8) le Flap permet de traverser le pore nucléaire. 9) transport intranucléaire
diffusif (Arhel et al., 2006). 10) l’ADN viral s’intègre dans la chromatine de l’hôte ou reste sous forme
circulaire à 1 ou 2 LTR.
Arhel, N. et al., 2007;
The EMBO journal
36
Figure 17: Intégration du génome viral
Field’s virology. 2007
37
mutation de cppt engendre un génome linéaire dépourvu de la région « Central DNA Flap »,
et inhibe la réplication virale (Arhel et al., 2006; Zennou et al., 2000). De plus l’ADN linéaire
dépourvu du ‘Flap’, s’accumule à proximité des membranes nucléaires indiquant une
déficience de l’import nucléaire (Zennou et al., 2000). Contrairement à ce qui a été avancé, il
semblerait que la décapsidation n’aurait pas lieu immédiatement après la fusion, mais à
proximité des pores nucléaires du coté cytoplasmique, une fois la transcription inverse
terminée et au moment de la maturation du PIC (ADN proviral, IN, MA, Vpr, et RT) essentiel
pour l’import nucléaire (Arhel et al., 2007) (Fig. 16). Le complexe PIC étant deux fois plus
grand que le diamètre maximal du pore nucléaire (9 à 29 nm), plusieurs mécanismes doivent
être mis en jeu pour faciliter sa pénétration dans le noyau : i) la séquence consensus de
localisation nucléaire (NLS) de la matrice est reconnue notamment par les importines-α et β cellulaires impliquées dans la translocation nucléaire; ii) Vpr se lie aux importines et aux
nucléoporines (Fouchier et al., 1998; Popov et al., 1998); iii) de plus, la séquence « Central
DNA Flap » aurait un rôle dans l’adressage de PIC au noyau; iv) enfin, le PIC pourrait aussi
utiliser les microtubules pour pénétrer dans le noyau (McDonald et al., 2002). Le PIC accède
ainsi au noyau et permet l’intégration de l’ADN viral dans le génome de l’hôte grâce à
l’action de l’intégrase.
2- Intégration
L’intégrase clive les deux derniers nucléotides 3’ de chacun de deux brins d’ADN
viral, puis clive aussi l’ADN cellulaire en formant des extrémités cohésives 5’ sortantes de 4
nucléotides (Fig. 17). Une ligase cellulaire intervient pour joindre l’ADN cellulaire et viral.
L’intégration au génome de la cellule hôte est définitive, ce qui confère au virus la capacité de
persister dans les cellules infectées.
En plus de cet ADN linéaire qui sert pour l’intégration, deux types d’ADN viraux
circulaires peuvent se trouver dans le noyau des cellules infectées : un ADN circulaire à un
LTR, généré par recombinaison homologue entre les deux LTR de l’ADN linéaire, et un autre
ADN à deux LTR générés par la ligation des deux extrémités du précurseur linéaire, ou dans
lequel les LTR sont distribués de façon aléatoire sur la molécule circulaire, suite à une autointégration de l’ADN viral sur lui-même, médiée par l’intégrase virale (Li et al., 2001).
Aucune des ces formes d’ADN circulaires n’est infectieuse bien que certaines soient
transcriptionnellement actives (Wu and Marsh, 2001).
Le provirus peut persister pendant des années dans des cellules quiescentes, pouvant à
tout moment se réactiver en réponse à une stimulation et ainsi induire la réplication du
38
Figure 18: Structure du LTR (Long Terminal Repeat)
39
Figure 19: Transcription du génome viral
Modifiée d’après Peterlin, S. et al., 2003
Nature
40
provirus intégré. Ces phénomènes constituent une limitation pour les traitements rétroviraux
actuels qui ne sont actifs que sur les virus en réplication (Pomerantz, 2002).
3-4- Expression du provirus et bourgeonnement de nouveaux virions
3-4-1- Transcription
Dans la cellule hôte, le LTR 5’ contient des éléments promoteurs qui vont permettre
au génome viral de s’exprimer (Fig. 18). On compte un centre « core promoter », constitué
d’un élément initiateur de la transcription (Inr) et d’une TATA box. Du côté 5’ se trouvent
trois sites Sp1 (Taube et al., 1999) et des éléments promoteurs permettant de fixer les facteurs
de transcription NF-κB, NF-AT et les membres de la famille Ets (Jones and Peterlin, 1994).
Du coté 3’ l’autre, des séquences activatrices « enhancers ».
Un complexe co-activateur se fixe sur Sp1 et ensemble, recrutent et positionnent
l’ARN polymérase II au site d’initiation de la transcription pour former le complexe de
préinitiation (Fig. 19). La transcription commence, mais la polymérase seule ne permet pas
l’élongation du transcrit naissant. En effet, l’ARN pol II initie la transcription de l’ARN viral,
mais la transcription est rapidement bloquée par le facteur N-TEF « Negative Transcriptional
Elongation Factor ». Ceci résulte en l’accumulation de transcrits courts (Kao et al., 1987;
Wada et al., 1998; Yamaguchi et al., 1999). Le N-TEF est un complexe constitué du DSIF
« DRB-Sensitivity-Inducing Factor » et du NELF « Negative ELongation Factor ». Afin de
remédier à ce blocage, le virus met en jeu un activateur transcriptionnel : la protéine Tat.
Contrairement à la majorité des activateurs transcriptionnels, Tat ne se fixe pas directement à
l’ADN cible, mais interagit avec une structure en tige-boucle, localisée à l’extrémité 5’de
l’ARN naissant, appelée TAR « Trans-Activating Response element » (Kao et al., 1987).
La protéine Tat du VIH, se lie à la protéine PCAF « p300/CBP-associated factor » qui
induit son acétylation sur la lysine K28 générant Ac28Tat (Fig. 20). Cette dernière a une
grande affinité pour le complexe P-TEFb « positive elongation factor b » constitué de la
Cycline T1 et CDK9 (cyclin-dependent kinase 9). Le complexe Ac28Tat-PTEFb a une forte
affinité pour la séquence TAR de l’ARN naissant (Wei et al., 1998) qui recrute la Cdk9
cellulaire. Tat recrute p300/CBP et hGCN5 ce qui provoque son acétylation sur les lysines
K50 et K51 (Col et al., 2001; Deng et al., 2000; Kiernan et al., 1999). Ac50Tat ayant une plus
41
Figure 20: Transcription du génome viral médié par Tat
Gatignol, A. et al., 2007;
Advance in pharmacology
42
Figure 21: Rôle de la protéine Rev dans l’export nucléaire
des transcrits viraux
Rôle de Rev dans l’export nucléaire
L’ARNm multi-épissé des protéines (Tat, Rev et Nef) du VIH-1 utilise une voie indépendante de Rev pour
sortir du noyau (1). Grâce à son signal NLS, la protéine Rev néosynthétisée se lie à l’importine β (2) formant un
hétérodimère (3), qui est transloqué via le pore nucléaire. Dans le noyau, Ran (GTP) permet la dissociation
Rev/importine (4) et Rev libre (5) se lie à l’élément RRE (Rev-responsive element) sur l’ARNm (6). Le complexe
Rev-RRE ARNm est convertie en une structure d’export fonctionnelle après l’addition de CRM1 et Ran (GTP) (7).
Le complexe sort par le pore nucléaire (8). Dans le cytoplasme, Ran (GTP) est convertie en Ran (GDP) grâce à
RanBP1/RanGAP (9) et se détache de l’ARN viral (10). Ce transcrit peut être encapsidé dans le virion ou traduit
en protéines virales lorsqu’il est partiellement épissé (11).
Field’s virology, 2007
43
faible affinité pour TAR, le complexe p300/CBP-Ac50Tat-PTEFb est alors dissocié de TAR
et transféré à une autre région du promoteur (Bres et al., 2002; Kaehlcke et al., 2003). La cdk9
phosphoryle le DSIF (Fig. 19) et la queue C-terminale de l’ARN polymerase II (CTD), ce qui
marque la transition de l’étape d’initiation vers l’étape d’élongation de la transcription (Price,
2000). La phosphorylation de la queue CTD de l’ARNpol II sur les sérines 2 et 5 ne sert pas
seulement à activer l’élongation de la transcription, mais permettrait aussi de stimuler le
« capping » des ARN viraux naissants (Zhou et al., 2003). Le complexe Tat-CycT1-CDK9
fixé sur TAR, recrute des facteurs de transcription tels que TFIID (Kashanchi et al., 1994;
Raha, Cheng, and Green, 2005), TFIIB (Veschambre, Roisin, and Jalinot, 1997), et NF-κB au
niveau du promoteur des gènes (Dandekar, Ganesh, and Mitra, 2004), ainsi que des histones
acétyl transférases et les protéines SWI/SNF nécessaires pour la décondensation de la
chromatine (Agbottah et al., 2006) (Fig. 20).
3-4-2- Traduction
a- Export des ARN du Noyau vers le cytoplasme
Nous décrirons les différents mécanismes et étapes de (1 à 11) de la figure 21 qui
interviennent dans l’export des ARNm de manière dépendante ou non de Rev. Les ARNm
multi-épissés des protéines (Tat, Rev et Nef) du VIH-1 utilisent la voie indépendante de Rev,
pour sortir du noyau (1). Les ARN mono- ou non-épissés, qui codent pour les précurseurs des
protéines de structure et enzymatiques, contiennent des séquences instables qui favorisent leur
rétention dans le noyau. Pour sortir du noyau, ces ARN dépendent de la protéine Rev et de la
présence de la séquence RRE « Rev Response Element » (Cullen, 1992). Grâce à son signal
de localisation nucléaire NLS, la protéine Rev néosynthétisée se lie à l’importine β (2)
formant un hétérodimère (3), qui est transloqué dans le noyau via le pore nucléaire. Dans le
noyau, Ran (GTP), permet la dissociation Rev/importine β (4). Rev libre (5) se lie à l’élément
RRE sur l’ARNm (6). Grâce au recrutement de CRM1 « Chromosome Region Maintenance
1) dite aussi exportine 1 (Fornerod et al., 1997; Stade et al., 1997) et Ran(GTP), le complexe
Rev-RRE-ARNm est converti en une structure d’export fonctionnelle (7). Le complexe sera
exporté du noyau via les pores nucléaires (8). Dans le cytoplasme, Ran(GTP) est converti en
Ran(GDP) grâce à RanBP1 « Ran binding protein 1 » et RanGAP « Ran GTPase-activating
protein» (9). Ces deux protéines augmentent l’activité de Ran dans le cytoplasme en induisant
44
Figure 22: Traduction des protéines virales
Peterlin, M. et al., 2003;
Nature review
45
Figure 23: Bourgeonnement des virions
Assemblage
à la membrane
Bourgeonnement
Maturation
46
l’hydrolyse du GTP et son détachement de l’ARN viral (10). Les transcrits peuvent être alors
encapsidés dans le virion ou traduits en protéines virales (11).
b- Traduction des protéines virales
La traduction a lieu dans le cytoplasme à partir de la machinerie de la cellule hôte. La
traduction de l’ARNm gag-pol s’arrête la plupart du temps au codon stop donnant le
précurseur Pr55Gag. Quant au Pr160Gag-Pol, il résulte d’un événement rare de changement de
cadre de lecture « frameshift » qui rend silencieux le premier codon stop (Wilk et al., 2001).
Alors que peu de molécules d’enzymes virales (protéase, transcriptase inverse, intégrase) sont
synthétisées, de fortes quantités de Pr55Gag (plus de 2000 molécules) sont ainsi générées pour
servir à la formation de la matrice et la capside du virion (Wilk et al., 2001) (Fig. 22).
3-4-3- Assemblage et bourgeonnement
L’assemblage des particules virales (Fig. 23) est catalysé par la dimérisation du
précurseur Pr55Gag (Alfadhli et al., 2005). Le domaine M, contenant les 32 premiers acides
aminés de la p17 et qui correspond à la zone MA caractérisée par ses peptides basiques
permet l’adressage du précurseur Pr55Gag vers la membrane cellulaire via un signal
« membrane binding ». Cette affinité de MA à la membrane est due en partie à son motif
myristilé attaché de manière covalente à la glycine N-terminale de MA. De plus, des résidus
basiques de MA interagiraient avec les phospholipides chargés négativement du feuillet
interne de la bicouche lipidique, stabilisant ainsi l’interaction membranaire (Massiah et al.,
1994; Zhou et al., 1994). La mutation des séquences NC ou p6 du précurseur Pr55Gag bloque
l’assemblage et le bourgeonnement des virions, ce qui suggère un rôle important de ces
domaines dans ce processus (Demirov and Freed, 2004; Morita and Sundquist, 2004; Muriaux
et al., 2001). Les protéines de l’enveloppe présentes à la surface cellulaire sont incorporées
dans le virion grâce à l’association du domaine cytoplasmique de la gp41 avec le domaine
MA du précurseur Pr55Gag. Le bourgeonnement des virions se fait généralement au niveau des
rafts, ce qui leur confère une membrane riche en cholestérol (Nguyen and Hildreth, 2000). Le
virus emporte également avec lui des protéines de surface cellulaire. Des protéines cellulaires
joueraient aussi un rôle crucial dans le bourgeonnement des virions : HP-68 et TSG-101. HP-
47
Figure 24: Maturations de la particule virale
Figure par Henderson Louis E. et Arthur Larry
48
68 agirait comme une protéine chaperonne, facilitant les changements conformationnels de
Gag nécessaires à la formation de la capside (Zimmerman et al., 2002). La dernière étape du
bourgeonnement est caractérisée par un événement de fusion membranaire qui dépend de la
séquence Pro-Thr-Ala-Pro présente dans la séquence p6 de Gag (Garnier et al., 1999). La
protéine TSG101, qui participe normalement au bourgeonnement des endosomes tardifs, se
lie à ce domaine Pro-Thr-Ala-Pro et reconnaît aussi l’ubiquitine (Garrus et al., 2001;
VerPlank et al., 2001). Le précurseur Pr160Gag-Pol et l’ARN génomique sont encapsidés grâce
à une séquence d’encapsidation
ᴪ
présente sur les ARN génomiques complets (Clever,
Miranda, and Parslow, 2002).
3-5- Clivage protéique et maturation du virion
Après bourgeonnement du virion de la surface cellulaire, les protéines précurseurs
Pr55Gag et Pr160Gag-Pol subissent un clivage protéolytique pour générer les protéines matures
dans le virion infectieux (Fig. 24). Ce clivage est réalisé par la protéase PR virale responsable
également de son propre clivage. Le clivage de Gag donne naissance aux protéines de
structure MA, NC et CA. La région Pol du précurseur Gag-Pol donne les protéines RT (p66 et
p51), PR et IN (p46). Le précurseur Env subit plusieurs modifications post-traductionnelles
principalement des N-glycosylations, puis il est maturé dans le trans-Golgi par une
endoprotéase cellulaire donnant la gp120 et la gp41, essentielles au tropisme et la fusion
virus-cellule hôte (McCune et al., 1988). La gp120 est fortement glycosylée, 50% de sa masse
molaire est constituée de carbohydrates. Cette modification post-traductionelle semble jouer
un rôle dans les mécanismes d’échappement du virus à la réponse immunitaire (anticorps
neutralisants et lymphocytes T cytotoxiques).
49
4- TROPISME ET PERSISTANCE VIRALE
4-1- Les cellules cibles du VIH
a- Les Lymphocytes T CD4+
In vivo la plupart des cellules T CD4+ sont dans un état quiescent (G0). La moitié des
cellules quiescentes environ sont naïves alors que les autres sont des cellules T CD4+
mémoires qui ont déjà répondu à un antigène. En plus du CD4, les cellules T naïves
expriment les corécepteurs CXCR4 alors que les cellules T mémoires expriment le CCR5
(Kaech, Wherry, and Ahmed, 2002; Sallusto, Geginat, and Lanzavecchia, 2004). Les cellules
T CD4+ mémoires quiescentes ont une demi-vie de six mois et les cellules T CD4+ naïves
quiescentes ont une demi-vie encore plus longue (Persaud et al., 2003). L’infection par le
VIH-1 se caractérise par une déplétion progressive des cellules T CD4+ avec l’évolution de la
maladie, dans la majorité des cas, vers le stade SIDA. En effet, le VIH se réplique plus
fréquemment dans les cellules T CD4+ activées. A cause de l’effet cytopathique du virus et
de la cytotoxicité des cellules T CD8+ activées, le nombre des cellules T helper spécifiques
du VIH diminue, conduisant à un affaiblissement du contrôle de la réplication virale par le
système immunitaire. Les lymphocytes T CD4+ infectés se caractérisent aussi par le fait
qu’une petite fraction de ces cellules infectées arrêtent de proliférer et redeviennent des
cellules quiescentes, formant ainsi un réservoir latent. Ceci participe à assurer la persistance
du virus dans l’organisme à long terme, et ce même en présence des traitements
antirétroviraux (Blankson, Persaud, and Siliciano, 2002).
b- Les cellules dendritiques
Ces cellules sont faiblement susceptibles à l’infection par le VIH-1 in vitro (Patterson
et al., 2001), probablement parce qu’elles expriment très peu de CD4, CXCR4 et de CCR5
(Turville et al., 2001). Il semblerait qu’elles jouent un rôle crucial lors de la primo-infection
du VIH-1 en capturant le virus au niveau du site initial de l’infection dans les muqueuses, et
en le propageant vers les organes lymphoïdes où le virus est présenté aux lymphocytes T
helper (Chaipan et al., 2006; Wu and KewalRamani, 2006).
Les cellules dendritiques sous-mucosales expriment à leur surface la structure
d’attachement DC-SIGN qui se lie à la gp120 avec une grande affinité (Kd=1,3.10-9M)
(Curtis, Scharnowske, and Watson, 1992; Geijtenbeek et al., 2000).
50
Les cellules de Langerhans expriment le récepteur CD4 et le corécepteur CCR5. Elles
sont susceptibles à l’infection par le VIH-1(Kawamura et al., 2003; Reece et al., 1998; Sugaya
et al., 2004). Ces cellules migrent de la surface des épithéliums aux ganglions lymphatiques,
où elles transmettent le VIH-1 aux lymphocytes T CD4+ (Kawamura et al., 2003).
Enfin, les cellules dendritiques folliculaires sont situées dans les centres germinatifs
des organes lymphoïdes secondaires où le virus est opsonisé par des anticorps et/ou des
protéines du complément. Dans la pathogenèse du VIH-1, les tissus lymphoïdes deviennent
rapidement un réservoir majeur du virus contribuant ainsi à la persistance virale (Burton et al.,
2002; Smith-Franklin et al., 2002; Smith et al., 2001).
c- Les Macrophages
Les macrophages sont à la fois une cible du VIH-1 et un acteur essentiel de la défense
antivirale : L’infection des macrophages par le VIH-1 altère la production de cytokines, leur
capacité de présentation des antigènes et de destruction (par phagocytose) des pathogènes
intracellulaires. Ces dysfonctions alimentent l’inflammation chronique et les dommages
tissulaires observés chez les sujets VIH-1+ (Kumar et al., 1999; Lee et al., 2003a; Polyak et
al., 1997). Les macrophages sont résistants à l’effet cytopathogène du VIH et des antiviraux
(Garbuglia et al., 2001; Stevenson, 2003). Ils représentent donc un réservoir viral important et
un acteur principal dans la persistance de l’infection. Puisque les macrophages sont des
cellules présentatrices d’antigènes et productrices des chimiokines, elles favorisent ainsi la
transmission intercellulaire du virus (Verani, Gras, and Pancino, 2005). Cette propriété de
présentation d’antigènes augmenterait l’apoptose des lymphocytes infectés et non infectés qui
a lieu dans les ganglions lymphatiques (Mahlknecht and Herbein, 2001; Verani, Gras, and
Pancino, 2005). Tout comme les DC-SIGN, les héparanes sulfates protéoglycanes présents à
la surface des macrophages lient efficacement le VIH via les carbohydrates de la gp120, et
participent à sa transmission aux cellules T (Nguyen and Hildreth, 2003).
d- Les cellules NK « Natural Killer »
Les cellules NK sont des cellules lymphoïdes dérivées de la moelle osseuse qui
partagent avec les cellules T un progéniteur initial commun. Elles expriment des marqueurs
membranaires typiques des cellules T, mais aussi des marqueurs présents sur les monocytes et
les granulocytes. Les cellules NK représentent 5 à 10% de la population des lymphocytes
circulants. Elles sont impliquées dans les défenses immunitaires contre les virus et les
tumeurs. L’activité NK est stimulée par l’IFNα, IFNβ et l’IL-12. Dans le développement
51
d’une infection virale, le taux de ces cytokines augmente rapidement suivi de près par une
production de cellules NK qui atteint son maximum en trois jours environ. Les cellules NK
constituent la première ligne de défense contre l’infection virale en contrôlant la réplication
des virus pendant la période nécessaire à l’activation, la prolifération et la différentiation des
cellules T qui nécessitent plus de temps (de l’ordre de la semaine). Les cellules NK expriment
le CD4 et peuvent être infectées de manière productive par les virus CCR5 et CXCR4
tropiques. L’ADN viral peut persister dans ces cellules même après deux ans de trithérapie
anti-VIH (Valentin et al., 2002). Cette observation suggère que les NK semblent constituer
aussi un réservoir potentiel du virus.
e- Les cellules endothéliales
Les cellules endothéliales participent également à la pathogenèse du VIH-1. Tapissant
le système cardiovasculaire dans son ensemble, les cellules endothéliales sont par conséquent
en contact fréquent avec les cellules T CD4+ mémoires. Cette proximité permet aux
lymphocytes infectés de migrer à travers les cellules endothéliales (barrière vasculaire) et
d’exporter des particules infectieuses vers divers tissus et organes (Birdsall et al., 2004). Les
cellules endothéliales peuvent être permissives au VIH-1(Argyris et al., 2003 ; Lafon et al.,
1993). L’entrée du virus dans ces cellules passe par les récepteurs CD4, les récepteurs
galactosyl-céramides et les récepteurs aux chimiokines. La gp120 est à l’origine de la
cytotoxicité des cellules endothéliales dérivées de la veine ombilicale (Huang, Hunter, and
Bond, 1999), des intestins et du cerveau (Kanmogne, Kennedy, and Grammas, 2001;
Kanmogne, Kennedy, and Grammas, 2002; Kanmogne, Primeaux, and Grammas, 2005).
Cette cytotoxicité des cellules infectées conduit à la libération de la gp120 et d’autres
protéines virales dans le sérum (Oh et al., 1992) et le tissu cérébral (Jones, Bell, and Nath,
2000).
f- Le système nerveux central
Chez plus de 25% des sujets infectés, le VIH-1 cause des troubles neurologiques,
dont la sévérité varie de désordres cognitifs et moteurs légers à la démence. Les principales
cibles d’infection par le VIH-1dans le cerveau sont les macrophages et les cellules
microgliales qui produisent des protéines virales (telles que la gp120, Tat, et Vpr), des
chimiokines et des cytokines responsables de la dysfonction ou l’apoptose des neurones et des
astrocytes, causant des troubles neurologiques. Le parenchyme du cerveau est séparé du reste
du corps par la barrière hémato-encéphalique. Pour qu’il y ait infection, les virions doivent
52
franchir cette barrière soit directement soit indirectement via des monocytes et/ou des
lymphocytes infectés par le VIH-1. De plus, le VIH-1 pourrait utiliser une voie para-cellulaire
impliquant les jonctions étanches. En effet, la protéine virale Tat perturbe l’expression et la
distribution des protéines des jonctions étanches des cellules endothéliales microvasculaires
du cerveau et induit leur apoptose (Gonzalez-Scarano and Martin-Garcia, 2005; Kim et al.,
2003). Ces événements participent à la perturbation de l’intégrité de la barrière hématoencéphalique, ce qui semble favoriser le passage du VIH-1 dans le cerveau.
4-2- Latence et persistance
Si le virus n’exprime pas son génome et si il réside dans des « sanctuaires » cellulaires
sans induire un effet cytopathique, il peut établir une infection persistante (Oldstone, 1998;
Ploegh, 1998). Le VIH est capable d’échapper au contrôle du système immunitaire dans au
moins deux sites : les cellules microgliales du système nerveux central, dans lesquelles la
réponse immunitaire est naturellement réduite, mais aussi dans les lymphocytes T quiescents
au niveau des organes lymphoïdes (Blankson, Persaud, and Siliciano, 2002) où il adopte un
état de latence provirale.
Des facteurs cellulaires et viraux peuvent contribuer à cette latence provirale. Parmi ces
derniers, la protéine Tat du VIH semble jouer un rôle très important : 1) D’abord, le VIH
s’intègre occasionnellement dans une région du génome où la transcription est peu ou pas
activée, dans une cellule quiescente (Jordan, Defechereux, and Verdin, 2001). Dans ces
régions de l’hétérochomatine, ni l’initiation ni l’élongation de la transcription n’y sont
observées. 2) Le niveau des facteurs de transcription NF-κB et NFAT dans les cellules
quiescentes serait trop faible pour leur permettre de recruter le P-TEFb au LTR (Herrmann et
al., 1998), ce qui fait, que seule l’initiation de la transcription virale a lieu. 3) Le niveau de la
cycline T1, cofacteur essentiel pour l’activité de Tat, est très faible dans les cellules
quiescentes (Herrmann et al., 1998).
Dans les conditions normales, les cellules infectées par un virus sont aussitôt reconnues
et éliminées par le système immunitaire. Ceci est essentiellement dû à la présentation des
peptides viraux par les molécules du CMH-I (complexe majeur d’histocompatibilité de classe
I), qui permet la reconnaissance par les lymphocytes T cytotoxiques CD8+ (CTL). Pour
échapper à ce contrôle, le VIH inhibe l’expression du CMH-I à la surface cellulaire via sa
protéine Nef qui est produite durant la phase précoce (Schwartz et al., 1996). De cette façon,
53
les cellules infectées par le VIH échappent aux CTL, ce qui contribue très probablement à la
chronicité de l’infection (Collins et al., 1998). En présence de Nef, la migration du CMH-I à
la surface cellulaire est déviée vers les endosomes d’où ils seront récupérés par le réseau
trans-golgien. La protéine Tat pourrait également diminuer l’expression du CMH-I en
agissant au niveau de la transcription du gène (Howcroft et al., 1993). Par ailleurs, la protéine
Nef en inhibant ASK-1, protège les cellules infectées de l’apoptose et contribue à leur
persistance comme réservoir du virus (Geleziunas et al., 2001).
54
Figure 25: Profile sérologique au cours de l’infection VIH-1
Infection primaire
SIDA
Infection chronique
1000
Cellules T CD4+
700
105
600
Immunité cellulaire
anti-VIH-1
500
ARN du VIH-1
104
400
Cellules DC4+/ml
ARN du VIH-1 (Copies/ml)
106
300
Anticorps VIH-1 spécifiques
103
200
100
Années
Mois
Modifiée d’après Field’s Virology.
2007.
55
II-IMMUNOPATHOLOGIE DE L’INFECTION VIH-1
1- INFECTION VIH-1
L’infection par le VIH peut être divisée en 3 phases (Fig. 25):
1-1- La primo-infection
Très vite après l’infection, le virus atteint les nodules lymphatiques et stimule la réponse
immunitaire, à la fois cellulaire et humorale. De plus en plus de cellules sont infectées, le
virus est produit en très grande quantité (106-108 copies d’ARN par ml) et en quelques jours
une forte chute de globules blancs (leucopénie), et des lymphocytes TCD4+ est observée
(Cooper et al., 1985; Daar et al., 1991; Pantaleo et al., 1993; Tindall and Cooper, 1991).
Après 2-4 semaines, l'organisme élimine une très grande partie du virus grâce à son système
de défense immunitaire comprenant des lymphocytes T CD8+ et T CD4+ (Cooper et al.,
1988; Koup et al., 1994) et des anticorps spécifiques du VIH-1, mais sans réussir à l’éliminer
totalement. Parfois pendant cette période silencieuse, des symptômes peuvent apparaître
rappelant une mononucléose (fièvre, éruptions cutanées). Des études in vitro ont montré que
les cellules T CD8+ provenant de patients infectés, produisent des cytokines solubles qui
inhibent la réplication virale dans les T CD4+ sans pour autant causer leur lyse (Walker et al.,
1986). Le niveau des cellules T CD8+ décline par la suite, mais reste plus haut que la normale
durant toute l’infection. Les virions présents à ce stade sont principalement R5-tropiques,
utilisant majoritairement le corécepteur CCR5 pour pénétrer dans leurs cellules hôtes.
1-2- La phase asymptomatique
Après cette phase silencieuse, les individus infectés restent asymptomatiques malgré
l’endommagement continuel de leur système immunitaire. Cette phase peut s’étaler sur une
période de 10 ans en moyenne (dans les pays occidentaux) (Hessol et al., 1994; Lemp et al.,
1990; Pantaleo et al., 1993). Le virus qui subit de nombreuses mutations, échappe au système
immunitaire et continu à se répliquer dans les organes lymphoïdes. On assiste à un déclin
permanant du nombre et de la fonction des cellules T CD4+ (2 108 cellules/jour). Cette perte
56
Figure 26: Maladies opportunistes
(Infections)
a) Varicelle-Zona (par Adrian Mindel)
b) Pneumocystis pneumonia (par Rob Miller)
c) Candidose orale (par Adrian Mindel) Candidoese oesophagienne (par Ian Mc Gowan)
ABC of AIDS,
2001
57
Figure 27: Maladies opportunistes
(Tumeurs)
d) Lymphome non-hodgkinien
e) Sarcome de Kaposi
Par Caroline M Bridgewater, 2001
ABC of AIDS,
58
quotidienne des T CD4+ est compensée par leur renouvellement (2.109 cellules/jour),
indiquant une activité considérable du virus et du système immunitaire en même temps (Levy,
1993). La perte de fonction, en revanche se fait progressivement. D’abord, les cellules T
perdent la capacité de réponse aux antigènes, puis aux alloantigènes et enfin aux mitogènes
non spécifiques (Clerici et al., 1989). Le déclin du nombre des cellules T CD4+ peut être dû à
plusieurs facteurs : un effet cytopathique direct du virus, tel que la rupture de la membrane
cellulaire lors de la libération des nouveaux virions, et la formation de syncicia ; l’apoptose ;
la réponse cytotoxique spécifique médiée par les T CD8+, ADCC et cellules NK ; la liaison
des protéines gp120 libres au récepteur CD4 au niveau des cellules non infectées faisant
d’elles des cibles potentielles de l’immunité humorale et cellulaire ; l’anergie et enfin,
l’infection et l’endommagement des cellules souches thymiques.
1-3- La phase SIDA
La perte du nombre et de la fonction des cellules T CD4+, résulte en une très forte
diminution de la production de certaines cytokines telles que l’IL-2 (voir plus loin). Ceci
induit la baisse de l’activité anti-VIH des cellules CD8+. Quand les lymphocytes T CD4+
sont inférieures à 200 cellules/µl, les monocytes et les cellules dendritiques exprimant les
récepteurs CD8 ainsi que les cellules T CD8+ sont infectées, ce qui augmente davantage la
charge virale (Livingstone et al., 1996). A ce stade, le système immunitaire a perdu la bataille
contre le VIH et les individus VIH+ développent des infections opportunistes ou des tumeurs
(Lymphome non-Hodgkinien ou Sarcome de Kaposi) suite à l’altération des défenses
immunitaires (Fig. 26 et 27). Le SIDA est déclaré lorsque le nombre des cellules T CD4+ est
inférieur ou égale à 200 cellules/µl.
2- LES MOLECULES ANTIRETROVIRALES
Le traitement du SIDA, outre les thérapeutiques immunologiques, passe clairement par
la mise au point de molécules antirétrovirales, capables de bloquer d’une manière aussi
efficace que possible les différentes étapes du cycle viral (Fig. 28).
59
Figure 28: Etapes d’inhibition du cycle virale
Maturation
libération
Assemblage
Inhibiteurs de protéase
Encapsidation
Enveloppe
NRT
NNRT
Transcription
Entrée
Intégration
Inhibiteurs d’intégrase
Inhibiteurs d’attachement
Antagonistes des récepteurs aux chimiokines
Inhibiteurs de fusion
Modifiée d’après Field’s virology. 2007
60
2-1- Inhibiteurs de fusion
Plusieurs molécules ciblant l’entrée du virus dans la cellule hôte ont montrés des
résultats encourageants. Certains essais utilisaient la molécule CD4 soluble prévenant
l’attachement du virus (Daar et al., 1990; Turner et al., 1992) et des inhibiteurs bloquant
l’interaction gp120-CD4 (Guo et al., 2003; Lin et al., 2003). Des essais cliniques utilisant les
anticorps monoclonaux (TNX-355) se liant à la portion extracellulaire de CD4 (Kuritzkes et
al., 2004) inhibant ainsi l’entrée virale post-attachement, ont montré une activité anti-VIH
potentielle. L’Enfuvirtide (T20), un oligopeptide synthétique de 36 aa inhibe efficacement la
fusion membranaire, en prévenant la formation du paquet à 6 hélices par les régions HR1 et
HR2 de la gp41 (Lalezari et al., 2003). L’inhibition du corécepteur CCR5 du VIH-1 constitue
une nouvelle approche thérapeutique. Trois molécules antagonistes du CCR5 ont été
développées dont le maraviroc (Pfizer) qui a obtenu l’autorisation de mise sur le marché
européenne. L’addition de ces molécules anti-CCR5 à une trithérapie a permis d’améliorer la
réponse antivirale. Cependant, la limitation des anti-CCR5 aux infections X5 tropiques peut
constituer un risque d’échec et d’émergence de la population X4 tropique préexistante (Shafer
and Schapiro, 2008). Il existe également des molécules anti-CXCR4 qui inhibent l’entrée des
virus X4 tropiques, tel que le d-APACs « arginine d6 and d 9 mers D-and L-arginine
peptides » (Hegde et al., 2007).
2-2- Inhibiteurs de la transcriptase inverse
La transcriptase inverse a été la première cible pharmacologique utilisée pour
combattre le VIH. Les analogues non hydrolysables de nucléosides, ZDV (Zidovudine), ddI
(Didanosine), ddC (Zalcitabine), 3TC (Lamivudine), d4T (Stavudine) et le TDF (Tenofovir)
sont des inhibiteurs de cette enzyme. Sous forme triphosphorylée, ils entrent en compétition
avec les nucléosides naturels et entraînent la terminaison de l’élongation de la chaîne d’ADN
(Jones and Bischofberger, 1995). Une autre famille d’inhibiteurs de l’étape de transcription
inverse sont les inhibiteurs non nucléosidiques de la transcriptase inverse (NNRTI), qui
inhibent la polymérisation de l’ADN en liant la RT (Spence et al., 1995). Le bon profil
pharmacocinétique de ces molécules, la bonne tolérabilité et le faible coût de cette classe de
médicaments, les rend extrêmement importants dans le traitement de l’infection. Parmi ces
NNRTI, on compte la névirapine (NVP), la delavirdine (DLV), et l’efavirenz (EFV).
61
2-3- Inhibiteurs de l’intégrase
Le meilleur composé actif in vitro reste la suramine qui inhibe les deux étapes de
l’intégration à des concentrations pratiquement stoechiométriques à celle de l’enzyme. La
suramine présentant six charges négatives se fixe par interactions électrostatiques sur la partie
N-terminale cationique de l’enzyme. Cette fixation perturbe la fixation non spécifique de
l’enzyme sur l’ADN viral in vitro (Bushman, 1995). Actuellement un nouvel inhibiteur
d’intégrase, la raltergravir, a été élaboré pour le traitement anti-VIH (Pace and Rowley, 2008).
Il faut noter que l’inhibition de l’intégration peut être obtenue in vitro par une stratégie
antisens, en ciblant les séquences polypurine / polypyrimidine des extrémités LTR par des
oligonucéotides formant des triples hélices.
2-4- Inhibiteurs de protéase
L’étape finale de maturation des virions implique une aspartyl-protéase virale qui clive
le précurseur Gag-Pol en des unités fonctionnelles. Les inhibiteurs peptidiques de protéases
comportent une séquence peptidique analogue au substrat naturel, mais possèdent un acide
aminé non hydrolysable (Hostetler et al., 1994). Cette classe inclue le saquinavir (SQV),
l’indinavir (IDV) et le ritonavir (RTV). L’acide betulinic (PA-457) inhibe le clivage
protéolytique au niveau du site du clivage de la protéine CA, générant des particules virales
immatures non infectieuses (Li et al., 2003). Il existe également des pistes de recherches sur
des inhibiteurs non peptidiques, de faible poids moléculaire, susceptibles d’inhiber la protéase
en perturbant sa structure tridimentionnelle.
La combinaison de deux ou trois antiviraux, appelée HAART (Highly Active
Antiretroviral Therapy), réduit la réplication virale à des niveaux indétectables dans le sang et
dans les réservoirs lymphatiques, augmente le nombre de cellules T CD4+ et permet la
reconstitution partielle des fonctions immunes et une diminution de l’incidence des maladies
opportunistes. Cependant, la résistance du VIH-1 aux antirétroviraux reste le problème majeur
du traitement anti-VIH.
62
2-5- Les vaccins anti-VIH
Au même titre que les autres maladies infectieuses, la meilleure approche pour
contrôler la propagation du SIDA consiste à développer un vaccin empêchant l’établissement
de l’infection par le VIH-1 chez l’hôte. Malgré d’intenses recherches biomédicales et des
études cliniques encourageantes, aucun vaccin anti-VIH n’a encore été mis au point (Emini
and Koff, 2004; Ho and Huang, 2002; McMichael and Hanke, 2003). En effet, le
développement d’un vaccin fait face à de nombreux obstacles : La variabilité du virus, le
mode de contamination et l’absence de modèle animal satisfaisant reproduisant exactement la
physiopathologie de la maladie chez l’Homme.
Les approches privilégiées à l'heure actuelle dépendent de la production d'anticorps, de
la stimulation des cellules T CD8+, ou des deux, dans l'espoir que ces réponses immunitaires
puissent prévenir l'infection à VIH-1. Cependant, la conception de puissants immunogènes à
partir domaines structuraux essentiels des protéines virales (gp120, gp41, p24 et p17) est
difficile et ne procure qu’une protection partielle à cause de la variabilité structurale de ses
protéines au cours de la réplication (Emini and Koff, 2004; Ho and Huang, 2002; McMichael
and Hanke, 2003). La seconde approche visant l’induction d’une forte réponse immune
cellulaire antivirale, à l’aide de vaccins de SIV atténués, s’est avérée protectrice chez le singe.
Cependant, une telle stratégie vaccinale n’est pas envisageable chez l’humain. Les chercheurs
ont actuellement recours à des vaccins ADN ou à des virus autres que le VIH, notamment le
virus de la vaccine, le canarypox, l’adénovirus, les alphavirus ou le virus de la stomatite
vésiculaire atténués, comportant des protéines du VIH-1. Chez le macaque, de tels vaccins
permettent de contrôler la virémie, de même que la progression de la maladie, mais ne
bloquent pas l’infection proprement dite (Emini and Koff, 2004; Ho and Huang, 2002;
McMichael and Hanke, 2003).
De plus, l’immunité adaptive a besoin de temps pour consolider ses défenses contre les
microbes envahissants. Or, on aura besoin d'une réponse très rapide, se déclenchant après à
peine quelques minutes ou heures, si on espère maîtriser le VIH-1 dans les parties du corps les
plus susceptibles de le rencontrer lors de la primo-infection, soit les muqueuses. Ainsi, une
des options envisagées pour contrer le VIH-1 est de favoriser la réponse immune innée de
l’organisme puisque c’est là la première défense de l’hôte face à un envahisseur (Emini and
Koff, 2004; Ho and Huang, 2002; McMichael and Hanke, 2003).
63
Figures 29: Régulation de l’équilibre TH1/TH2
Modifiée d’après Kuby, J., 2003
Immunology
64
III- DEREGULATION DU RESEAU DE CYTOKINES
PENDANT L’INFECTION VIH-1
Dès la primo-infection, une modification de l’équilibre des cytokines a été observée.
Certaines cytokines sont davantage produites alors que d’autres sont inhibées (Poli et al.,
1995). In vitro, certaines de ces cytokines semblent influencer de manière positive, négative
ou bidirectionnelle la réplication de VIH-1 dans différents modèles cellulaires (Kedzierska et
al., 2003). Cette dérégulation de l’équilibre de cytokines est largement impliquée d’une part
dans le contrôle de la réplication virale et d’autre part dans l’orientation de la réponse immune
plutôt vers un profil TH2, plus favorable à l’établissement d’une infection chronique de l’hôte
(Emilie et al., 1994a; Graziosi et al., 1994; Klein et al., 1997).
Ainsi, la progression vers le stade SIDA est caractérisée par une perte de la production
d’IL-2 et d’IFN-γ et d’une augmentation de la production d’IL-4 et d’IL-10 (Clerici and
Shearer, 1993). La production de cytokines inflammatoires, comme l’IL-1β, le TNF-α et l’IL6, est aussi augmentée. Cependant, ces études ont été réalisées essentiellement in vitro et sur
un panel de cytokines limité. D’autres groupes semblent privilégier une transition TH1/TH0
lors de l’évolution de l’infection. TH0 qui secrètent à la fois l’IL-2, IL-4, IL-10, IL-5 et IFNγ. Cette dérégulation du réseau de cytokines participe largement à la physiopathologie de
l’infection à VIH-1 en agissant sur la réplication virale, l’inactivation du système
immunitaire, l’induction de l’apoptose et la neurotoxicité. Certains individus VIH+, dits
« non-progresseurs », semblent contrôler efficacement la virémie grâce à une réponse immune
efficace. Chez ces individus, on retrouve un équilibre des réponses TH1/TH2 (Imami et al.,
2002) (Fig. 29).
1- LES CYTOKINES PROINFLAMMATOIRES
1-1- L'interleukine-1
L’IL-1 comprend normalement deux protéines, IL-1α et IL-1β, cytokines de 15-17
kDa possédant les mêmes propriétés biologiques alors qu’elles ne présentent que 27%
d’homologie (Dinarello, 2002). Récemment, des molécules homologues de l’IL-1 ont été
caractérisées : IL-18 et IL-33 constituant ensemble la superfamille de l’IL-1 (Sims, Towne,
65
and Blumberg, 2006). Plusieurs gènes des membres de la famille IL-1 sont localisés sur le
chromosome 2, sauf l’IL-18 qui se situe sur le chromosome 11.
L’IL-1α et IL-1β sont produits par une grande variété de cellules (monocytes,
lymphocytes, kératinocytes, neutrophiles…). Leur production par les monocytes est induite
par le LPS des bactéries gram négatif (Dinarello, 1997). L’IL-1α et IL-1β se lient à deux
récepteurs cellulaires distincts, de la superfamille des immunoglobulines, présents à la surface
de plusieurs types cellulaires ; l’IL-1RI et l’IL-1RII. Seul l’IL-1RI est fonctionnel, tandis que
l’IL-1RII a pour rôle de limiter l’action de l’IL-1.
L’IL-1 joue un rôle important dans l’inflammation induisant l’expression des
molécules d’adhésion et la sécrétion de chimiokines par les cellules endothéliales. Dans les
macrophages et la lignée U1 chroniquement infectée par le VIH-1, l’IL-1 stimule la
réplication du virus (Granowitz et al., 1995; Poli, Kinter, and Fauci, 1994). Cet effet est dû à
l’activation du facteur de transcription NF-κB (Alfano and Poli, 2002). Cet effet stimulant sur
la réplication du VIH-1 peut être bloqué par des anticorps monoclonaux dirigés contre l’IL-1
(Poli, Kinter, and Fauci, 1994).
1-2- L'interleukine-6
L'IL-6, est produite par les fibroblastes, les cellules endothéliales, les kératinocytes,
les astrocytes et les lymphocytes T et B, suite à l’activation par l’IL-1 ou le TNF. La
production de l’IL-6 par les monocytes peut être induite par le LPS, l’IL-1α le TNF-α, l’IFNγ et le GM-CSF, et bloquée par les glycocorticosteroides. L’IL-6 est une protéine de 22-27
kDa (186 aa), monomérique, N-glycosylée. Le gène IL-6 est localisé sur le brin court du
chromosome 7.
Le récepteur IL-6 est constitué d’une chaîne de liaison IL-6Ra et une chaine dite de
conversion d’affinité, IL-6Rb connue aussi sous le nom de gp130. La liaison de l’IL-6 à son
récepteur active la voie de signalisation JAK-STAT.
Cette cytokine proinflammatoire possède un large spectre d’activités parmi lesquelles
la stimulation des lymphocytes B, la différenciation des macrophages et la différentiation des
cellules T productrices d’IL-4 (Rincon et al., 1997). Lors d’une infection, une inflammation
ou d’une lésion tissulaire, on assiste à une forte production de l’IL-6 dans le sérum des
66
patients. L’IL-6 potentialise la stimulation de la réplication du VIH-1 dans les macrophages et
les cellules de la lignée U1 (Poli et al., 1990a; Poli and Fauci, 1992).
1-3- Tumor Necrosis Factor α (TNF-α)
C’est une cytokine inflammatoire partageant de nombreuses propriétés avec l’IL-1 et
l’IL-6. Le terme TNF recouvrait initialement deux substances : le TNF-α dont les
macrophages représentent une source importante mais produit également par de nombreuses
autres cellules endothéliales, fibroblastes, keratinocytes et astrocytes. Le TNF-β ou
lymphotoxine a (LTa) est lui produit surtout par les lymphocytes T, B et les cellules NK. Ces
deux molécules sont en fait les mêmes effets biologiques et se lient aux mêmes récepteurs.
Le TNF-α et la LTa appartiennent à une grande famille regroupant : FasL, CD40L, CD30L
RANKL, TRAIL et bien d’autres molécules.
1-3-1- Caractérisation génétique et moléculaire du TNF-α
Le gène du TNF-α est présent en une seule copie d’environ 3 Kb, précédée de celle du
TNF-β sur le bras court du chromosome 6 humain (Spriggs, Deutsch, and Kufe, 1992). Il est
constitué de 4 exons interrompus par 3 introns. Plus de 80 % de la séquence du TNF-α mature
est codée par le quatrième exon, alors que les exons I et II contiennent presque entièrement la
séquence du peptide leader. La région promotrice du gène du TNF-α contient plusieurs
séquences activatrices homologues à κB et une « Y-box » semblable à celle présente dans les
gènes du CMH classe II (Shakhov et al., 1990) qui semblent être impliquées dans l’activation
de la transcription. L’expression du TNF-α est aussi régulée au niveau traductionnel grâce à
une séquence riche en nucléotides UA située dans la région 3’ non traduite de l’ARNm.
Le TNF-α existe sous deux formes, soluble ou membranaire, chacune possédant des
rôles physiologiques distincts (Beyaert and Fiers, 1994; Watts et al., 1997). Le TNF-α est
exprimé sous forme d’un précurseur de 157 aa, précédé d’un pro-segment de 76 acides
aminés. Ce pro-segment est hautement conservé et semble servir à ancrer le polypeptide
précurseur à la membrane (Vilcek and Lee, 1991). A l’inverse du TNF-β, qui est sécrété, le
TNF-α est d’abord produit sous forme d’une protéine membranaire de type II. Les acides
aminés –44 à –26 du pro-segment contiennent la région transmembranaire hydrophobe et les
résidus –76 à –50 constituent la région intracytoplasmique. La protéine non-clivée a une
67
masse moléculaire de 26 kDa et est clivée en une protéine active de 17 kDa par une
métalloprotéinase. Le TNF-α mature forme des homotrimères de 52 kDa en solution qui
pourront se lier à leurs récepteurs. Le TNF-α humain se lie fortement à son récepteur avec des
constantes de dissociation d’environ 0,5 et 0,1 nM respectivement pour le TNF-R1 et le TNFR2.
Le TNF-α est produit par une grande variété de cellules hématopoïétiques et nonhématopoïétiques, malignes et non-malignes comme les macrophages, les lymphocytes T
CD4+ et CD8+, les lymphocytes B, les cellules NK, les neutrophiles, les astrocytes, les
cellules endothéliales, les cellules musculaires lisses, et un certain nombre de lignées
tumorales non-hématopoïétiques (Vilcek and Lee, 1991).
1-3-2- Récepteurs du TNF-α
Le grand spectre d’action du TNF-α est dû à la présence de ses récepteurs dans
presque toutes les cellules nucléées. Deux récepteurs membranaires ont été identifiés : TNFR1 (nommées aussi TNF-R55, TNFRSF1A, TNFR60 ou CD120a) et TNF-R2 (nommées
aussi TNF-R75, TNFRSF1B, TNFR80, p80 ou CD120b). Les deux récepteurs sont
typiquement des protéines transmembranaires, avec des domaines extra- et intracellulaires de
taille identique et un simple domaine transmembranaire. Le gène du TNF-R1, localisé sur le
chromosome 12p13, code pour 455 aa (55-60 kDa). Le gène du TNF-R2 code pour 461 aa
(70-80 kDa) et est localisé sur le chromosome 1p36. La différence de poids moléculaire entre
les deux récepteurs s’explique par la variation de glycosylation. Les deux récepteurs
membranaires peuvent être protéolytiquement clivés par les metalloprotéinases, libérant leurs
domaines extracellulaires respectifs. Ces derniers se comportent alors comme des « binding
proteins » inhibant les effets biologiques du TNF ; cette propriété inhibitrice ouvre des
perspectives thérapeutiques. La signalisation TNF-α et LTa solubles passe par le TNF-R1,
alors que la stimulation des cellules par la forme transmembranaire du TNF par contact
cellulaire, active la signalisation via les deux récepteurs TNF, ce qui aboutit à des réponses
cellulaires quantitativement et qualitativement différentes (Wajant, Pfizenmaier, and
Scheurich, 2003).
68
Figure 30: Signalisation TNF-α
Modifiée d’après Ramenda N. Saha et al., 2007
Journal of Neurochemestry
69
1-3-3- Signalisation du TNF-α
La multimérisation des récepteurs, après liaison de leurs ligands, leur permet de
s’associer à des protéines intracytoplasmiques (Loetscher et al., 1991; Schoenfeld et al.,
1991), ce qui aboutit de façon complexe soit à l’activation de protéases impliquées dans
l’apoptose, tels que les caspases, soit à la mise en jeu des voies MAP kinases et NF-κB par
une voie commune à celle induite par l’IL-1 (Fig. 30). En effet, les récepteurs au TNF-α
possèdent des domaines intracellulaires « Death Domain », domaines d’interaction protéique
de 65-80 acides aminés qui participent à l’induction de l’apoptose par le TNF-α. Le « Death
Domain » de TNF-R1 se lie à un adaptateur grâce à des protéines adaptatrices comme
TRADD « TNF-R associated death domain protein » et à une sérine thréonine kinase RIP
« receptor interacting kinase » 1. Ces derniers à leur tour, recrutent les protéines FADD
« Fas-associated death domain protein », caspase 8 (une cystéine protéase), TRAF2 « TNF
receptor-associated factor » et le complexe signalosome IκB-kinase (voir partie NF-κB)
(Ashkenazi and Dixit, 1998; Ashkenazi and Dixit, 1999; Dempsey et al., 2003). Depuis
l’identification des deux voies (apoptose et survie cellulaire), leur régulation est restée
longtemps inconnue. Ce n’est que récemment que la formation de deux complexes alternatifs
de signalisation par TNF-R1 a été identifiée. Le premier (complexe I), est formé au niveau
de la membrane plasmique après l’interaction récepteur/ligand et est ultérieurement
internalisé via des vésicules de clathrine pour former le deuxième complexe (complexe II ou
réceptosome) (Micheau and Tschopp, 2003; Schneider-Brachert et al., 2004). Le complexe I
induit l’activation d’une voie de signalisation anti-apoptotique, alors que le complexe II est
responsable de la mort cellulaire.
Le trimère de TNF-α peut subir, à un faible pH et en absence de fixation au récepteur,
un changement conformationel qui, lui, permet d’agir comme un canal ionique (Baldwin et
al., 1996; Kagan et al., 1992).
1-3-4- Rôles biologiques du TNF-α
Le TNF-α possède des propriétés anti-tumorales (Aggarwal, 1991; Liu et al., 2004)
notamment en association avec l’interféron (Gruss and Dower, 1995). Une telle combinaison
peut guérir des tumeurs agressives non-immunogéniques dans des modèles animaux (Che et
70
al., 1998). L’effet anti-tumoral du TNF-α observé in vivo dans des modèles de souris et des
essais cliniques chez l’Homme, ne semble pas être dû à son action cytotoxique directe (Corti,
2004).
Le TNF-α joue de nombreux rôles thérapeutiques. Ainsi, il semble jouer un rôle
crucial dans la résistance aux infections parasitaires, bactériennes et virales. Il pourrait
contribuer à la résistance contre l’infection grâce à l’activation des neutrophiles et des
plaquettes, à l’augmentation des activités cytotoxiques des macrophages/cellules NK, et à la
stimulation du système immunitaire (Idriss and Naismith, 2000). Cependant, ces infections
peuvent devenir plus sévères voire fatales suite à la circulation de quantités trop importantes
de TNF-α dans l’organisme. Le TNF-α est aussi impliqué dans un certain nombre de réactions
auto-immunes comme celle contre le greffon et la polyarthrite rhumatoïde (Beutler and
Bazzoni, 1998; Beutler, 1999).
Enfin, l’accumulation et la persistance du TNF-α durant les infections parasitaires et
les cancers, induit un « shift » vers le catabolisme des lipides associé à une
hypertriglycéridémie (Branschädel, 2007). Ceci entraîne un syndrome de cachexie caractérisé
par l’anorexie, la perte de poids et la déplétion des ressources de lipides et de protéines.
1-3-5- TNF-α et VIH
a- Le TNF-α module le cycle viral
Le TNF-α cible principalement deux étapes du cycle viral : l’entrée et la transcription.
Des études ont montré que le TNF-α inhibe l’entrée du VIH-1 dans les macrophages, mais pas
dans les lymphocytes du sang périphérique suite à son interaction avec le récepteur TNFR-2
(Herbein, Montaner, and Gordon, 1996). En fait, cette interaction déclenche la sécrétion de
GM-CSF, une cytokine connue pour bloquer l’entrée des souches R5-tropiques (infectant
principalement les monocytes/macrophages) via une régulation négative de l’expression du
corécepteur CCR5 (Herbein, Montaner, and Gordon, 1996; Sallusto et al., 1998). De plus, le
TNF-α pourrait bloquer l’entrée du VIH-1 en diminuant l’expression du récepteur CD4 et en
induisant la production de CC chimiokines (Hornung, Scala, and Lenardo, 2000;
Schmidtmayerova, Sherry, and Bukrinsky, 1996). A l’opposé, l’interaction du TNF-α avec le
récepteur TNFR-1 induit l’activation du facteur de transcription NF-κB et stimule ainsi la
transactivation du promoteur LTR du virus (Duh et al., 1989; Osborn, Kunkel, and Nabel,
71
1989; Poli et al., 1990b). Ainsi, lors d’infections opportunistes, les macrophages tissulaires,
stimulés par le TNF-α, augmentent fortement leur production de virus (Orenstein, Fox, and
Wahl, 1997). Donc, au cours d’infections opportunistes chez des individus infectés par le
VIH-1, le TNF-α pourrait agir en confinant la production virale aux macrophages déjà
infectés.
b- Le TNF-α est impliqué dans la mort des lymphocytes T sains
La progression de l’infection par le VIH-1 est caractérisée par une déplétion
progressive des lymphocytes T CD4+, mais aussi, à un stade plus tardif, des lymphocytes T
CD8+ (Fauci, 1993). Cette déplétion des lymphocytes T ne peut pas être expliquée par le seul
effet lytique du virus sur ses cellules cibles. La formation de syncitia, l’auto-immunité, les
réponses immunes de l’organisme contre le virus et enfin des processus d’apoptose pourraient
être impliqués. Le nombre de lymphocytes T infectés étant relativement faible, l’apoptose
touche en majorité les lymphocytes T non infectés. Cette apoptose est notamment induite par
l’interaction Fas/FasL, mais aussi par l’interaction TNF/TNFR (Badley et al., 1997; Badley et
al., 1996). L’apoptose des lymphocytes T CD4+ induite par l’antigène pourrait être provoquée
par le TNF-α mais aussi par d’autres membres de la même famille. L’apoptose des
lymphocytes T CD8+, quant à elle, semble être induite par l’interaction TNF-α/TNFR-2 mais
pas par Fas/FasL (Herbein et al., 1998). Cette interaction déclenche la mort des lymphocytes
T CD8+ par les macrophages comme conséquence de l’activation immune observée chez des
patients infectés par le VIH-1, surtout au stade tardif de la maladie.
Puisque les lymphocytes T CD8+ limitent la dissémination de l’infection par leur
activité cytotoxique et/ou la libération de facteurs solubles, la déplétion des lymphocytes T
CD8+ contribue à l’évolution vers le stade SIDA.
c- TNF-α et démence associée au VIH-1 (HAD)
La démence associée au VIH-1 (HAD) fait référence à une atteinte neurologique
sévère observée chez environ 20% des patients souffrant du SIDA (Adle-Biassette et al.,
1999; Kolson and Gonzalez-Scarano, 2000). Cette démence est identifiée par l’infiltration des
cellules inflammatoires dans le système nerveux central, une gliose et une apoptose neuronale
(Saha and Pahan, 2003). Cependant, le virus n’infecte pas les neurones et n’est pas
72
directement cytotoxique. Le TNF-α serait ainsi impliqué dans les désordres neurologiques en
raison de ses effets toxiques sur les neurones, les oligodendrocytes et les astrocytes (Larrick
and Wright, 1990; Saha and Pahan, 2003; Wright et al., 1988). En effet, de grandes quantités
de TNF-α sont présentes dans le cerveau de patients infectés par le VIH à des stades avancés
de la maladie (Talley et al., 1995).
2- LES CYTOKINES ANTI-INFLAMMATOIRES
2-1- L'interleukine-2
L’IL-2 est une cytokine de 14-15 kDa, produite par les lymphocytes T CD4+, les
lymphocytes T CD8+ et par les cellules NK après stimulation par un mitogène ou antigène
(Granucci et al., 2001; Granucci et al., 2003). Elle stimule la prolifération des lymphocytes T
CD4+ et CD8+ (Waldmann, 2000), l’activation des lymphocytes B et augmente l’activité
cytotoxique des lymphocytes T CD8+ et des cellules NK. Par conséquent, l’IL-2 joue un rôle
majeur dans l’élimination des organismes intracellulaires et le contrôle des infections virales
(Brinchmann, 2000; Napolitano, 2003).
Cependant, chez les individus VIH+, la production d’IL-2 est déficiente (Ahmad et al.,
2003 ; Honda et al., 1989; Klein et al., 1997). Les travaux de Levy et al., ont montré que
l’injection intermittente d’IL-2 par voie sous-cutané, en association avec les trithérapies,
induit une expansion du nombre de lymphocytes T CD4+ naïfs et mémoires chez les individus
VIH+. De plus, l’IL-2 augmente l’expression de CD28 et CD25 sur les lymphocytes et les
cellules NK (Levy et al., 2003). Cependant, une étude récente a montré que l’administration
continue de l’IL-2 en combinaison avec une trithérapie, donnait de meilleurs résultats,
statistiquement significatifs chez toutes les populations étudiées (Healey et al., 2008). Une
autre cytokine l’IL-7, dont le taux est généralement plus élevé chez les individus VIH+, a été
utilisée en complément de la trithérapie et semble plus efficace que l’IL-2 pour réactiver le
virus latent et augmenter l’activation des lymphocytes T mémoires (Wang et al., 2005).
73
2-2- L’interleukine-12
L’IL-12 est un héterodimère de 75 kDa, glycosylé, composé d’une chaîne lourde de 40
kDa (p40) liée par des ponts disulfures à une chaîne légère de 35 kDa (p35). L’IL-12p35 et
IL-12p40 sont codées par les gènes IL-12A et IL-12B, localisés sur le chromosome 3p12 et
5q31 respectivement (Gately et al., 1998).
L’IL-12 est sécrétée par les cellules présentatrices d’Ag (Cellules dendritiques et
monocytes/macrophages) et les cellules polynucléaires (Sartori et al., 1997; Trinchieri, 1998a;
Trinchieri, 1998b). La sécrétion de l’IL-12 est hautement régulée, particulièrement au niveau
transcriptionnel ; p35 est produite de manière ubiquitaire, alors que p40 est inductible. La
production de l’IL-12 est induite par différents stimuli microbiens, ou par l’IL-12 lui-même.
La protéine p17 de matrice du VIH-1 induit la production d’IL-12 par des cellules NK
purifiées (Vitale et al., 2003) tandis que les protéines Nef et p55 Gag sont internalisées par les
cellules dendritiques immatures et induisent la sécrétion d’IL-12 et la maturation de ces
cellules (Quaranta et al., 2003; Tsunetsugu-Yokota et al., 2003). Cependant, une altération de
la production d’IL-12 in vitro par les PBMC d’individus VIH+ a été décrite (Daftarian et al.,
1995; Marshall et al., 1999).
Bien que l’ajout d’IL-12 à des lymphocytes T et des cellules NK in vitro a montré une
restauration des capacités prolifératrices et de production d’IFN-γ (Poaty-Mavoungou et al.,
2002), les essais cliniques utilisant l’IL-12 recombinant en combinaison avec une trithérapie
n’ont eu aucun effet sur la charge virale ou le nombre de lymphocytes T des individus VIH+
(Jacobson et al., 2002). Enfin, des études récentes ont montré que l’IL-12 joue un rôle crucial
dans le développement et la maintenance des lymphocytes TH1 (Alber et al., 2006).
2-3- Les interférons
On distingue au moins deux types d’interférons (IFN) : les interférons de type I (α ou
β), et l’interféron de type II (γ). L’IFNα régule de nombreuses réponses immunes comme la
production d’anticorps, l’augmentation de la cytotoxicité des lymphocytes T et des cellules
NK, l’inhibition des lymphocytes T suppresseurs et l’immunité anti-tumorale (Belardelli et
al., 2002; Belardelli and Gresser, 1996). L’IFNγ (20-25 kDa), quant à lui, est un produit des
lymphocytes T et des cellules NK activées. Il induit l’augmentation de l’expression des
74
molécules de CMH classe I et II, active les macrophages, augmente l’activité des cellules NK
et co-stimule la croissance et la différenciation des lymphocytes B.
L’IFN de type I stimule l’expression des gènes codant pour des protéines aux
propriétés antivirales et pro-apoptotiques (de Veer et al., 2001). L’IFNα, en particulier,
inhibe de nombreuses étapes de la réplication du VIH-1, comme la transcription inverse ou
l’expression du génome viral dans des cellules primaires infectées ou chez des souris SCID
reconstituées avec de la moelle osseuse humaine (Lapenta et al., 1999; Popik and Pitha, 2000;
Weiden et al., 2000). De plus l’IFNα inhibe l’angiogenèse dans le sarcome de Kaposi (Albini
et al., 2000; Marchisone et al., 1999). L’IFNα est utilisé en combinaison avec une trithérapie
antivirale, pour le traitement du sarcome de Kaposi associé au SIDA (Krown et al., 2006).
L’IFN-γ possède une large activité antivirale, antiproliférative et immunomodulatrice
capable d’inhiber l’infection virale de manière non spécifique (Le Page et al., 2000). L’IFN-γ
inhibe la réplication du VIH-1 dans les macrophages. En effet, l’IFN-γ inhibe l’entrée virale
probablement via la diminution d’expression de surface des CD4, bien qu’il permette
l’expression du CCR5 et CCR3 utilisés par les virus M-tropique (Dhawan et al., 1995;
Hariharan et al., 1999). L’IFN-γ semble réduire la production du VIH en inhibant la voie
JAK/STAT dans la lignée U937 (Bovolenta et al., 1999). Cependant, la stimulation des
cellules U1, chroniquement infectées, par l’IFN-γ active significativement la réplication virale
(Biswas et al., 1992).
2-4- L'interleukine-4
L’IL-4 est une cytokine produite principalement par les lymphocytes T helper (Th2) et
les cellules T mémoires. L’IL-4 est une protéine monomérique N-glycosylée, de 129 aa,
contenant trois ponts disulfures internes, responsables d’une structure en 4 hélices similaire à
celle du GM-CSF. Le gène IL-4 est localisé sur le chromosome 5 et lié aux gènes codant pour
l’IL-3, IL-5 et le GM-CSF.
L’IL-4 antagonise l’effet de l’IFN-γ. En revanche, elle semble avoir un effet
synergique avec l’IL-2 pour induire la prolifération des lymphocytes T. Suite à l’activation
des cellules dendritiques via des TLR « Toll-Like Receptors », les lymphocytes T naïfs
sécrètent de l’IL-4 qui agit comme facteur de croissance autocrine pour la stimulation et
l’expansion des lymphocytes de type TH2 (von der Weid et al., 1996), produisant les
75
interleukines 4, 5 et 6 (Paul, 1997). Dans l’infection par le VIH, des travaux contradictoires
ont été décrits concernant la production de l’IL-4 et son rôle dans la réplication virale (Clerici
et al., 1993; Emilie et al., 1994b; Graziosi, Pantaleo, and Fauci, 1994; Maggi et al., 1994).
Cependant, l’IL-4 semble jouer un rôle essentiel dans le « switch » de phénotype du VIH des
virus CCR5-tropiques vers les virus CXCR4 tropiques, observé chez 50% des patients
infectés par les virus du groupe B (Galli et al., 1998; Wang et al., 1998).
2-5- L'interleukine-10
L’IL-10 est une cytokine pléotropique produite par les cellules T et B, les monocytes
/macrophages, les mastocytes et les kéranocytes. Une molécule d’IL-10 biologiquement
fonctionnelle est un dimère de 36 kDa qui consiste en une longue chaine polypeptidique
de160 acides aminés (Tan et al., 1993; Windsor et al., 1993). Plusieurs homologies de
séquences ont été retrouvées entre les gènes IL-10 viraux et cellulaires (Dumoutier and
Renauld, 2002; Kotenko, 2002). En effet, des homologues viraux ont été retrouvés chez le
virus d’Epstein-Barr (EBV) (Moore et al., 1990; Vieira et al., 1991), l’Herpes simplex type 2
équin (Rode et al., 1993) et les cytomégalovirus (CMV) humain et simien (Kotenko et al.,
2000; Lockridge et al., 2000). Cependant, les homologies de séquences en acides aminés de
ces protéines par rapport à l’IL-10 humain, varient de 23% à 85%. Les IL-10 virax utilisent
tous le système des récepteurs IL-10, et semblent être sous forme de dimères ayant une
structure tridimensionnelle similaire à l’IL-10 humain. Les homologues cellulaires incluent
l’IL-19 (Gallagher et al., 2000), IL-20 (Blumberg et al., 2001), IL-22 (Dumoutier et al., 2000;
Xie et al., 2000), IL-24 (Jiang et al., 1996) et IL-26 (Knappe et al., 2000), mais qui ont tous
une très faible homologie de séquence en acides aminés avec l’IL-10 cellulaire. La plupart
sont des monomères à l’exception de l’IL-26 qui semble être sous forme de dimères. Certains
polymorphismes ont été décrits pour le promoteur IL-10, qui seraient liés à certaines maladies
auto-immunes, cancers, allergies, Alzheimer, diabète…et d’autres.
2-5-1- Les récepteurs de l’IL-10
Le récepteur de l’IL-10 est composé d’au moins deux sous-unités de la famille des
récepteursà l’IFN-γ, IL-10R1 et IL-10R2. L’IL-10 se lie d’abord à l’homodimère IL-10R1
76
Figure 31: IL-10 et réponse immunitaire
Listeria, Mycobacterium,
Salmonella,Chlamydia,
Streptococcus, Staphylococcus
Candida, Cryptococcus,
Aspergillus
HIV, HCV
Leishmania, Toxoplasma, Plasmodium
Homologue viral
d’IL-10
EBC, CMV, Orf
IL-10
Réponses Th1
CM1
Réponses Th2
Anticorps
Présentation d’Ag
Inhibition de:
-Molécules costimulatrices (B7-2)
- CMH-II
- Cytokines inflammatoires
(IL-1, IL-2, IL-6, IL-12, TNF-α)
- O2 réactif et N2 intermediaire
Réponse Th
Développement de la maladie
Modifiée d’après Kryworuchko, W., et al., 2006;
Medical intelligence unit
77
pour lequel elle possède une grande affinité (35<Kd<200pM) (Liu et al., 1994), formant le
site de liaison du second récepteur. La liaison subséquente à l’IL-10R2 complète le complexe
de signalisation ternaire (Kotenko et al., 1997) et transduit le signal reçu par la sous-unité IL10R1 (Kotenko et al., 1997; Spencer et al., 1998). L’IL-10R2 est un récepteur de faible
affinité (Kotenko et al., 1997; Spencer et al., 1998),
il est ainsi difficile d’obtenir un
complexe ternaire stable capable de cristalliser. En revanche, un complexe intermédiaire IL10 / IL-10R1 est très stable. En solution, l’IL-10 et l’IL-10R1 soluble (sIL-10R1) forment un
complexe de deux dimères IL-10 et quatre sIL-10R1 (Hoover et al., 1999; Tan et al., 1995).
Le domaine cytoplasmique de l’IL-10R contient deux motifs préalablement connus
comme des unités de transduction de signal du récepteur IL-6, et qui sont responsables de
l’activation de STAT3 « signal transducer of activated T cells » (Ding and Shevach, 1992).
En effet, l’engagement de l’IL-10R induit l’activation de STAT3 et STAT1 mais pas STAT5.
Une étude a montré que seul STAT3 est directement recruté au récepteur IL-10 activé, via des
domaines phospho-tyrosine intracellulaires (Ho and Moore, 1994).
2-5-2- Les effets de l’IL-10 sur l’immunité innée et adaptative
Les effets de l’IL-10 sur l’immunité innée ont été étudiés chez les souris dans
plusieurs modèles infectieux, incluant les bactéries, les champignons, et les pathogènes
protozoaires (L. monocytogenes, C. albicans et T. gondii). Le rôle de l’IL-10 dans les modèles
de maladies infectieuses a été généralement étudié par l’administration de l’IL-10
recombinant (rIL-10), en bloquant ses effets par des anticorps anti-IL-10 neutralisants, ou en
utilisant les souris IL-10-/- créés par des délétions ciblées. Les réponses observées sont
dépendantes du niveau d’expression des récepteurs IL-10 et de la signalisation induite. Dans
les modèles L. monocytogenes, l’administration de l’IL-10 abolit la résistance innée des
souris SCID à cette bactérie (Kelly and Bancroft, 1996; Tripp, Beckerman, and Unanue,
1995). Par ailleurs, il a aussi été rapporté que les souris déficientes pour le gène de l’IL-10 ou
traitées avec des anticorps monoclonaux anti-IL-10 contrôlent mieux l’infection par L.
monocytogenes (Dai, Kohler, and Brombacher, 1997).
L’IL-10 peut avoir des effets stimulateurs ou inhibiteurs sur les cellules immunitaires
(Fig. 31), mais qui tendent tous à inhiber le processus inflammatoire et la réponse
immunitaire spécifique : i) alors que l’administration de l’IL-10 peut induire une anergie des
cellules T CD4+ antigène spécifique à long terme (Moore et al., 2001), elle peut également
78
induire l’activation des cellules NK et faciliter la destruction des cellules cibles d’une manière
dose dépendante. In vivo, la prolifération des cellules NK n’est pas affectée en présence de
l’IL-10 alors que leur fonction cytotoxique est fortement activée (Cavaillon, 2001; Mocellin
et al., 2003; Moore et al., 2001) ; ii) Les CD4+ naïves sont la cible majeure de l’IL-10, alors
que les CD4+ activées ou mémoires semblent y être insensibles (Asadullah, Sterry, and Volk,
2003) ; iii) L’IL-10 augmente les réponses prolifératives des cellules T CD8+ cytotoxiques
induites par l’IL-2 et IL-4 (Cohen et al., 1997b; Taga, Cherney, and Tosato, 1993) ; iv) L’IL10 augmente l’expression des CCR1, CCR2 et CCR5 dans les monocytes, les rendant plus
sensibles aux facteurs chémotractants et donc plus susceptibles à l’infection VIH (Sozzani et
al., 1998). L’IL-10 augmente par ailleurs l’activité phagocytaire des monocytes/ macrophages
et des CD immatures via l’augmentation de l’expression des IgG-Fc récepteurs (CD16, CD32
et CD64), en revanche elle diminue l’expression du TLR4 (Muzio et al., 2000).
2-5-3- L’IL-10 chez les patients VIH+
a- Effet immunosuppresseur
Chez les patients VIH+, on observe, dès le stade asymptomatique, une augmentation
progressive de la production de l’IL-10 dans le sérum (Kedzierska and Crowe, 2001 ;
Stylianou et al., 1999). Cette augmentation est associée à un dysfonctionnement du système
immunitaire qui se caractérise par la perte de la capacité des lymphocytes T CD4+ à proliférer
suite à la stimulation par un mitogène ou un antigène de rappel. En effet, les travaux de
Clerici et al., ont montré que les cellules T CD4+ des patients au stade asymptomatique
commencent par perdre la capacité à proliférer suite à la stimulation par un antigène
spécifique mais continuent à répondre à des mitogènes. Au stade SIDA, même cette
prolifération en réponse aux mitogènes est perdue (Clerici et al., 1989). En revanche, la
réponse des cellules T peut être restaurée en présence d’anticorps anti-IL-10, ce qui suggère le
rôle de cette cytokine dans l’anergie des cellules T CD4+ et l’évolution de la maladie (Clerici
et al., 1994; Kumar et al., 1998). En effet, en comparaison avec les patients dits non
progresseurs, de fortes concentrations de l’IL-10 ont été retrouvées dans le sérum des patients
ayant développé le SIDA (Muller et al., 1998a; Muller et al., 1998b). Cette production est
significativement réduite chez les patients bénéficiant d’une trithérapie (Ostrowski et al.,
79
2001; Stylianou et al., 1999). Cependant, un travail plus récent ne semble pas montrer de
corrélation directe entre la production de l’IL-10 et la non progression de la maladie chez les
patients portant l’allèle IL-10 1082G (Erikstrup et al., 2007). En effet, chez ces patients,
malgré l’augmentation du taux d’IL-10, ils ne semblent pas développer rapidement le SIDA
(Erikstrup et al., 2007).
b- IL-10 et réplication du VIH
L’effet de l’IL-10 sur la réplication virale est très controversé. La plupart des travaux
effectués abondent en faveur d’un effet inhibiteur de l’IL-10 sur la réplication virale (Akridge,
Oyafuso, and Reed, 1994; Masood et al., 1994; Saville et al., 1994). Ainsi, l’IL-10 augmente
l’expression de CCR5 au niveau des monocytes/macrophages (Sozzani et al., 1998; Wang et
al., 2002a), mais bloque la réplication des virus R5-tropiques à une étape postérieure à
l’entrée du virus (Wang et al., 2002b). En revanche, l’IL-10 inhibe à la fois l’expression de
CCR5 et la réplication des virus R5 dans les lymphocytes T CD4+ (Patterson et al., 1999).
Des expériences de co-cultures, qui miment le microenvironnement des tissus
lymphoïdes, ont par ailleurs montré que l’IL-10 inhibe la réplication de souches X4 du VIH-1
lorsque les macrophages sont cultivés en présence des lymphocytes T. Alors que dans la coculture lymphocytes/cellules dendritiques, l’IL-10 augmente la réplication virale mais n’altère
pas la capacité des cellules dendritiques à le transmettre aux lymphocytes (Ancuta et al.,
2001). Ces travaux suggèrent un rôle de l’IL-10 dans l’émergence des souches X4 du VIH-1
aux stades avancés de l’infection.
Par ailleurs, il semblerait que l’IL-10 agit en synergie avec le TNF-α et l’IL-6, pour
favoriser la réplication virale (Finnegan et al., 1996). En effet, les travaux de Weissman et al.,
ont montré que lorsque les macrophages sont en présence de fortes concentrations d’IL-10
recombinante, on observe un effet inhibiteur de l’IL-10 sur la réplication virale, corrélé à
l’inhibition totale du TNF-α et de l’IL-6 induits par le VIH-1. Inversement, lorsque la
concentration d’IL-10 est plus faible, le TNF-α et l’IL-6 qui ne sont alors que partiellement
inhibées, coopèrent avec l’IL-10 pour favoriser l’augmentation de la réplication virale
(Weissman, Poli, and Fauci, 1994; Weissman, Poli, and Fauci, 1995).
80
2-5-4- L’IL-10 virale
Des protéines homologues à l’IL-10 ont été élaborées par les virus EBV (Epstein Barr
Virus), CMV (Cytomégalovirus) ou encore le parapox Orf virus pour inhiber la réponse
immunitaire de l’hôte et persister à l’état latent.
En plus d’influencer la production de l’IL-10 cellulaire, certains virus codent pour
leurs propres homologues d’IL-10 (vIL-10). Ces homologues viraux miment les effets
biologiques de l’IL-10 humain (hIL-10), et favorisent ainsi la survie du virus. Le premier vIL10 a été identifié comme BCRF dans le génome de l’EBV {Hsu, 1990 #1197}, responsable de
nombreux effets immunosuppresseurs chez son hôte, dont l’inhibition de la prolifération des
cellules T antigène spécifiques via l’inhibition de l’expression du CMH classe II et la
présentation des antigènes par les macrophages (Vieira et al., 1991). L’IL-10 viral codé par le
CMV nommé UL111A (Kotenko et al., 2000) ne représente que 27% d’homologie avec hIL10, mais exerce néanmoins les mêmes propriétés immunosuppressives potentielles (Spencer
et al., 1998). UL111A formerait des homodimères capables de se lier à l’IL-10 (IL-10R1)
avec la même affinité que l’hIL-10 et transduit ainsi un signal cellulaire (Kotenko et al.,
2000). Le parapox Orf virus responsable des lésions cutanées pustulaires chez le mouton, la
chèvre et chez l’Homme, code également pour le vIL-10 qui exerce des effets inhibiteurs sur
la production des cytokines inflammatoires {Haig, 2002 #1200}.
Enfin, concernant le VIH-1, aucune protéine virale mimant l’IL-10 n’a été décrite,
mais certaines protéines du VIH-1 peuvent induire la production d’IL-10 par les cellules de
l’organisme hôte afin d’inhiber le système immunitaire et permettre au virus de persister dans
l’organisme hôte. En effet, les protéines gp41/120 induisent une rapide augmentation de la
production de l’IL-10 par les monocytes et pas les cellules T, B ou NK (Barcova et al., 1998;
Borghi et al., 1995; Schols and De Clercq, 1996). La protéine Nef et Tat sont aussi
responsables de la production de l’IL-10 dans les monocytes (Badou et al., 2000; Brigino et
al., 1997; Creery et al., 2002). Les monocytes étant un réservoir viral durant l’infection VIH
(Crowe, Zhu, and Muller, 2003; Fauci, 1996), l’augmentation de la production de l’IL-10
activerait le développement de ce réservoir et permettrait ainsi la persistance virale (Zhou et
al., 2001).
81
Figure 32: Domaines de modification de la protéine Tat
Structure de Tat et ses modifications
Les différents domaines de Tat et ses acides aminés importants sont indiqués.
L’acétylation est médiée par PCAF et p300/CBP et GCN5. La phosphorylation par CDK2. La méthylation par
PRMT6. L’ubiquitinylation par Hdm2. Lorsque l’acide aminé qui subit la modification n’est pas connu, sa région est
indiquée par une flèche horizontale bidirectionnelle.
Gatignol, A. et al., 2007
HIV Advance in pharmacology
82
IV- LA PROTEINE TAT DU VIH-1
Le virus de l’immunodéficience humaine code pour une petite protéine activatrice de
la transcription Tat relativement conservée (Jeang and Gatignol, 1994), en plus d’autres
protéines de régulation. La fonction principale de Tat est d’activer la transcription du génome
viral. En plus de ses fonctions transcriptionnelles, Tat présente plusieurs autres propriétés
inhabituelles pour un facteur de transcription. En effet, Tat peut être secrétée des cellules
infectées pour agir sur les cellules voisines et participer à d’autres fonctions dont la
dérégulation du système immunitaire.
1- LA PROTEINE TAT ENDOGENE
Le gène tat du VIH-1 est composé de deux exons qui codent pour environ 86 à 101 aa
selon les isolats (130 aa pour VIH-2). L’isolat LAI/Bru du VIH-1 (X4 tropique), code pour
une protéine Tat de 86 aa à cause d’un codon stop prématuré au niveau de 2ème exon. Lors de
la dernière étape du cycle viral, une Tat tronquée en C-terminal (72 aa pour VIH-1 et 99 pur
VIH-2), codée uniquement par le 1er exon du gène, est générée lorsque les ARN viraux non
épissés sont exportés dans le cytoplasme par la protéine Rev. Cette forme en exon de Tat est
suffisante à la transactivation du promoteur du VIH. Durant ce processus, Tat fonctionne
comme un adaptateur pour les cofacteurs cellulaires, dont la plupart possèdent des activités
enzymatiques intrinsèques, qui peuvent induire des modifications au niveau de la Tat ellemême
(phosphorylation,
acétylation,
méthylation….)
régulant
ainsi
son
activité
transactivatrice (Fig. 32).
1-1- Phosphorylation de Tat
Contrairement à la protéine Tat du VIH-1, celle du VIH-2 est phosphorylée par CDK9
qui s’auto-phosphoryle après la liaison de Tat (Herrmann and Rice, 1993). La phospho-CDK9
active la liaison Tat-CyclinT1-CDK9 à la séquence TAR (Garber et al., 2000). Les sites de
phosphorylation de Tat par CDK9 ont été localisés au niveau des Thr 85, Thr 89 et Ser 94 au
83
niveau du premier exon de Tat VIH-2, mais la mutation combinée de ces résidus n’altère pas
la fonction de transactivatrice de Tat dans les expériences de co-transfection (Hetzer et al.,
2005). D’autres études ont montré que CDK2 s’associe à la cycline E et phosphoryle Tat. Le
site de phosphorylation de Tat impliquerait les aa 15-24 et 36-49. Une diminution de
l’expression de CDK2 diminue la transcription du VIH-1 et la production du virus
(Ammosova et al., 2005; Deng et al., 2002). La protéine Tat du VIH-1 se lie à la protéine
kinase R (PKR) et inhibe sa fonction comme un substrat compétitif (Cai et al., 2000). A son
tour, Tat est phosphorylée sur les Ser62, Tyr62 et Ser68 par la PKR. Une mutation au niveau
de ces sites, diminue la liaison Tat-TAR et la transactivation du LTR (Brand, Kobayashi, and
Mathews, 1997; Cai et al., 2000; Endo-Munoz et al., 2005; McMillan et al., 1995).
1-2- Acétylation de Tat
Tat est un substrat potentiel pour l’acétylation par certaines HAT « Histones Acetyl
Transferase ». Parmi ces HAT on compte le co-activateur de transcription p300/CBP
(Hottiger and Nabel, 1998; Marzio et al., 1998), p300/CBP-associated protein P/CAF
(Benkirane et al., 1998) Tip60 (Kamine et al., 1996) et hGCN5 (Col et al., 2001) acétylases.
Les lysines K50 et K51 sont les substrats majeurs de l’acétylation par p300/CBP et hGCN5,
alors que la lysine K28 peut aussi être modifiée par P/CAF (Kiernan et al., 1999).
L’acétylation de Tat joue un rôle important dans la transactivation et la réplication du VIH-1
(Bres et al., 2002; Deng et al., 2000; Kiernan et al., 1999; Roof et al., 2002). L’acétylation de
Tat permet donc la stabilité du complexe. La protéine Ac28Tat possède une plus forte affinité
pout CycT1-CDK9, ce qui active la liaison du complexe Tat-PTEFb à la séquence TAR de
l’ARN (Bres et al., 2002; Kiernan et al., 1999). En revanche, l’Ac50Tat ou le complexe
Ac50Tat-CycT1 a une plus faible affinité pour TAR ce qui suggère qu’elle jouerait un rôle
important dans le détachement du complexe Tat-PTEFb de TAR (Bres et al., 2002; Deng et
al., 2000; Kaehlcke et al., 2003; Kiernan et al., 1999).
D’autre part, via son interaction avec des HAT, Tat facilite l’acétylation de la queue
N-terminale des histones, suivie d’une déstabilisation des interactions histones-ADN (Brown
et al., 2000; Cheung, Briggs, and Allis, 2000; Sterner and Berger, 2000) et ainsi l’accès des
facteurs de transcription au génome viral.
84
1-3- Déacétylation de Tat
La nature dynamique des modifications post traductionnelles de Tat est due à sa
liaison à la fois aux acétylases et aux déacétylases. La lysine 50 de Tat est déacétylée par une
déacétylase classe II, la sirtuin (SIRT1) (Pagans et al., 2005). Les sirtuines, contrairement à
d’autres déacétylases, ont besoin de NAD+ « nicotinamide adenine dinucleotide » comme
cofacteur, induisant son hydrolyse en acetyl-ADP ribose et nicotinamide. L’acétylation de la
K50 de Tat a un effet positif au niveau de la deuxième étape de transactivation, mais interfère
avec la liaison de Tat/TAR et CyclineT1 lors de l’étape initiale (Pagans et al., 2005).
1-4- Ubiquitinylation de Tat
L’ubiquitination est un processus multi-enzymatique qui induit généralement la
dégradation des protéines par le protéasome. L’ubiquitination de la protéine Tat induit en
revanche l’augmentation de son activité transcriptionelle (Bres et al., 2003). La protooncoprotéine Hdm2 est une ubiquitine ligase qui se lie à Tat et induit son ubiquitinylation sur
la Lys71. Le mécanisme par lequel l’ubiquitination de Tat affecte son activité
transcriptionnelle n’est pas défini. Il semblerait que l’ubiquitination active Tat et amorce sa
dégradation à la fin du cycle transcriptionnel.
1-5- Méthylation de Tat
La méthylation des arginines par les protéines arginine méthyltransferases (PRMT),
régule plusieurs voies incluant l’expression des gènes (Bedford and Richard, 2005). Ces
protéines transfèrent le groupement méthyle du S-adenosyl methionine à l’atome guanidino
nitrogène de l’arginine (McBride et al., 2005). PRMT6 interagit avec la protéine Tat du VIH1 et la méthyle au niveau de la région 49-63 qui contient 6 arginines. La suppression de
PRMT6 augmente la transactivation du LTR médiée par Tat, ce qui suggère que la
méthylation de Tat inhibe son activité transactivatrice (Boulanger et al., 2005). La métylation
de l’Arg53, induirait la dissociation de l’interaction de la Tat acétylée avec le bromodomaine
de PCAF (Dorr et al., 2002; Mujtaba et al., 2002).
85
Figure 33: Multiples fonctions de la protéine Tat:
prolifération vs apoptose.
Modifiée d’après Peruzzi, F. et al., 2006
Frontiers in Bioscience
86
Outre son rôle indispensable à la transcription du génome viral, Tat possède de
nombreuses activités exogènes (Rubartelli et al., 1998). La protéine Tat est retrouvée dans le
sérum de patients VIH+ à une concentration de l’ordre du nanomolaire (Westendorp et al.,
1995a; Xiao et al., 2000). Elle peut alors agir sur des cellules non-infectées et interagir avec
des récepteurs cellulaires ou pénétrer dans ces cellules. Ses nombreux effets jouent un rôle
prépondérant dans la pathologie induite par le VIH-1.
2- LA PROTEINE TAT EXOGENE
En effet, en plus de son rôle dans la localisation nucléaire le domaine basique confère
à Tat la capacité de sortir de la cellule en absence de peptide signal (Noonan and Albini,
2000; Vene et al., 2000). Cependant, il est probable que la majeure partie de Tat
extracellulaire ne soit pas libérée dans l’environnement extracellulaire, mais reste associée à
la membrane cellulaire par différents types de récepteurs dont les HspG (Tasciotti, Zoppe, and
Giacca, 2003). La sécrétion de Tat par les cellules infectées lui permet en plus de son rôle
dans la réplication virale, d’agir sur les cellules non infectées en interagissant avec des
récepteurs membranaires (Fig. 33). Elle pourrait donc jouer un rôle majeur dans la
physiopathologie de l’infection à VIH-1, notamment en agissant sur les cellules du système
immunitaire et du SNC (Rappaport et al., 1999; Rubartelli et al., 1998).
2-1- Interaction avec des récepteurs cellulaires
Différents travaux ont rapporté que Tat est capable de se lier à la molécule CD26,
aussi appelée dipeptidyl peptidase IV (DPIV), à la surface des lymphocytes T via son
domaine N-terminal (Gutheil et al., 1994). Cette molécule est impliquée dans la prolifération
des lymphocytes T en réponse à un antigène de rappel. Tat, en interférant avec l’activité de
CD26, pourrait être impliquée dans l’anergie des lymphocytes T et ainsi exercer une activité
immunosuppressive.
Le domaine RGD de Tat interagit avec les intégrines de type αvβ3 et inhibe ainsi la
phagocytose des corps apoptotiques par les cellules dendritiques (Zocchi, Poggi, and
Rubartelli, 1997). Ce mécanisme participe à l’altération des fonctions des cellules
dendritiques et notamment la présentation des antigènes.
87
Tat peut aussi, via son domaine riche en cystéines 24-51 se lier aux récepteurs aux
chimiokines CCR2 et CCR3 des monocytes/macrophages (Albini et al., 1998). Elle attire et
active ainsi des cibles du VIH-1 aux lieux de l’infection. Elle pourrait aussi interagir
directement avec le CXCR4, un membre des récepteurs aux chimiokines (Xiao et al., 2000).
Tat se fixe sur les canaux calciques de type L des cellules dendritiques et des cellules
NK (Zocchi et al., 1998) et inhibe ainsi leur action cytotoxique.
Au niveau des cellules endothéliales, Tat possède une activité angiogénique. Cette
activité est la conséquence de l’interaction de Tat avec les récepteurs au VEGF (Flk1/KDR) et
au bFGF (Albini et al., 1996).
Tat se lierait aussi au récepteur aux lipoprotéines (LRP) au niveau des neurones (Liu et
al., 2000) activant ainsi des gènes neuronaux et dérégulant le métabolisme des lipides dans
ces cellules.
En dehors des récepteurs spécifiques, Tat peut enfin interagir avec les lipides
membranaires (Sabatier et al., 1991) et les heparanes sulfates (Ziegler and Seelig, 2004). Ces
derniers seraient impliqués dans le processus d’internalisation de Tat dans la cellule (Argyris
et al., 2004).
2-2- Internalisation de la Tat exogène
2-2-1- Par endocytose
Comment Tat pénètre-t-elle dans le cytosol ? Cette propriété fut décrite en montrant
que la protéine Tat extracellulaire pouvait transactiver des gènes rapporteurs placés en aval du
promoteur VIH-1 LTR (Frankel and Pabo, 1988; Mann and Frankel, 1991). Cette découverte
fut plus tard confirmée par l’utilisation de plusieurs protéines de fusion de Tat (Fawell et al.,
1994). A 4°C, la protéine Tat pénètre très peu dans les cellules, donc le mécanisme d’entrée
dans les cellules serait un mécanisme actif (Ensoli et al., 1993; Mann and Frankel, 1991).
Bien que la pénétration de Tat via les caveoles ait été décrite dans les cellules HeLa (Fittipaldi
et al., 2003), ce mécanisme n’aurait pas lieu dans les lymphocytes T. En effet, les travaux de
Fra et al et de Lamaze et al (Fra et al., 1994; Lamaze et al., 2001) n’ont pas permis de détecter
la caveoline dans les lymphocytes T. Ainsi, plus récemment, le processus d’internalisation de
Tat dans les lymphocytes T a été mis en évidence (Vendeville et al., 2004) (Fig. 34). Tat
entrerait dans les lymphocytes T en utilisant essentiellement la voie d’endocytose via les
88
Figure 34: Internalisation de la protéine Tat
1
2
Tat
3
4
5
6
Modifiée d’après Vendeville A. et al.,
2004
Molecular biology of the cell
89
vésicules de clathrine de manière dépendante des Eps15, intersectine et de la dynamine. Tat
utilise le gradient de pH entre les endosomes et le cytoplasme, pour échapper à la dégradation
et être libérée dans le cytoplasme. Cette translocation de Tat est favorisée par Hsp-90, Tat est
libérée dans le cytosol où elle remplie ses fonctions. Il est à noter que les heparanes sulfate
seraient indispensables à la pénétration de Tat dans d’autres types cellulaires (Argyris et al.,
2004; Tyagi et al., 2001).
2-2-2- Rôle du domaine de transduction de Tat dans l’internalisation
Tat possède une séquence peptidique, baptisée domaine de transduction protéique
(DTP), conférant à cette protéine la propriété d’être transportée à l’intérieur des cellules sans
l’intermédiaire d’un récepteur spécifique (Ezhevsky et al., 1997). Ce domaine peptidique
fusionné à d'autres protéines ou macromolécules permet leur internalisation leur donnant ainsi
accès au cytoplasme (Mann and Frankel, 1991). La protéine Tat, synthétique ou purifiée, peut
après son internalisation dans le cytoplasme, se concentrer dans le noyau et transactiver la
transcription de gènes viraux (Frankel and Pabo, 1988; Green and Loewenstein, 1988). Suite
à la mort cellulaire ou suite à un processus de transport encore mal caractérisé, Tat peut être
relarguée de la cellule infectée par le VIH pour ensuite être internalisée dans une cellule
voisine non infectée (Ensoli et al., 1993), ou infectée de manière latente.
Mann et Frankel furent les premiers à suggérer l’utilisation de Tat comme vecteur
pour faciliter la transduction intracellulaire de protéines ou de macromolécules d'intérêts
(Mann and Frankel, 1991). En 1994, la protéine Tat fut exploitée comme un outil de transport
de protéines, tels que la β-galactosidase, à l’intérieur des cellules (Fawell et al., 1994). Suite à
l’injection intraveineuse de Tat (37-72)-β-galactosidase, l’enzyme fut détectée dans le foie, le
cœur, la rate, et dans une moindre mesure les poumons et les muscles (Fawell et al., 1994).
Plus tard, deux groupes ont identifié le domaine basique minimal (aa 49-57) responsable de la
transduction intracellulaire de la protéine Tat (Ezhevsky et al., 1997 ; Vives, Brodin, and
Lebleu, 1997).
90
Figure 35: Effets de la protéine Tat exogène
via les canaux Ca2+ type-L
Protéine Tat du VIH-1
Canaux Ca2+ type-L
Cellules NK
Cellules tumorales
apoptotiques
Cellules B
Cellules
dendritiques
Cellules tumorales
Lymphocytes T cytotoxiques
Modèle des effets de Tat exogène sur les cellules immunitaires in vivo, médiés par les canaux Ca2+ de type-L.
Le blocage de l’entrée de Ca2+ induit l’inhibition de l’activité anti-tumorale des cellules NK, la sécrétion de l’IL-12
ainsi que l’endocytose des corps apoptotiques par les CD. Tat bloque la production des Ac par les cellules B.
L’inhibition de l’IL-12 influence le développement des cellules Th2 au dépend des Th1. Ceci induit la production
de l’IL-10. L’IL-10 diminue les fonctions des APC et la production de l’IFN-γ et l‘IL-2 impliqués dans la
maturation des cellules T.
Modifiée d’après Rubartelli A. et al., 1998;
Immunology today
91
2-3- Effets sur le système immunitaire
La dérégulation du réseau de cytokines observée pendant l’infection VIH est en grande
partie due à l’effet de la protéine Tat (Brady et al., 1995; Nath et al., 1999; Poggi, Rubartelli,
and Zocchi, 1998; Rautonen et al., 1994). En effet, Tat active la transcription de l’IL-6 et de
l’IL-2 et induit la production de cytokines pro-inflammatoires IL-1β et TNF-α par les
monocytes/macrophages (Mayne et al., 2000; Rubartelli et al., 1998). Tat est capable
d’induire l’apoptose des lymphocytes T, et d’inhiber leur prolifération antigène spécifique et
non-spécifique (Yang et al., 2003; Li et al., 1995). Tat inhibe la phagocytose des corps
apoptotiques par les cellules accessoires incapables de présenter les antigènes associés
(Zocchi, Poggi, and Rubartelli, 1997). De plus, elle bloque la production d’IL-12 qui stimule
les cellules NK et induit la différenciation des lymphocytes T auxiliaires de type TH1 (Ito et
al., 1998; Zocchi et al., 1998). A son tour, l’inhibition de la production d’IL-12 pourrait
contribuer à la diminution de l’activité des cellules NK et au déséquilibre TH1-TH2 observé
chez les patients séropositifs.
In vitro, il a été montré que Tat inhibe la fonction cytotoxique des cellules NK, en
bloquant les canaux calciques de type-L (Zocchi et al., 1998) (Fig. 35). Tat, via sa région Cterminale, inhibe aussi la production de Mn-SOD dans les cellules HeLa, induisant ainsi une
augmentation du stress oxydatif (Flores et al., 1993 ; Westendorp et al., 1995b).
Ainsi, la protéine Tat participe à l’orientation de la réponse immunitaire vers une
réponse de type TH2. La protéine Tat, induit la polarisation des monocytes vers le lieu
d’infection, en mimant les molécules chimiotractantes telles que CCR2 et CCR3 par sa région
riche en cystéines et le domaine core, contribuant ainsi à l’expansion de l’infection (Albini et
al., 1998). D’autre part, Tat a été décrite comme antagoniste sélectif de CXCR4. En inhibant
sélectivement la réplication des virus X4 tropique, Tat participerait ainsi à la sélection des
virus R5 tropiques au cours de la primo-infection (Xiao et al., 2000).
2-4- Effets sur le système nerveux central
La démence associée au VIH-1 (HAD) se développe chez environ 20 % des individus
à des stades avancés de l’infection par le VIH+ dans les pays industrialisés (Lawrence and
Major, 2002). Quelles sont les bases de cette neuropathologie ?
92
Le VIH-1 ne semble pas pouvoir infecter les neurones. Mais il peut infecter d’autres
cellules du système nerveux central : la microglie, les macrophages (Griffin, 1997) et les
astrocytes (Canki et al., 1997). Ces cellules libèrent des protéines virales et notamment la
protéine Tat qui agit de manière directe ou indirecte sur les neurones. Le mécanisme de
neurotoxicité induit par Tat implique une mobilisation prolongée de calcium, qui stimule la
production de réactifs oxygénés toxiques et l’activation des voies de l’apoptose dépendante
des caspases. Mais Tat peut aussi agir indirectement en induisant la production de
métalloprotéinases de la matrice MMP-2 qui favorisent l’apoptose neuronale. Ces
métalloprotéinases sont en effet retrouvées dans le cerveau des patients VIH+ atteints de
démence.
En outre, Tat induit la production de TNF-α et d’IL-1. Le TNF-α est cytotoxique pour
les oligodendrocytes, cellules responsables de la production de myéline. Sa production dans
les neurones de souris transgéniques s’accompagne d’une démyélinisation, d’une infiltration
de lymphocytes, d’une astrogliose et d’une microgliose.
Enfin, Tat, via son domaine riche en cystéines (CC), mime les chimiokines et attire les
monocytes non-infectés, entrainant une infiltration de ces cellules (Ranga et al., 2004). Cet
effet de Tat serait déterminant puisque dans des régions du monde où des souches de VIH-1
sont mutées dans ce domaine CC, la prévalence des démences associées au VIH-1 chez les
personnes à des stades avancés de l’infection serait beaucoup moins importante (environ 1%
des patients séropositifs vs 15 à 30%) (Ranga et al., 2004).
2-5- Tat et le sarcome de Kaposi
Le sarcome de Kaposi (KS), est une maladie angioproliférative particulièrement
fréquente chez les patients VIH-1. Cette maladie est associée à l’infection par le virus de
l’herpès humain 8 (HHV8), impliqué dans le développement des lésions du sarcome de kaposi
(Ensoli and Sirianni, 1998; Schulz, 1998).
Le développement de lésions dermiques ressemblant au KS chez les souris
transgéniques exprimant le gène HIV-tat (Vogel et al., 1988), a suggèré très tôt que Tat
constituerait un lien pathogénique entre l’infection VIH-1 et le KS. A des concentrations de
l’ordre du picomolaire, Tat extracellulaire induit la migration directionnelle des cellules KS
(chimiotactisme) et active leur capacité à dégrader et traverser les membranes basales
(invasion) (Albini et al., 1995). Ce dernier effet est dû à la capacité de Tat à activer
93
l’expression des MMP-2 (Barillari et al., 1999a; Ensoli et al., 1994), qui jouent un rôle
important dans l’invasion et l’angiogenèse (Brooks et al., 1996).
Cependant, pour exercer ses effets angiogéniques, Tat requiert la coopération de
cytokines inflammatoires, incluant l’IL-1β, le TNF-α et l’IFNγ, dont le niveau augmente dans
le sang et les tissus des patients SIDA-KS (Albini et al., 1996; Barillari and Ensoli, 2002;
Barillari et al., 1999b). Ces cytokines augmentent (dans le KS) ou induisent (dans les cellules
endothéliales), la synthèse du facteur de croissance bFGF « basic fibroblast growth factor »
(Samaniego et al., 1998). En se liant aux sites de fixation héparines, la région basique de Tat
rentre en compétition avec bFGF extracellulaire. Les bFGF ainsi solubles, induisent la
croissance des cellules endothéliales et l’expression des intégrines α5β1 et αvβ3 (Barillari et
al., 1999a; Barillari et al., 1999b). Ces intégrines interagissent à leur tour avec la région RGD
de Tat, induisant ainsi la locomotion des cellules KS et la croissance des cellules
endothéliales activées en réponse au bFGF (Barillari et al., 1999a; Barillari et al., 1999b;
Ensoli et al., 1994).
En plus du bFGF, ces mêmes cytokines inflammatoires coopèrent avec Tat pour la
production du facteur angiogénique VEGF-A « vascular endothelial cell growth factor type
A » (Barillari et al., 1999b). De manière intéressante, Tat se fixe et phosphoryle le récepteur
VEGF 2 (Flk-1/KDR), responsable de la majorité des effets angiogéniques de VEGF-A
(Morini et al., 2000). Le fait que Tat et VEGF-A utilisent le même récepteur, explique
pourquoi Tat, contrairement au bFGF, n’active pas les effets angiogéniques du VEGF in vitro
et in vivo.
94
3- TAT : CANDIDAT VACCIN ET CIBLE THERAPEUTIQUE
3-1- Anticorps anti-Tat et molécules antagonistes
De par sa fonction essentielle dans le cycle viral et ses implications comme facteur de
pathogénicité, plusieurs arguments sont en faveur de l’utilisation de la protéine Tat comme
une cible privilégiée pour le développement de molécules antagonistes ou de préparation
vaccinale.
En effet, la protéine Tat est i) produite de manière précoce dans le cycle virale, ii)
essentielle à la réplication virale puisque sa mutation abolit totalement la réplication virale,
iii) capable d’induire une immunité cellulaire cytotoxique et humorale chez certains patients.
De plus il semble que cette réponse anti-Tat soit corrélée avec le contrôle de la réplication
virale, particulièrement chez les patients non progresseurs et dans le modèle SIV/macaque
(Addo et al., 2001; Allen et al., 2000; Ensoli and Cafaro, 2002).
Les essais de vaccination avec la protéine Tat, dans le modèle SIV/macaque, semblent
donner des résultats différents. Les travaux de Ensoli et al., ont rapporté que l’immunisation
avec une protéine Tat soluble confère une protection totale du macaque cynomologus contre
un challenge par le SHIV 89.6P (Cafaro et al., 1999a). L’analyse de la réponse immune antiTat chez les macaques protégés montre l’absence des anticorps anti-Tat et par conséquent,
semble mettre en évidence une corrélation entre la protection et une réponse immunitaire
cytotoxique médiée par des lymphocytes T CD8 spécifiques de Tat (Cafaro et al., 1999a). Le
même groupe a aussi montré qu’une vaccination de macaque avec l’approche vaccination
ADN, utilisant un plasmide codant pour le gène Tat, confère une protection aux macaques
cynomologus suite à un challenge avec du SHIV 89.6P (Cafaro et al., 2001; Maggiorella et al.,
2004).
Cependant, des protocoles similaires avec une protéine Tat native, dénaturée, Tat
vectorisée ou des peptides de Tat, chez le macaque rhésus, ont conduit à une absence de
protection (Allen et al., 2002; Silvera et al., 2002), ou uniquement une protection partielle
(Goldstein et al., 2000; Pauza et al., 2000), contre le challenge par SIVma239 ou SHIV33 ou
SHIV 89.6P.
La différence des résultats rapportés par les différents groupes, peut être liée à l’espèce
de macaque testée, à l’immunogénicité de la protéine Tat chez chaque espèce, aux voies
d’administration du vaccin, au système de délivrance, à la durée du protocole d’immunisation
95
ou encore au protocole du challenge. Afin de limiter les différentes variables, Florese et al.,
ont utilisé exactement le même protocole, en vaccinant des macaques cynomologus et rhésus,
avec la protéine Tat soluble ou vectorisée dans un vecteur adénovirus. Cependant, cette étude
bien qu’elle montre l’influence de l’haplotype du CMH sur la susceptibilité ou la résistance
des macaques à l’infection par SHIV 89.6P, elle ne reproduit pas la protection observée lors
des premières expériences rapportées par Cafaro et al., (Cafaro et al., 1999b). Les auteurs
expliquent cette différence par la dose du virus utilisée (15 MID50 vs 10 MID50) (Florese et
al., 2008).
Malgré ces controverses, il semble clair aujourd’hui qu’un vaccin efficace contre le
VIH-1 sera probablement composé d’une association de protéines de structure et de protéines
de régulation incluant Tat, Nef et Rev, comme semble le montrer les différents essais utilisant
différentes protéines du VIH-1 et SIV (Hel et al., 2006; Osterhaus et al., 1999).
En parallèle à l’approche vaccinale, des molécules antagonistes de Tat sont en cours
de développement (De Clercq, 2002; Watson et al., 1999), telles que les fluoroquinolones (K12 et K-37) (Baba et al., 1998) et le flavopiridol qui est un inhibiteur de CDK et du complexe
p-TEFb (Watson et al., 1999). Certains polysaccharides sulfatés agiraient en séquestrant la
protéine Tat extracellulaire et inhibent la réplication du VIH-1 in vitro (Lecoq et al., 2008 ;
Watson et al., 1999).
Des peptides antagonistes de la protéine Tat, correspondant au domaine core (aa 3650) ou au domaine basique (aa 48-56) sont capables d’inhiber la réplication virale (Kashanchi,
Sadaie, and Brady, 1997). Le peptide CGP64222, dont la structure est identique au domaine
basique de Tat, agit en bloquant l’interaction Tat/TAR (Hamy et al., 1997) mais surtout en
interagissant avec le corécepteur CXCR4 (Daelemans et al., 2000).
3-2- Les ARNs interférents
L’approche des ARN interférents (ARNi), permet d’inhiber l’expression des gènes par
l’intermédiaire de petits ARN (siRNA) « small interfering RNA » de 21 à 23 oligonucléotides
non codants.
Différents travaux ont montré que les siRNA sont capables d’inhiber la
réplication virale en ciblant des micros ARN (ARNmi), spécifiques des récepteurs cellulaires
du VIH-1 (CD4, CCR5) (Chackerian et al., 1997), des protéines virales de structure Gag ou
des protéines de régulation telle que Nef (Novina et al., 2002). Par conséquent, cette approche
96
pourrait être un candidat intéressant pour le développement des molécules à visées
thérapeutiques. En effet, les miRNA sont conservés chez les cellules eucaryotes, mais on les
trouve également chez certains virus (Bennasser et al., 2006). Ils assurent un rôle de
régulation d’expression des gènes, y compris certains gènes contrôlant la réplication virale.
Après leur synthèse dans le noyau par les ARN polII et III, les ARN cibles sont clivés par
l’activité nucléase de DROSHA avant de passer dans le cytoplasme où ils seront ensuite
clivés par DICER, générant ainsi de petits fragments d’ARN qui, en s’hybridant aux ARN des
gènes cibles, permettent leur inactivation.
L’ajout des miARN synthétiques spécifiques de Tat ou l’utilisation de vecteurs viraux
dont le génome code pour ce même miARN est capable d’inhiber l’expression et l’activité de
Tat respectivement dans des cellules 293T transfectées ou des macrophages primaires
(Coburn and Cullen, 2002; Lee et al., 2003b). Ces mêmes ARNi peuvent inhiber la production
de virus par des cellules immortalisées et des lymphocytes T primaires humains infectés.
Cependant, les premiers essais réalisés montrent que le virus peut échapper au traitement
(Boden et al., 2003). Cet échappement semble être médié par la protéine Tat, qui pourrait
interférer avec la voie des miRNA en interagissant directement avec DICER, inhibant ainsi
son activité et son rôle clé dans ce mécanisme d’activation de miRNA (Bennasser and Jeang,
2006).
97
V- VOIES DE SIGNALISATION ET PRODUCTION DE
CYTOKINES
Nous avons vue que lors de l’infection VIH-1, en plus de la particule virale elle-même,
plusieurs protéines virales (Tat, Nef, Rev, Vif….) participent à la dépression du système
immunitaire. Ces protéines agissent de manière extra ou intracellulaire en initiant différentes
voies de signalisation, qui aboutissent à la dérégulation de l’expression d’un certain nombre
de gènes, notamment les gènes de cytokines. Ainsi suite à la liaison du ligand, la
phospholipase C est recrutée par le récepteur activé. Elle clive alors le phosphatidyl inositol
biphosphate (PIP2) en inositol 1, 4, 5 triphosphate (IP3), qui va induire le relargage de
calcium des stocks intracellulaires dans le cytosol, et en diacylglycérol qui recrute et stimule
la PKC. La voie de la Protéine Kinase A (PKA) peut aussi être recrutée suite à l’augmentation
de la synthèse d’AMP cyclique (AMPc). En aval, les voies des MAPK et des facteurs de
transcriptions comme NF-AT, NF-κB, AP-1 ou CREB sont activées, aboutissant ainsi à
l’expression des gènes codant pour de nombreuses cytokines, et à terme, à la dérégulation du
système immunitaire par des protéines virales.
1- LES TOLL-LIKE-RECEPTEURS : TLRS
1-1- Généralités
Metchinkoff était le premier à décrire le système immunitaire inné depuis maintenant
plus d’un siècle. En 1989, Janeway propose que les effecteurs de l’immunité innée sont
activés par des récepteurs appelés PRR « Patern-Recognition Receptors » qui reconnaissent
des structures microbiennes appelées PAMP « Pathogen-Associated Molecular patterns ». Ces
dernières sont conservées chez les différentes classes de micro-organismes. Le LPS, les
lipoprotéines et les acides nucléiques des virus ou des bactéries font partie des PAMP. La
signalisation via les PRR induit une cascade d’évènements incluant la production de
chimiokines et des cytokines proinflammatoires, l’activation des molécules du complément, le
recrutement des cellules phagocytaires et des cellules présentatrices d’antigène. A la fin des
années 1990, trois découvertes ont significativement fait avancer la compréhension et la
définition de l’immunité innée médiée par les PRR. Tout d’abord, des observations chez la
98
Figure 36: Structure des dimères Toll-like receptors
Domaine TIR
Domaine TIR
Modifiée d’après Beutler B. et al., 2006
Annual review of immunology
99
mouche Drosophila melanogaster des mécanismes de défense antibactériens et antifongiques
induits par Toll et 18-wheeler respectivement (Lemaitre et al., 1996). L’année suivante, un
homologue chez les mammifères, le TLR4 a été identifié. Une forme constitutivement active
de ce récepteur peut activer l’expression du facteur de transcription nucléaire NF-κB,
induisant ainsi l’expression des gènes proinflammatoires codant pour l’IL-1, IL-6 et l’IL-8 et
surexprime les molécules costimulatrices (Medzhitov and Janeway, 1997; Medzhitov,
Preston-Hurlburt, and Janeway, 1997). Enfin, l’identification d’une mutation ponctuelle du
gène TLR4 rendant les souris anergiques au LPS, et plus susceptibles aux bactéries gram
négative, relie définitivement les TLR à l’immunité innée (Poltorak et al., 1998).
Depuis 10 membres de cette nouvelle famille de « Toll-Like-Receptors » (TLR1TLR10) (Tableau) ont été identifiés chez l’Homme (Du et al., 2000). La localisation
chromosomique de chaque gène TLR a été déterminée chez l’Homme : TLR1 et TLR6 sur
4p14 (34,35), le TLR2 (4q32), TLR3 (4q35), TLR4 (9q32-33), TLR5 (1q33-3) (34). Les
TLR7 et TLR8 sont localisés en tandem sur Xp22 alors que le TLR9 sur 3p21.3 (Chuang and
Ulevitch, 2000; Du et al., 2000).
Les TLR font partie de la famille des récepteurs transmembranaires type 1,
caractérisés par une région extracellulaire LRR « Leucine Rich Repeat », et un domaine
intracellulaire TIR « Toll/IL-1 Receptor » (Fig. 36). LRR sont trouvés dans plusieurs
protéines fonctionnelles où ils semblent impliqués dans les interactions protéine-protéine et
protéine-ligand. Le domaine TIR est un module de signalisation conservé dans plusieurs
protéines cytoplasmiques. Les TLR sont exprimés au niveau de la membrane cellulaire et
dans les compartiments subcellulaires tels que les endosomes (Fig. 37). Ils sont exprimés dans
plusieurs types cellulaires incluant les cellules épithéliales et endothéliales non
hématopoïétiques, ainsi que les macrophages, neutrophiles et les cellules dendritiques (CD).
Cependant chaque type cellulaire n’exprime que certains membres spécifiques de cette
famille.
1-2- Les TLR endosomaux
¾ TLR3
Le TLR3 humain (hTLR3) possède des caractéristiques structurales uniques qui le
distinguent des autres TLRs. En effet, TLR3 est dépourvu de résidu proline conservé dans
les autres membres de la famille TLR. D’autre part le TLR3 est également particulier par
100
Figure 37: Localisation et ligands des TLR
Membrane plasmique
Endosomes
Kaisho, T. et al., 2005;
Encyclopedia of life
101
le fait qu’il soit exprimé préférentiellement dans les cellules dendritiques matures et par
l’organisation de son gène (Muzio et al., 2000). Le TLR3 reconnaît l’ARN double brin,
produit par plusieurs virus lors de leur cycle réplicatif soit comme un intermédiaire
essentiel de la synthèse d’ARN, ou comme un produit dérivé généré, lors de la
transcription symétrique de l’ADN viral (Alexopoulou et al., 2001). Cependant, des
travaux ont montré une reconnaissance d’ARN viral double brin indépendamment du
TLR3, via des hélicases RIG-I «Retinoic acid-Inducible Gene I » et MDA5 « MelanomaDifferenciation-Associated gene 5», qui sont des PRR cytoplasmiques exprimés
abondamment dans plusieurs types cellulaires (Andrejeva et al., 2004; Yoneyama et al.,
2004). RIG-I et MDA5 reconnaissent de manière différentielle les différents groupes
d’ARN viraux jouant ainsi un rôle important dans la réponse antivirale (Kato et al., 2006).
Ces récepteurs contiennent des domaines hélicase pour la liaison des ARN et deux
domaines de recrutement de caspases (CARD) pour la transduction du signal. Suite à la
fixation du ligand, RIG-I et MDA5 se lient et activent un adaptateur IPS-1 « Interferon-β
promotor stimulator 1 », dit aussi CARDIF, MAVS et VISA) pour l’activation de NF-κB
et IRF3 induisant la production de l’IFN-β (Kawai et al., 2005; Meylan et al., 2005; Seth
et al., 2005; Xu et al., 2005). L’importance de RIG-I et MDA5 dans la reconnaissance
virale est supportée par des expériences de ciblage de gènes, démontrant que TLR3 et son
adaptateur TRIF ne sont pas requis pour la production de l’IFN type I dans certaines
cellules infectées par des virus, telles que les fibroblastes et les CD conventionnels
(Honda et al., 2003). Paradoxalement, les CD plasmacytoïdes semblent utiliser
exclusivement TLR3/TRIF pour induire la production de l’IFN type I en réponse aux
ARN viraux (Kato et al., 2005).
¾ TLR9
L’activité immunostimulatrice de l’ADN bactérien est attribuée aux motifs CpG non
méthylés reconnus spécifiquement par le TLR9 au niveau des endosomes suite à leur
internalisation non spécifique (Hemmi et al., 2000). En effet, le TLR9 est exprimé au niveau
des endosomes cellulaires (Ahmad-Nejad et al., 2002), contrairement au TLR1, TLR2, et
TLR4 qui sont exprimés en surface. Cette restriction endosomale du TLR9 semble jouer un
rôle clé dans la reconnaissance de l’ADN du soi et du non soi, puisque l’ADN de l’hôte ne
rentre pas dans les endosomes contrairement à l’ADN microbien (Barton, Kagan, and
Medzhitov, 2006). D’autre part, la faible fréquence et le fort taux de méthylation des motifs
102
CpG d’ADN mammifère, prévient sa reconnaissance par les TLR9. Enfin, Coban et al., ont
montré que le TLR9 est capable de reconnaitre un nouveau ligand non ADN dit ‘Hemozoine’,
qui est un polymère hydrophobe de l’hème produit par les parasites de la malaria quand ils
digèrent l’hémoglobine de l’hôte (Coban et al., 2005). Les voies de signalisation JNK et NFκB induites lors de l’activation des autres TLR par le LPS, ne semblent pas activées par les
motifs CpG de l’ADN bactérien dans les macrophages (Hemmi et al., 2000).
¾ TLR7 et TLR8
TLR7 et TLR8 présentent des homologies au TLR9. Comme le TLR9, les ligands de
ces récepteurs doivent être internalisés. Les ligands naturels de ces deux récepteurs n’ont pas
encore été identifiés. Cependant des composants synthétiques de faible poids moléculaire dont
la structure moléculaire ressemble à des acides nucléiques, tels que les dérivés de
l’Imidazoquinoline, la loxoribine ou la bropirimine, sont utilisés comme ligand du TLR7
(Hemmi et al., 2002). Les TLR7 et TLR8 semblent essentiels à la reconnaissance des ARN
viraux simple brin (ARNsb) riches en guanosine et uridine par les CPAg (Heil et al., 2003).
De manière intéressante, l’ARN de mammifère, contenant plusieurs nucléosides modifiés est
très peu ou pas reconnu par le TLR7 et TLR8 contrairement à l’ARN bactérien, ce qui
suggère que l’hôte utilise ces modifications des nucléosides afin de distinguer entre les ARN
dérivés des pathogènes et les ARN endogènes (Kariko et al., 2005). Comme le TLR3,
l’engagement de ces récepteurs induit la production de l’IFN type I essentiel à l’immunité
innée antivirale.
1-3- Les TLRs de la membrane plasmique
¾ TLR1, TLR2 et TLR6
TLR2 reconnaît les composants d’une variété de microorganismes tels que les
lipoprotéines et les peptidoglycanes (Takeuchi et al., 1999; Takeuchi et al., 2000). Le TLR2
reconnaît aussi plusieurs types de LPS atypiques de Leptospira interrogans et porphyromonas
gingivalis contrairement au TLR4 qui ne reconnait que les LPS des entérobactéries tels que
Escherichia coli et Salmonella spp (Hirschfeld et al., 2001; Werts et al., 2001). En effet, les
propriétés des LPS atypiques reconnues par TLR2 diffèrent structurellement, en nombre de
chaînes acyles dans le lipide A, et fonctionnellement de ceux des entérobactéries reconnus par
TLR4.
103
L’un des aspects spécifiques de reconnaissance par le TLR2 est sa coopération avec
d’autres TLR notamment avec TLR1 et TLR6 qui forment un hétédimère fonctionnel avec
TLR2 et lui confèrent une spécificité de reconnaissance avec des différences subtiles entre les
triacyl et les diacyl lipopeptides (Ozinsky et al., 2000; Takeuchi et al., 2001; Takeuchi et al.,
2002; Wyllie et al., 2000). L’héterodimère TLR2/TLR1 reconnaît une variété de
lipoprotéines, incluant celles des mycobactéries et des Meningococcus (Takeuchi et al., 2002;
Wetzler, 2003), alors que le complexe TLR2/TLR6 reconnaît les lipoprotéines des
mycoplasmes et les peptidoglycanes (Takeuchi et al., 2001). Cependant, des travaux récents
ont montré que le TLR2 est capable de reconnaitre d’autres ligands sous forme
d’homodimères ou d’héterodimères formés avec d’autres molécules non-TLR. Parmi ces
ligand on compte l’acide lipotéichoïque, les lipoarabinomannanes, les LPS atypiques
précédemment cités et les porines présents sur la membrane externe de Neisseria (Massari et
al., 2002; Wetzler, 2003). En plus des PAMPs bactériens, les hétéro/homodimères TLR2
reconnaissent aussi des molécules fongiques (Kataoka et al., 2002; Underhill et al., 1999) et
protozoaires (Campos et al., 2001).
¾ TLR5
Le ligand le plus connu du TLR5 est la flagelline des bactéries Gram négatif (Hayashi
et al., 2001). La flagelline se fixe au domaine extracellulaire (1-636 aa) du TLR5
membranaire mais aussi à la forme soluble et spécifiquement via la région (386-407 aa)
(Mizel, West, and Hantgan, 2003). De manière intéressante, le site de reconnaissance du
TLR5 est masqué dans la forme filamenteuse de la structure flagellaire, indiquant que le
TLR5 reconnait seulement la forme monomérique de la flagelline (Smith et al., 2003). La
région N-terminale de 358aa du TLR5 semble jouer un rôle important dans la signalisation
cellulaire de ce récepteur (Mizel, West, and Hantgan, 2003). Cependant, des travaux récents
ont démontré une reconnaissance de la flagelline cytosolique de Salmonella typhirium via
Ipaf, un membre des NOD-LRR « nucleotide-binding oligomerisation domain » (Franchi et
al., 2006; Miao et al., 2006). La reconnaissance de la flagelline par Ipaf induit l’activation de
la caspase-1 et par conséquent la sécrétion de l’IL-1β par les macrophages.
¾ TLR11
Des études génétiques ont montré récemment que les souris déficientes en TLR11 sont
susceptibles aux infections urinaires causées par Escherichia coli (Zhang et al., 2004). Bien
104
que le ligand bactérien du TLR11 reste inconnu, l’infection par ce genre de pathogènes
urinaires est complètement inhibée par un traitement à la protéinase K, suggérant que le
ligand du TLR11 serait de nature protéique.
¾ TLR4
Le hTLR4 est exprimé dans plusieurs types cellulaires et plus spécialement les cellules
du système immunitaire : macrophages, cellules dendritiques, neutrophiles, mastocytes et
cellules B. Le TLR4 est le récepteur pour la transduction du signal LPS. Le mécanisme de
reconnaissance du LPS par le TLR4 est très complexe et implique plusieurs protéines
accessoires.
Le LPS se fixe tout d’abord à une protéine sérique LBP « LPS binding protein » qui le
transfert au CD14 (da Silva Correia et al., 2001; Jiang et al., 2000). CD14 est un
« glycosylphosphatidylinositol anchored molecule » exprimée préférentiellement à la surface
des macrophages et de certaines sous populations de cellules dendritiques. CD14 existe aussi
sous forme soluble dans le sérum. Les deux formes de CD14 se lient au LPS avec une grande
affinité. L’éctodomaine du TLR4 est associé à une autre protéine accessoire nommée MD2
(Akashi et al., 2000; Shimazu et al., 1999) une glycoprotéine de 20-30 kDa. Etant dépourvue
du domaine transmembranaire, la protéine MD2 s’associe au TLR4 dans le réticulum/cis
Golgi, et le complexe TLR4/MD2 migre à la surface cellulaire (Visintin et al., 2001). Alors
que TLR4 réside normalement à la surface, on le retrouve dans l’appareil de golgi dans les
cellules déficientes en MD2, ce qui suggère que cette protéine est essentielle à la distribution
intracellulaire du récepteur (Nagai et al., 2002). Une autre protéine de surface, la MD1 est
aussi impliquée dans la reconnaissance du LPS. C’est une protéine homologue à MD2, qui
contient un domaine LRR structuralement relié à ceux de la portion extracellulaire du RP105,
un homologue du TLR préférentiellement exprimé à la surface des cellules B (Miyake et al.,
1995). Cette protéine s’associe de manière fonctionnelle au RP105 et permet son expression à
la surface cellulaire pour reconnaître le LPS (Ogata et al., 2000).
En plus du LPS, le TLR4 semble induire une réponse inflammatoire en réponse à
plusieurs autres ligands exogènes (protéines virales) et endogènes (HSP60, fibronectine, acide
hyaluronique, héparanes sulfates). En effet, le TLR4 et CD14 reconnaissent la protéine de
fusion du virus syncytial (VRS) (Haynes et al., 2001; Kurt-Jones et al., 2000). De plus il a été
montré que la protéine Nef du VIH réduit la sécrétion du TNF-α médiée par le TLR4 dans les
U937, en activant la phosphatase MKP-1 qui interfère avec l’activation des MAP kinases
105
ERK1/2 (Tachado et al., 2005). Le TLR4 semble également être responsable de la réponse
inflammatoire induite par les « Heat shock proteins » HSP60 (Bulut et al., 2002). Cependant
ces ligands n’activent les cellules immunitaires qu’à de très fortes concentrations,
contrairement au LPS.
L’une des questions intrigantes est si le TLR4 reconnaît ses ligands directement ou
non. Certains groupes ont proposé que la reconnaissance du LPS par le TLR4 implique une
liaison directe, alors que d’autres suggèrent que le LPS se lie d’abord au MD2, et que ce
complexe stimulerait ensuite le TLR4 (Akashi et al., 2001; Lien et al., 2000). Une
reconnaissance espèce-spécifique des différents ligands serait une preuve génétique d’une
interaction directe. Par exemple, les cellules de souris et non humaines reconnaissent le Taxol,
et cette reconnaissance espèce-spécifique semble être médiée par MD2 (Kawasaki, Gomi, and
Nishijima, 2001).
1-4- Les TLR et voies de signalisation
Comme nous venons de le voir, une pléiotropie de PAMP stimule différents TLRs
pour induire la transcription des gènes cibles essentiels à une réponse immunitaire efficace.
Les voies de signalisation induites pas les TLR sont presque identiques à celles
induites par la famille IL-1R. Les TLRs et IL-1R interagissent avec la protéine adaptatrice
MyD88, possédant un domaine TIR en C-terminal et un domaine de mort « Death domain,
DD » en N-terminal. MyD88 recrute les membres de la famille IRAK «L-1R associated
kinase » via une interaction homotypique entre leurs DD. Un autre adaptateur TRAF6 « TNF
receptor-associated factor 6 » est également recruté ce qui déclenche l’activation d’une
cascade MAP kinase et NF-κB induisant ainsi la sécrétion de cytokines inflammatoires.
1-4-1- Signalisation dépendante de MyD88
MyD88 joue un rôle important dans la signalisation par IL-1R, puisque la
surexpression d’un dominant négatif de MyD88 bloque la signalisation et par conséquent
l’activation de NF-κB en réponse à l’IL-1 (Muzio et al., 1997). La production des cytokines
proinflammatoire, induite par le LPS et l’IL-1, dans les macrophages et les fibroblastes, est
fortement inhibée chez les souris déficientes en MyD88 (Adachi et al., 1998; Kawai et al.,
1999). De plus, les cellules déficientes en MyD88 ne répondent pas aux peptidoglycanes,
106
Figure 38: Signalisation TLR MyD88-dépendante et -indépendante
www.invivogen.com
107
flagelline, ADN CpG, ARNss indiquant l’importance du MyD88 dans la signalisation via
TLR2, TLR5, TLR7/8, TLR9 et TLR11 (Adachi et al., 1998; Beutler et al., 2005; Takeda,
Kaisho, and Akira, 2003; Yarovinsky et al., 2005) (Fig. 38). La signalisation MyD88dépendante est initiée par un changement conformationel du domaine cytoplasmique du TLR
induit par les PAMP, ce qui favorise l’association MyD88-TLR par leurs domaines TIR. En
aval, MyD88 recrute une sérine/thréonine kinase IRAK-4 via une interaction entre leurs
domaines de morts respectifs (Burns et al., 2003; Suzuki et al., 2002). Une fois liée au
MyD88, IRAK-4 recrute et phosphoryle IRAK-1 qui devient alors actif. IRAK-1 s’autophosphoryle, et recrute TRAF-6 au complexe MyD88/IRAK-4/IRAK-1. Ensuite, IRAK-1 et
TRAF-6 se détachent du complexe, et interagissent avec d’autres molécules pour activer les
JNK « c-Jun N-terminal Kinase » et IKK « Inhibitor of κB Kinase ». Enfin, ces kinases
induisent l’activation des facteurs AP-1 « Activator protein-1 » et NF-κB, et par conséquent la
transcription des gènes de cytokines proinflammatoires et des chimiokines tels que TNF-α,
IL-6, IL-8 et IL-1β (Chen and Goeddel, 2002; Hayden and Ghosh, 2004; Takeda and Akira,
2005).
1-4-2- Signalisation MyD88-indépendante/TRIF-dépendante
Comme nous l’avons vu précédemment, la délétion du MyD88 se traduit par une
signalisation aberrante et une diminution drastique de la production des cytokines induite par
la plupart des TLR. Cependant, la stimulation des cellules déficientes en MyD88 par le LPS
induit l’activation de NF-κB et des MAP kinases, bien qu’avec une cinétique tardive. De plus,
la stimulation des TLR4 et TLR3 active IRF3, un facteur de transcription clé nécessaire à
l’activation de la dernière étape de la voie NF-κB, indépendamment de MyD88 (Covert et al.,
2005; Kawai et al., 1999) (Fig. 38). Ces données suggèrent l’existence d’une signalisation
TLR indépendente du MyD88, ce qui a permis la caractérisation d’une molécule TICAM-1
« TRIF/TIR-containing adaptor molecule-1 », essentielle à la transduction du signal MyD88indépendant (Akira, Takeda, and Kaisho, 2001; Hoebe et al., 2003; Yamamoto et al., 2003a).
Bien que largement étudié, le mécanisme d’activation via lequel TRIF active NF-κB et IRF3
reste encore mal compris. La signalisation via IL-R1 et TLRs induit l’activation du facteur de
transcription NF-κB. Suite à la fixation des PAMP, les adaptateurs MyD88 ou TRIF et
TRAF6 sont recrutés au TLR et la kinase TAK1 est activée et initie la voie classique de NFκB en phosphorylant IKKβ (voir partie NF-κB) (Hayden and Ghosh, 2004). Cependant, les
108
doubles mutants MyD88 et TRAF6 activent partiellement NF-κB en réponse au LPS,
indiquant l’existence d’une signalisation TRAF6-indépendante, médiée par TRIF via TLR4
(Kawai et al., 2001).
1-4-3- Signalisation via d’autres protéines adaptatrices
L’identification des voies MyD88 et TRIF-dépendante, a aidé à la compréhension de
la signalisation des TLR. Cependant, d’autres molécules dites TIRAP « TIR-domaincontaining adaptor protein » et TRAM « TRIF-related adaptor molecule » ont été
caractérisées et servent d’adaptateurs entre MyD88 et/ou TRIF.
TIRAP/Mal : La protéine TIRAP sert d’adaptateur dans la voie MyD88-dépendante
induite par TLR2 et TLR4, d’où sa deuxième appellation Mal « MyD88-adaptor-like »
(Horng, Barton, and Medzhitov, 2001; Oshiumi et al., 2003a). Cette protéine semble
essentielle à l’activation de NF-κB et la production de TNF-α, IL-6 et IL-12p40, via TLR2 et
TLR4 (Horng, Barton, and Medzhitov, 2001). Mansell et al., ont récemment montré que
TIRAP possède un domaine d’interaction putatif avec TRAF6, et que les deux molécules coimmunoprécipitent ensemble (Mansell et al., 2004). Pourquoi TIRAP interagit spécifiquement
avec TLR2 et TLR4 et pourquoi est elle requise pour servir de pont entre MyD88 et cesTLR
n’est pas encore très claire.
TRAM/TIRP/TICAM-2 : En plus de TIRAP, l’adaptateur TRAM appelé aussi
« TRIP/TIR-containing adaptor molecule-2 », participe aussi à la transduction du signal à
partir de certains TLR. Des études ont montré que TRAM ne peut se lier qu’au domaine TIR
du TLR4 mais pas aux autres TLR et sert de pont entre TLR4 et TRIF (Oshiumi et al.,
2003b).
D’autre part, les cellules des souris déficientes en TRAM montrent une forte
diminution de la production des cytokines en réponse au LPS, mais continuent à répondre
normalement à l’IL-1 et aux ligands des TLR2, 3, 7 et 9 (Yamamoto et al., 2003b). On ne sait
pas encore pourquoi TRAM est utilisé spécifiquement par TLR4, bien que des études récentes
se sont intéressées au mécanisme avec lequel TRAM est spécifiquement recruté à la
membrane cellulaire pour la signalisation TLR4. Ainsi, il a été montré que TRAM contient un
site de myristoylation N-terminal, jouant un rôle essentiel dans sa co-localisation avec TLR4
(Rowe et al., 2006). Néanmoins, le degré des changements conformationels du TLR4 lors de
109
l’interaction avec son ligand, se traduit par un recrutement différentiel de TIRAP ou TRAM,
ce qui peut déterminer si la signalisation induite par TLR4 passe par MyD88 ou TRIF
respectivement.
1-5- TLR et remodelage de la chromatine
Nous avons vu que les TLR induisent l’activation des facteurs de transcriptions NF-κB
et AP-1. Cependant, les promoteurs des gènes cibles sont généralement masqués à cause du
super-enroulement de la chromatine autour des histones afin de compacter et protéger l’ADN.
Weinmann et al., ont montré que la signalisation LPS/TLR4 induit le remodelage de la
chromatine et par conséquent l’accessibilité de ces facteurs de transcription au niveau du
promoteur du gène IL-12p40 (Weinmann et al., 2001). Cependant, aucune étude n’a identifié
le mécanisme exact par lequel les TLR induisent le remodelage de la chromatine.
110
2- LA VOIE CALCIQUE
Le calcium (Ca2+) est un messager intracellulaire universel capable d’intégrer des
stimuli reçus à la surface cellulaire et de transmettre l’information. Il contrôle un large spectre
de processus cellulaires (Bootman et al., 2001) : transcription de gènes (Mellstrom and
Naranjo, 2001), contraction musculaire, prolifération cellulaire, sécrétion, mémoire,
apprentissage et diverses étapes du développement embryonnaire.
2-1- Le calcium libre, lié ou piégé
Dans les tissus calcifiés tels que les os et les dents, le calcium est piégé sous une forme
minérale avec le phosphate. Le niveau de calcium extracellulaire en revanche, est beaucoup
plus faible, et seulement la moitié existe sous forme libre. La partie restante est généralement
sous une forme liée aux protéines dans le milieu extracellulaire.
Alors que la concentration de calcium est d’environ 100 nM dans le cytoplasme, elle
est de l’ordre de 1 à 2 mM dans les stocks intracellulaires et dans le milieu extracellulaire. Le
gradient électrochimique est donc important et favorise l’entrée de calcium dans le cytosol
lorsque, suite à un signal reçu par la cellule, des canaux calciques situés au niveau des stocks
intracellulaires ou de la membrane cellulaire sont activés. Toute libération de calcium dans le
cytoplasme va se comporter comme un messager qui va initier des voies de signalisation.
Cependant, le calcium peut être toxique pour la cellule. Celle-ci cherche donc à maintenir un
bas niveau de calcium intracellulaire grâce aux calcium-ATPases, aux échangeurs
sodium/calcium et aux protéines capables de fixer le calcium. Cependant, de la même manière
qu’une hypercalcémie est dangereuse, l’hypocalcémie affecte l’excitabilité des membranes, à
l’origine de cas de tétanie et de décès.
Comment la cellule peut-elle contrôler cette homéostasie ?
111
Figure 39: Les récepteurs à l’IP3
Signal transduction. 2002
112
2-2- Maintien de l’homéostasie calcique
2-2-1- Réduction du calcium intracellulaire
Afin de maintenir un niveau bas de Ca2+ intracellulaire, la cellule met en jeu des
« Ca2+ binding proteins » qui agissent comme des pompes membranaires ou comme des
échangeurs d’ions. Les pompes sont des Ca2+-ATPases, protéines transmembranaires qui
exercent un transport actif primaire, qui permettent le passage de l’ion Ca2+ à travers la
membrane plasmique contre leurs gradients électrochimiques. Les échangeurs d’ions (Na+Ca2+), sont des protéines transmembranaires, qui exercent un transport actif secondaire,
utilisant le gradient électrochimique du Na+ intracellulaire à travers la membrane plasmique
pour transporter les ions Ca2+ hors de la cellule.
2-2-2- Augmentation du calcium intracellulaire
Les mécanismes d’augmentation du calcium intracellulaire impliquent l’entrée du Ca2+
à partir du milieu extracellulaire ainsi que sa libération à partir des réservoirs intracellulaires.
La perméabilité au calcium peut être médiée, au niveau du réticulum endoplasmique, par les
récepteurs aux IP3 et les récepteurs à la ryanodine et au niveau de la membrane plasmique,
par les canaux calciques voltage dépendant (VOCC), les canaux couplés à un récepteur
(ROCC) et les canaux activés par une déplétion des stocks intracellulaires (SOCC ou TRP).
a- Les canaux du réticulum endoplasmique
¾ Les récepteurs à l’IP3
Les récepteurs à l’IP3(IP3R) sont de grands complexes tétramériques de 1200 kDa
environ (homo ou hétéromériques). Chacune des sous-unités porte un site de fixation à l’IP3
au niveau cytoplasmique (Bootman et al., 2001; Taylor and Laude, 2002) (Fig. 39). Les IP3R
sont constitués de trois domaines : Un domaine de fixation à l’IP3 dans la région N-terminale,
un domaine à 6 segments transmembranaires (TMR), proches du coté C-terminal, qui
permettent l’ancrage et le ciblage des IP3R à la membrane du réticulum endoplasmique
113
Figure 40: Mobilisation du Ca2+ intracellulaire
Signal transduction. 2002
114
(Parker, Gergely, and Taylor, 2004) et un domaine de régulation qui sert à contrôler
l’ouverture ou la fermeture du canal.
La fixation d’une hormone ou d’un autre messager à des récepteurs spécifiques de la
membrane plasmique induit l’hydrolyse par la PLC du PIP2 membranaire en diacylglycerol
(DAG) et inositol 1,4,5-triphosphate (IP3) (Fig. 40). L’IP3 diffuse ensuite dans le cytoplasme
et se fixe aux récepteurs IP3R situés majoritairement à la surface du réticulum endoplasmique
(Bootman et al., 2001). Cette fixation du ligand modifie la conformation de l’IP3R pour
permettre aux ions calcium, séquestrés dans le réticulum endoplasmique, de passer dans le
cytoplasme. L’activation des récepteurs à l’IP3 joue un rôle majeur dans la production des
cytokines et la prolifération spécifique de l’antigène via la production d’IL-2 comme cela a
été montré dans les cellules de la lignée T Jurkat (Fraser, Straus, and Weiss, 1993; Jayaraman
et al., 1995).
¾ Les récepteurs sensibles à la ryanodine
Ces récepteurs sont activés par un alcaloïde végétal, la ryanodine. C’est une famille de
récepteurs présentant de fortes homologies avec le récepteur à l’IP3. En effet, le récepteur
ryanodine (RyR) est aussi un tétramère formé de 4 sous-unités associées en forme de trèfle
(Bootman et al., 2001). Le domaine cytoplasmique interagit avec le récepteur aux
dihydropyridines (ou canal calcique type L). Trois sites de fixation de calcium dans la région
N-terminale sont potentiellement impliqués dans la régulation en permettant la fixation d’un
grand nombre de modulateurs physiologiques. Parmi ces derniers, on trouve le calcium, ATP,
calmoduline et FKBP12. Le domaine C-terminal constitue le canal ionique.
Il existe 3 isoformes du RyR connues, codées par 3 gènes différents. Cependant,
contrairement aux récepteurs à l’IP3, les récepteurs ryanodine ne présentent pas la même
redondance fonctionnelle. Les récepteurs de type 1 (RyR1) sont présents dans le muscle
squelettique où ils interagissent directement avec les complexes de canaux calciques voltage
sensibles. Ceci requiert une proximité étroite entre le réticulum sarcoplasmique et la
membrane plasmique. Les récepteurs de type 2 (RyR2) en revanche, sont présents dans le
muscle cardiaque et certaines cellules nerveuses et n’interagissent pas avec les canaux
calciques de la membrane plasmique. Le récepteur type 3 (RyR3) est exprimé de façon
ubiquitaire dans le cerveau, les muscles et certaines cellules non excitables (Ogawa,
Kurebayashi, and Murayama, 2000).
115
b- Les canaux calciques de la membrane plasmique
¾ Les canaux calciques voltage dépendant (VOCC)
Les canaux calciques voltage dépendants « Voltage-operated calcium channels »
(VOCC), s’ouvrent en réponse à une dépolarisation membranaire et permettent l’entrée du
Ca2+. Ces canaux convertissent un signal électrique en un signal Ca2+ second messager. Les
VOCC se distinguent en deux catégories : Les canaux calciques « haut seuil » et les canaux
calciques « bas seuil » (Catterall, 2000).
Les canaux calciques « haut seuil » (types L, N, P, Q et R) sont des protéines
hétéromultimériques (Catterall, 2000). Ils sont activés par de fortes dépolarisations
membranaires. Parmi les canaux « haut seuil », les canaux calciques de type L ont été décrits
principalement dans les cellules du système nerveux, musculaires et endocrines (Abernethy
and Soldatov, 2002; Wang, Dolphin, and Kitmitto, 2004). Ce sont des cibles de la
dihydropyridine, tels que la nifedipine, qui agissent comme des bloqueurs de canaux.
L’interaction avec ces canaux calciques sensibles à la dihydropyridine (DHPR), initie la
libération du calcium soulignant ainsi le couple excitation-contraction.
Les canaux calciques « bas seuil » (type T) sont des canaux activés par de faibles
dépolarisations membranaires, (Perez-Reyes, 2003). Les courants correspondants présentent
une cinétique rapide et transitoire, et peuvent être enregistrés sur de nombreux types
cellulaires, cardiaques, neuronaux ou endocrines.
¾ Les canaux calciques couplés à un récepteur (ROCC)
Ils sont essentiellement exprimés dans les cellules sécrétrices et dans les terminaisons
nerveuses (Li, Westwick, and Poll, 2002). Les plus connus sont le récepteur nicotinique à
l’acétylcholine et le récepteur au N-méthyl-D-aspartate. Les ROCC sont activés par la fixation
d’un agoniste (ATP, sérotonine, glutamate, ou acétylcholine) sur le domaine extracellulaire du
canal. Des récepteurs glutamate sensibles au NMDA « N-methyl-D-aspartic » sont des canaux
ioniques post synaptiques très importants, qui permettent la transmission de l’excitation aux
synapses centrales. Pour que ces canaux s’ouvrent, deux conditions doivent être satisfaites :
ils doivent fixer le glutamate et la membrane sur laquelle ils sont localisés doit être
préalablement dépolarisée afin de mobiliser l’ion Mg2+ (Nowak et al., 1984).
116
¾ Les canaux TRP (Transient Receptor Potential)
Les canaux TRP sont des canaux activés par la déplétion des stocks intracellulaires de
calcium. Il existe trois grandes familles de TRP comportant chacune plusieurs isoformes :
TRP-C1-7 « canonical TRP », TRP-V1-6 « Vallinoïd receptor related TRP » et TRP-M1-8
« Melastatin related-TRP ». Ces canaux sont composés de 6 domaines transmembranaires et
s’assemblent en hétéro- ou homotétramères présents au niveau de la membrane cellulaire
(Putney, 2004). Une courte région hydrophobe entre les domaines transmembranaires 5 et 6
semble être impliquée dans la formation du canal (Hofmann et al., 2002; Putney, 2004).
Les fonctions cellulaires associées à ces canaux dans le système immunitaire
commencent à être décryptées. Les travaux de Mori et al., ont montré que la mutation de
TRPC1 atténue l’activation des courants CRAC « calcium release activated calcium
currents » par la déplétion des stocks intracellulaires de calcium et la libération de calcium des
stocks intracellulaires par l’IP3 dans la lignée de lymphocytes B DT40 (Mori et al., 2002). Le
facteur de transcription NF-AT n’est donc plus (ou peu) activé dans ces conditions. Il
existerait donc un couplage fonctionnel entre les récepteurs à l’IP3 du réticulum
endoplasmique et les canaux de la membrane plasmique (TRPC1) dans le lymphocyte B.
Dans les neutrophiles, l’activation de TRPM2 (Heiner, Eisfeld, and Luckhoff, 2003) et de
LTRPC2 (pour Long-TRPC2) (Heiner et al., 2003) est sensible à l’ADP ribose et pourrait donc
être activée suite à la stimulation du récepteur CD38 ou en réponse au stress oxydatif.
c- Les canaux calciques nucléaires
On trouve aussi des signaux calciques au niveau du noyau (Bootman et al., 2001).
L’enveloppe nucléaire est constituée d’une membrane externe en contact avec la membrane
du réticulum et d’une membrane interne. L’espace entre ces deux membranes, appelé cisterne,
constitue un réservoir à calcium. Il a été montré que le calcium contenu dans la cisterne
nucléaire joue un rôle important dans le contrôle du transport de molécules dont la taille est
comprise entre 500 Da et 60 kDa (Bootman et al., 2001). Ces deux membranes possèdent des
récepteurs à l’IP3 ainsi que des récepteurs ryanodine, en plus des ATPases calciques qu’on
retrouve uniquement au niveau de la membrane externe. Ces ATPases calciques sont
également présent au niveau de la membrane plasmique et du réticulum endoplasmique, et
117
permettent un transport actif du calcium. Les transports actifs sont beaucoup plus lents que les
transports passifs via les canaux ioniques (10 à 100 ions/s vs 107 ions/s). Ainsi, l’export du
calcium du cytosol vers le noyau par ces canaux retarderait l’inactivation de certains canaux
calciques par une forte concentration en calcium et permettrait donc de rallonger le signal
calcium (Aneiros et al., 2005).
2-3- Influx calcique et expression de gènes
Le contrôle de l’expression des gènes par le calcium est un phénomène largement
étudié. Le facteur de transcription NF-AT « Nuclear Factor of Activated T-cells » est activé
suite à un signal calcium (Crabtree, 2001). Il s’agit d’un complexe formé d’une sous unité
cytoplasmique (NF-ATc) et une autre nucléaire (NF-ATn) dissociées à l’état inactif. Suite à
l’augmentation de la concentration intracellulaire de calcium, la calmoduline liée au calcium
induit un changement de conformation de la calcineurine, une sérine/thréonine phosphatase,
qui déphosphoryle la sous-unité NF-ATc au niveau d’une séquence de localisation nucléaire
(NLS), lui permettant ainsi de transloquer dans le noyau où elle s’associe à la sous-unité NFATn. Ce nouveau complexe est un facteur de transcription actif (Crabtree, 2001). Dans
certaines circonstances, la calcineurine pourrait faciliter l’activation d’autres facteurs de
transcription comme NF-κB (Frantz et al., 1994) et AP-1 (Ullman et al., 1993).
Comme pour la calcineurine, le complexe calcium-calmoduline qui entraîne un
changement de conformation et une autophosphorylation d’une autre sérine/théonine kinase,
la calmoduline kinase (CaMK), en présence de fortes concentrations de calcium intracellulaire
(Nairn and Picciotto, 1994). Les CaMKs agissent sur des facteurs de transcription comme
CREB « Cyclic AMP Responsive Element Binding protein » ou la voie des MAP kinases via
la tyrosine kinase Pyk2.
Le calcium est capable de se fixer directement à la protéine DREAM « Downstream
Regulatory Element Antagonistic Modulator », connue pour se fixer à l’ADN afin de réguler
négativement la transcription des gènes (Carrion et al., 1999). DREAM agit donc comme un
répresseur transcriptionnel capable de détecter des variations de calcium au niveau du noyau
et de réguler directement l’expression de gènes cible.
118
Figure 41: Les isoformes des PKC
Signal transduction. 2002
119
3- LA VOIE DES PROTEINES KINASES C (PKC)
A la fin des années 1970, une enzyme appelée Protéine Kinase C (PKC), a été
découverte dans le cervelet des bovins (Takai et al., 1977). Il s’agit d’une sérine/thréonine
kinase recrutée principalement par le DAG membranaire suite à l’hydrolyse du PI (4,5) P2.
Depuis, 11 isoformes distinctes de PKC ont été identifiées chez l’Homme (Fig. 41).
Les isoformes de PKC ont été classées en trois groupes en fonction de leur structure et de leur
mode d’activation et de leurs substrats spécifiques.
- Les PKC classiques activées par le DAG et le calcium : PKC α, βI, βII, γ
- Les PKC non-classiques dont l’activation est indépendante du calcium : PKC δ, ε, η, θ et µ
- Les PKC atypiques dont l’activation est indépendante du calcium et du DAG et dépend
d’acides gras insaturés : PKC ζ et ι (appelée λ chez la souris).
Dans les cellules immunitaires notamment, les PKC sont impliquées dans la
prolifération, la survie, l’apoptose, l’activation et la différenciation cellulaires. De plus, ces
kinases semblent impliquées dans le développement embryonnaire, la perception de la
douleur, et le développement de la mémoire à long terme.
3-1- Distribution des PKC dans l’organisme
Les isoformes de PKC α, βI, βII et δ semblent être exprimées de façon ubiquitaire et
sont retrouvées dans la plupart des tissus (Hug and Sarre, 1993). L’expression de la PKC γ est
restreinte au système nerveux central et à la moëlle épinière (Nishizuka, 1988; Nishizuka,
1992; Wetsel et al., 1992). La PKC η est fortement exprimée au niveau de la peau et des
poumons mais très faiblement dans la rate et le cerveau (Bacher et al., 1991). La PKC θ est
présente de façon prédominante dans le muscle squelettique et dans une moindre mesure dans
le poumon, la rate, la peau et le cerveau (Osada et al., 1992). Enfin la PKC µ a été décrite
dans de très nombreux tissus. Elle est très fortement exprimée dans le thymus et les poumons
(Rennecke et al., 1996).
Cependant, la plupart des tissus est composée de divers types cellulaires. Ainsi au
niveau du monocyte, 8 isoformes de PKC sont exprimées : α, βI, βII, δ, ε, η, µ et ζ (Bennasser
and Bahraoui, 2002; Chang and Beezhold, 1993). La présence des isoformes de PKC semble
aussi évoluer en fonction de la différenciation des monocytes en macrophages (Monick et al.,
1998).
120
3-2- Structure des PKC
Un gène différent code pour chaque isoforme de PKC sauf pour les isoformes βI et βII
qui résultent d’un épissage alternatif à partir du même ARNm. La structure des PKC inclut
des domaines fortement conservés C1 à C4 interrompus par des régions variables V1 à V5 et
un pseudosubstrat (Ron and Kazanietz, 1999) (Fig. 41).
Les domaines C1-C4 : En partant de la région N-terminale, C1 et C2 constituent les
domaines régulateurs alors que C3 et C4 constituent le domaine catalytique commun à toutes
les PKC. Les PKC classiques et non-classiques contiennent une ou deux séquences C1 riches
en cystéines, nécessaires pour la fixation au DAG et aux esters de phorbols grâce à leur
structure en doigt de zinc. Le domaine C2 se lie aux phospholipides chargés négativement,
tels que les phosphatidyl sérines (PS), et permet également la fixation au calcium grâce à des
interactions électrostatiques (Banci et al., 2002). Le domaine C2 comprend aussi au moins
une partie du domaine de fixation des RACK1 « receptor for activated C kinase ».
Du côté C-terminal, les régions C3 à V5 forment le domaine catalytique. La région
C3 contient une séquence consensus de fixation à l’ATP similaire à celle que l’on retrouve
dans d’autres protéines kinases, sauf pour la PKC ζ qui possède une séquence légèrement
différente (Kemp and Pearson, 1990; Liu and Heckman, 1998). La région C4 quant à elle,
contient le site de fixation du substrat et le domaine impliqué dans le transfert de phosphate
(Hug and Sarre, 1993).
Les domaines régulateurs (C1 et C2) et catalytiques (C3 et C4) sont liées par une
région charnière. Lorsque l’enzyme est liée à la membrane, cette dernière devient sensible aux
enzymes protéolytiques telles que la trypsine, ce qui aiderait à un « Turnover » des PKC.
Le pseudosubstrat : Il s’agit d’un prolongement d’acides aminés (19-36 aa) du coté
N-terminal de la région C1. Cette séquence commune à toutes les PKC, ressemble aux sites
de phosphorylation consensus au niveau des substrats des PKC. Cependant, dans le
pseudosubstrat, la sérine est remplacée par une alanine, par conséquent, elle ne peut être
phosphorylée (House and Kemp, 1987). En absence de stimulus, le domaine catalytique se lie
au pseudosubstrat, permettant ainsi le repliement de l’enzyme en liant C2 et C3. Le domaine
catalytique ainsi bloqué, la PKC est donc maintenue à l’état inactif (Ron and Kazanietz,
1999).
121
Figure 42: Activation des PKC par phosphorylation
Signal transduction. 2002
122
3-3
Activation des PKC et leur régulation
a- Activation par phosphorylation
L’activation des PKC requiert la phosphorylation du domaine catalytique dans la
boucle d’activation, et le détachement du pseudosubstrat du site actif (Newton, 1997) (Fig.
42).
La PKC est synthétisée sous forme de précurseur inactif non phosphorylé,
probablement lié au cytosquelette. A ce stade, le site catalytique est accessible à l’ATP, mais
l’enzyme est catalytiquement incompétente (Dutil and Newton, 2000). Plus tard, la boucle
d’activation est phosphorylée (Thr 500), probablement par une PDK1 (protéine kinase 1
phosphoinositide dépendante), une protéine kinase dépendante des phospholipides également
impliquée dans l’activation de la protéine kinase B (Le Good et al., 1998). Sans cette première
phosphorylation, les PKC α et β ne sont pas actives alors que d’autres kinases comme la PKC
δ ne sont que peu actives. Quant aux PKC atypiques, le résidu thréonine est remplacé par un
acide glutamique dont la charge négative mime la phosphorylation. S’en suivent deux
autophosphorylations (Thr 641, Ser 660) en C-terminal du domaine catalytique (Fig. 42). La
forme mature de PKC est maintenant catalytiquement compétente, mais resterait inactive à
cause de l’apposition du pseudosubstrat et du domaine catalytique (Parekh, Ziegler, and
Parker, 2000).
Des phosphorylations sur des tyrosines peuvent aussi réguler positivement ou
négativement l’activité des PKC en fonction des substrats. Ce phénomène a été observé pour
la PKC δ et impliquerait les kinases c-Src ou c-Fyn dans les kératinocytes et la kinase Lyn
dans des cellules leucémiques (Song et al., 1998; Zang et al., 1997).
b- Activation par le DAG
L’activation des PKC requiert la présence simultanée du DAG et du calcium. De
manière générale, presque tous les ligands, les facteurs de croissance, les hormones et les
neurotransmetteurs, induisent d’une façon ou d’une autre la production du DAG et de
l’inositol triphosphate (IP3). Ce qui voudrait dire que les PKC sont impliquées dans un grand
nombre de réponses cellulaires.
123
Figure 43: Activation des PKC par le DAG
Forme active des PKC
Les domaines C1-C4 conservés sont des modules fonctionnels
C1 : se lie au DAG ou au phorbol ester
C2 : liaison des phospholipides renforcée par le Ca2+
C3+C4 constitue le domaine catalytique
Signal transduction. 2002
124
L’hydrophobicité et la petite taille du DAG lui permettent de diffuser latéralement
dans les membranes cellulaires de manière assez rapide. Cependant le DAG a une courte
demie vie, car il peut être dégradé par les DAG lipases (pour former du glycérol ou des acides
gras), ou converti en phosphatidate sous l’action des DAG kinases (Sakane and Kanoh, 1997).
Le DAG membranaire lie le site hydrophobe du domaine C1, ce qui permet à la PKC de se
loger dans la membrane avec une forte affinité pour la PS (Fig. 43). En effet en l’absence de
DAG, les PKC se fixent avec une faible affinité aux membranes anioniques sans discriminer
les types de lipides auxquels elles se fixent. Le calcium qui se fixe au domaine C2 serait
impliqué dans cette interaction. Ce recrutement membranaire des PKC entraîne un
changement conformationnel au niveau du domaine catalytique, qui permet sa dissociation du
pseudosubstrat auto-inhibiteur. La PKC est alors complètement active.
c- Activation par d’autres lipides
Plusieurs lipides seconds messagers et médiateurs peuvent activer l’effet du DAG et
calcium, ou activer directement les PKC. Les PKC non-classiques sont activées par de plus
faibles concentrations en acides gras que les PKC classiques. Les 3-phosphoinositide 3kinases PI(3,4)P2 et PI(3,4,5)P3 activent aussi bien les PKC non-classiques (δ, ε et θ), et
atypiques (ζ) dans un environnement riche en PS (Toker et al., 1994). Les acides gras
insaturés, plus spécialement l’acide arachidonique, l’acide lisophosphatidique (LPA) et lysophosphatidylcholine (lysoPC), peuvent également activer les PKC. Ces lipides potentialisent
les effets du DAG à des concentrations basales de calcium (100 nM) (Sando and Chertihin,
1996). Les dérivés de sphingolipides inhibent les PKC conventionnels en masquant leur
interaction avec les PS (Hannun and Bell, 1989). Les PKC atypiques ne sont pas activé par le
DAG ou les esters de phorbol, mais sont activés par d’autres produits lipidiques, tels que
PI(3,4,5)P3, l’acide lysophosphatidique et les céramides. Seule la PKCλ peut être activé par
une protéine, LIP « lambda-PKC interaction protein » (Diaz-Meco et al., 1996).
3-4- Protéines d'ancrage et localisation subcellulaire des PKCs
Bien que les PKC se transloquent typiquement à la membrane lors de leur activation,
leur localisation membranaire semble transitoire si elle n’est pas stabilisée par d’autres
125
mécanismes. Ces mécanismes mettent en jeu des protéines d’ancrage qui se lient aux PKC et
les ciblent vers des sites subcellulaires spécifiques. Ces protéines d’ancrage sont inhibitrices,
comme les AKAP « cAMP-dependent A-kinase anchoring proteins » et les RICK « Receptor
for Inactive C-Kinase », ou activatrices, comme les RACK « Receptor for Activated CKinase », les STICK « Substrate That Interact with C-Kinase », la caveoline et les PICK
« Protein interacting with C-kinase ». Ces protéines lient le cytosquelette d’actine avec la
membrane plasmique en se liant à la PS et agissent comme des substrats des PKC. Ce qui
implique
que
les
PKC
jouent
un
rôle
dans
la
régulation
de
l’interaction
membrane/cytosquelette.
La fonction principale de ces protéines d’ancrage est donc de positionner les isoformes
de PKC à des localisations subcellulaires appropriées, afin de répondre à des signaux
d’activation spécifiques ce qui participe à la spécificité de substrat de chaque isoforme.
La protéine AKAP79 inhibe l’activité des PKC grâce à un oligopeptide basique situé
près de sa région N-terminale. Lors du processus d’activation, la calcium-calmoduline de
même que le DAG induisent une dissociation des PKC de la protéine AKAP79 (Faux and
Scott, 1997).
La protéine RICK constituerait une protéine d’ancrage pour la PKC θ dans les
lymphocytes T et inhiberait la translocation et la fonctionnalité de la PKC θ (Meller et al.,
1996).
Les protéines RACK interagissent avec le domaine C2 ou C2-like des PKCs (Csukai
et al., 1997; Ron et al., 1999). RACK1 se lie spécifiquement à l’isoforme βII (Ron et al., 1994,
1995) et RACK2 à l’isoforme ε (Csukai et al., 1997; Ron et al., 1999).
Les protéines STICK (vinculine, MARCKS, adducine et annexine) interagissent avec
les PKC qui peuvent en retour les phosphoryler. La Sdr « serum deprivation protein », un
autre type de STICK, se lie à la PKC α et la recrute au niveau des cavéoles (Mineo et al.,
1998).
La cavéoline elle-même joue le rôle de protéine d’ancrage. Elle se fixe à certaines
isoformes de PKC comme la PKC α et la PKC ζ (Oka et al., 1997).
La protéine PICK1 interagit avec la PKC α et induit sa relocalisation au niveau de la
mitochondrie (Wang et al., 2003).
126
3-5- Substrats et fonctions des PKCs
De nombreux substrats des PKC ont été identifiés. Le motif consensus phosphorylé
par les PKC est du type « ArgXXSerXArgX » ou « ArgXXThrXArgX ». Au niveau des
positions -6, -4 et -2 du résidu sérine ou thréonine, toutes les isoformes de PKC ont une
sélectivité pour les résidus basiques. Cependant, au niveau des positions +2, +3 et +4, alors
que les substrats des PKC classiques ont préférentiellement des résidus basiques, les substrats
des PKC non-classiques et atypiques ont des résidus hydrophobes. La PKC µ agit sur un
motif différent. Il aurait une forte sélectivité pour les substrats ayant un résidu leucine en
position –5 (Ron and Kazanietz, 1999).
Les premières études in vitro ont montré que chaque isoforme de PKC peut agir
différemment sur un substrat donné (Dekker and Parker, 1994; Nishikawa et al., 1997).
Contrairement aux PKC βII, et ε les PKC α, βI et γ possèdent une plus grande activité kinase
vis-à-vis de la GSK-3β « glycogen synthase kinase-3β », une kinase qui phosphoryle
notamment c-jun. D’autres substrats inégalement phosphorylés par les différentes isoformes
de PKC ont été identifiés, comme le substrat neuronal GAP-43, l’EGF-R « epidermal growth
factor receptor », ou encore le récepteur de la vitamine D.
Des expériences in vivo ont permis de déterminer le rôle crucial des PKC α, βI et γ
(mais pas ε) dans la phosphorylation du récepteur à l’insuline (Chin et al., 1993). D’autres
études ont montré que le traitement de cellules de leucémie érythroïde avec la bryostatine, qui
permet aux cellules de proliférer, mais pas de se différencier, entraîne une translocation
nucléaire de la PKC βII mais pas de la PKC α (Hocevar, Burns, and Fields, 1993). La PKC βII
peut alors phosphoryler la lamine B qui pourrait influencer la stabilité de la structure de la
lamine nucléaire (Hocevar, Burns, and Fields, 1993).
Ainsi, de nombreuses fonctions sont associées aux PKC. Elles sont impliquées dans
les mécanismes de sécrétion et d’exocytose, la modulation de la conductance, la régulation de
l’interaction de certains récepteurs avec des composants des voies de transduction de signaux
ou encore la contraction des muscles lisses, l’expression de gènes et la prolifération cellulaire.
Ces diverses fonctions peuvent faire intervenir plusieurs isoformes de PKC.
127
3-6- PKC et agents infectieux
La protéine kinase C est associée à de nombreux processus cellulaires capables de
favoriser l’infection virale dans les cellules cibles.
La voie PKC joue un rôle important dans l’étape d’entrée et l’infectiosité de plusieurs
virus enveloppés comme les rhabdovirus, alphavirus et herpesvirus (Constantinescu,
Cernescu, and Popescu, 1991). Récemment, il a été montré qu’en présence de la calphostine,
un inhibiteur des PKC classiques, les adénovirus de type 2 n’atteignent plus les endosomes et
s’accumulent dans le cytoplasme (Nakano et al., 2000). De même, il a été montré que
l’interaction du virus de la grippe avec son récepteur conduit à l’activation des PKC βII qui
jouerait un rôle important dans le trafic viral au niveau des endosomes tardifs (Sieczkarski,
Brown, and Whittaker, 2003). La PKC α jouerait un rôle dans la fusion du RSV « Respiratory
Syncitial Virus » avec les cellules épithéliales bronchiques (San-Juan-Vergara et al., 2004).
La protéine de core du virus de l’hépatite C nécessite sa phosphorylation par les PKC pour
pouvoir transloquer dans le noyau.
Concernant l’infection VIH-1, les PKC participent à l’activation cellulaire et seraient
impliquées dans la réactivation du virus latent dans les lymphocytes T. Les PKC seraient
aussi capables de phosphoryler des protéines du VIH-1. En effet, la phosphorylation par les
PKC des protéines p17gag (Burnette, Yu, and Felsted, 1993), Nef (Carl et al., 1999; Guy et
al., 1990) et Rev (Hauber et al., 1988) a été décrite. Les sites de phosphorylation de ces
protéines virales sont conservés. Ils joueraient donc un rôle important dans le cycle viral. La
protéine Nef se lierait à la protéine adaptatrice RACK1, ce qui lui permettrait de recruter des
PKC. La PKC θ notamment interagirait avec la protéine Nef et régulerait ainsi l’activation des
lymphocytes T.
128
Figure 44: Familles des MAP Kinases et leurs substrats
129
4- LA VOIE DES MAP KINASES
4-1- La famille des MAPK
Les MAPKs « Mitogen Activated Protein Kinases », forment une famille de sérinethréonine kinases qui régule l’expression des gènes et de nombreuses fonctions cellulaires
comme la mitose, la survie, l’apoptose et la différenciation (Chen et al., 2001; Kyriakis and
Avruch, 2001). La famille des MAPK est constituée de quatre groupes principaux : Les ERK1
et ERK2 « Extracellular signal-Related Kinases », les p38α/β/γ/δ, les JNK1 à 3 « c-Jun NH2terminal Kinase » aussi appelées SAPK1-3 « Stress-Activated MAP Kinase » et finalement
ERK5 (Schaeffer and Weber, 1999) (Fig. 44). Ces MAPK sont activées par une double
phosphorylation du motif tripeptidique Thr-Xaa-Tyr. La séquence de ce motif tripeptidique
est spécifique à chaque MAP kinase : ERK (Thr-Glu-Tyr) ; p38 (Thr-Gly-Tyr) ; et JNK (ThrPro-Tyr) (Dong, Davis, and Flavell, 2002). La double phosphorylation de Thr et Tyr est
médiée par une cascade de kinase conservée qui commence par les MAPK-kinase-kinase ou
MAP3K. Ces dernières phosphorylent les MAPK-kinases (MKK) qui à leur tour activent les
MAPK en les phosphorylant. Une fois activées, les MAPK phosphorylent leurs substrats sur
des résidus sérine ou thréonine suivis d’une proline (Chang and Karin, 2001). Mais la
spécificité des substrats est surtout régulée par des acides aminés précis, présents sur les
substrats, qui assurent une plus grande spécificité d’interaction (Tanoue et al., 2000).
Les MAPKs peuvent être activés par divers agonistes de récepteurs à activité tyrosine
kinase ou de récepteurs à sept domaines trans-membranaires couplés à la protéine G. Ils
peuvent également être activés par les cytokines ainsi que par les stress physiques ou
chimiques, mais les cascades menant à l’activation des MAPK peuvent paraître complexes.
a- Les MAPK ERK1/2
Elles sont activéss en réponse à des signaux mitogènes (facteurs de croissance et
phorbol esters) et à des stimuli de prolifération et de stress cellulaires tels LPS, TNF, CSF-1,
M-CSF, IFNγ (Rao, 2001). En réponse à des signaux, les protéines Raf (Raf-1, A-Raf et BRaf), faisant partie des MAP3K, sont activées et phosphorylent MEK1 et 2 qui phosphorylent
à leur tour ERK1/2 sur un motif Thr-Glu-Tyr conservé dans leur boucle d’activation
(McCubrey et al., 2000) (Fig. 45). Suite à leur activation, les ERK1/2 s’accumulent dans le
130
Figure 45: Activation des MAP kinases
Chen Dong. MAP Kinases in the immune response.
Annu. Rev. Immunol. 2002
131
noyau (Pouyssegur, Volmat, and Lenormand, 2002) pour phosphoryler des facteurs de
transcription comme NF-κB (Tuyt et al., 1999), NF-AT, Elk1 (Janknecht et al., 1993), STAT
3 (O'Rourke and Shepherd, 2002) et CREB, mais aussi des substrats non nucléaires comme
des protéines du cytosquelette (Chen et al., 2001). L’activation de la voie des ERK1/2 mène à
la transcription de plusieurs gènes ou à leur régulation post-transcriptionnelle ainsi qu’à la
réplication de l’ADN et au contrôle du cycle cellulaire (Chang and Karin, 2001). Elle stimule
aussi la production de NO (Blanchette, Jaramillo, and Olivier, 2003), TNFα (Dumitru et al.,
2000) et d’IL-6 (Tuyt et al., 1999).
b- Les p38 MAPK
Composés de quatre membres p38α/β/γ/δ, dont p38α est la plus étudiée. Elles sont
activées en réponse à des stress environnementaux, à des cytokines inflammatoires, à des
facteurs de croissance (GM-CSF, IL-3) et au TGFβ. En réponse à ces signaux, des protéines G
Rho comme Rac et Cdc42 sont activées (Bagrodia et al., 1995; Nagata et al., 1998; Tibbles et
al., 1996; Zhang et al., 1995) et activent les MKKK telles MTK1, MLK2/3 et TAK1 (Ono and
Han, 2000). Ces dernières activent les doubles kinases MKK3/4/6/7 qui phosphorylent enfin
p38 sur leurs résidus thréonine et tyrosine (Han et al., 1996) (Fig. 45). Parmi les substrats des
p38 on retrouve les MAPKAP-K2/3 « MAPK-Activated Protein Kinase » qui vont activer à
leur tour CREB et ATF1 (Tan et al., 1996). MNK1 « MAP Kinase Interaction Protein Kinase
est aussi phosphorylée par p38 et est impliquée dans l’initiation de la traduction (Waskiewicz
et al., 1997). p38 active également des facteurs de transcription tels STAT1 (Goh, Haque, and
Williams, 1999), ATF1/2, p53, C/EBPβ, et induit la liaison au site AP-1 en régulant c-jun, cfos et par la liaison d’ATF2 avec des membres de la famille Jun. Toute cette cascade entraîne
la production de plusieurs cytokines pro-inflammatoires (IL-1β, TNFα, IL-6), de COX-2,
d’iNOS et de molécules d’adhésion. Les p38 MAPK sont impliquées également dans la
prolifération et la différentiation cellulaire, de même que dans l’apoptose (Ono and Han,
2000). Elles jouent aussi un rôle essentiel dans le système immunitaire où elles participent à la
réponse des macrophages et neutrophiles (Ono and Han, 2000).
132
c- Les JNK/SAPK
Ces kinases sont fortement activées en réponse aux cytokines telles que TNFα et IL-1,
à des stimuli de stress et, dans une moindre mesure, à des facteurs de croissance et des
récepteurs couplés aux protéines G (Ip and Davis, 1998; Kyriakis and Avruch, 2001). Leur
nom vient du fait qu’elles lient la portion N-terminale de la protéine c-Jun et la phosphoryle
sur deux de ses sérines, mais elles sont aussi responsables de la phosphorylation d’autres
protéines formant le facteur de transcription AP-1 telles JunB, JunD et ATF2(Weston and
Davis, 2002). Comme les p38 MAPK et les ERK1/2, les JNK/SAPK sont doublement
phosphorylées sur un motif conservé Thr-Pro-Tyr par une action synergique de MKK4 et
MKK7. Bien que ces dernières soient toutes deux capables de phosphoryler la thréonine et la
tyrosine de JNK, on note une préférence de MKK4 pour la tyrosine et de MKK7 pour la
thréonine (Lawler et al., 1998) (Fig. 45). Contrairement aux MEK1 et 2 exclusivement
cytoplasmiques, les MKKs ont une distribution cytoplasmique et nucléaire, ce qui permet la
phosphorylation des JNK dans les deux compartiments (Tournier et al., 1999). Tout comme
pour les ERK1 et 2, la cascade d’activation des JNKs nécessite des protéines d’échafaudage
telles que JIP1 ou JIP2, qui relie JNK, MKK7 et une MAP3K (Whitmarsh et al., 1998;
Yasuda et al., 1999). Selon le contexte, les JNKs sont impliquées dans l’apoptose ou dans la
survie cellulaire (Ip and Davis, 1998) et dans la production de cytokines telles que l’IFNα/β et
l’IL-6 pour l’activation de la réponse innée antivirale (Chu et al., 1999).
4-2- MAPKs et agents infectieux
L’activation de la voie MAPK semble être étroitement liée à la réplication du VIH. En
effet, il a été établi que les MAP kinases ERK1/2 activent le LTR du VIH en réponse aux
cytokines en activant les facteurs de transcription NF-κB et AP-1 dans les cellules T (Yang,
Chen, and Gabuzda, 1999; Yang and Gabuzda, 1999). De plus l’infection de lignées de
cellules T par le VIH conduit à l’activation de ERK1/2 via la voie de signalisation
Ras/Raf/MEK et que l’activation préalable de cette voie s’accompagne d’une augmentation
du pouvoir infectieux du virus alors que son inhibition conduit à une diminution du titre viral
(Yang and Gabuzda, 1999). De manière similaire, p38 MAPK est activée lors de l’infection
des lymphocytes T primaires par le VIH, et semble jouer un rôle critique dans la réplication
133
du virus (Cohen et al., 1997a). L’activation de la p38 nécessite l’internalisation du VIH dans
les cellules et son inhibition bloque la réplication virale (Cohen et al., 1997a).
La voie des MAPK joue également un rôle important dans le cycle de réplication de
nombreux autres virus. La réplication du virus de l’influenza est fortement inhibée suite au
blocage de la voie des MAP kinases (Raf/MEK/ERK) par le U0126 (un inhibiteur spécifique
de MEK), en interférant avec le transport des nucléoprotéines du noyau vers le cytoplasme
(Pleschka et al., 2001). Des résultats similaires ont été rapportés pour le virus neurotropique
BDV « Borna Disease Virus », montrant que l’inhibition de la voie MAP kinase se traduit par
le blocage de la propagation du virus aux cellules avoisinantes (Planz, Pleschka, and Ludwig,
2001).
134
Figure 46: Famille NF-κ
κB
Li, Q. et al., 2002;
Nature reviews Immunology
135
5- LA VOIE NF-κB
La voie NF-κB « Nuclear Factor-κB » joue un rôle clé dans le contrôle de l’immunité
innée et adaptative. Elle régule la transcription des gènes cibles tels que les gènes des
cytokines, chimiokines, protéines de réponse au stress et des protéines anti-apoptotiques.
L'activation de NF-κB a été décrite après stimulation par le LPS et les cytokines
proinflammatoires TNF-α et IL-1β. Cette voie met en jeu plusieurs acteurs qui ont chacun un
rôle bien précis et essentiel dans sa régulation.
5-1- Les protéines NF-κB
Comme pour toutes les familles de facteurs de transcription, la famille NF-κB compte
plusieurs membres chez les mammifères : Rel A (p65), NF-κB1 (p50 ; p105), NF-κB2 (p52 ;
p100), c-Rel et Rel B. Ces protéines possèdent toutes une région amino-terminale de 300 aa
hautement conservée, dite RHD « N-terminal Rel homology domain » qui permet la liaison à
l’ADN, la dimérisation ainsi que l’association à la protéine inhibitrice IκB (Baeuerle and
Baltimore, 1996; Ghosh, May, and Kopp, 1998) (Fig. 46). Tous les membres de la famille
NF-κB, excepté Rel B peuvent former des homo- ou des hétérodimères. Les protéines c-Rel,
Rel B et Rel A possèdent un domaine de transactivation C-terminal, qui permet une forte
activation de la transcription des gènes suite à leur fixation sur leur site NF-κB au niveau du
promoteur. Les autres protéines Rel, tels que les homodimers p50 et p52, sont dépourvues de
ce domaine de transactivation, et leur liaison à la séquence consensus au niveau du promoteur
a plutôt un effet répresseur (May and Ghosh, 1997). Les protéines p52 et p50 sont générées
suite à une maturation protéolytique de leurs précurseurs respectifs p105 et p100 (Silverman
and Maniatis, 2001).
Alors que p50 et p65 sont exprimées dans plusieurs types cellulaires, l’expression de
Rel B est restreinte à des régions spécifiques du thymus, des nodules lymphatiques et des
plaques de Payer. L’expression de c-Rel est, quant à elle, confinée dans les cellules
hématopoïétiques et les lymphocytes.
Les modèles de souris « knock out » pour certains membres de la famille NF-κB
indiquent des rôles distincts de ces protéines dans la régulation de l’immunité innée et
adaptative, la fonction des lymphocytes et la survie cellulaire. La délétion de la sous-unité p65
est une mutation embryonnaire létale conduisant à une dégénérescence du foie. Par contre, les
136
Figure 47: Les protéines IKK
Hans Häcker, H. et al., 2006
Science STKE
137
souris knockout pour les autres protéines sont immunodéficientes mais ont un développement
normal (Ghosh, May, and Kopp, 1998).
En aval des signaux membranaires engendrés par des interactions récepteur-ligand ou
par des inducteurs exogènes, sont activées des protéines kinases essentielles à l’activation de
la voie NF-κB.
5-2- Les protéines IκB Kinases : IKK
Le premier événement dans l’activation de NF-κB est l’activation du complexe
protéique IKK appelé « signalosome ». Ce complexe de 700-900 kDa est composé de
plusieurs protéines dont trois sous-unités : les protéines kinases IKK1 (IKKα), IKK2 (IKKβ)
et la protéine adaptatrice IKKγ (NEMO, IKKAP) (Karin and Ben-Neriah, 2000).
5-2-1- Les protéines kinases IKKα et IKKβ
¾ Définition
IKKα et IKKβ sont des sérines/thréonines kinases de 85 et 87 kDa respectivement. Il
s’agit de deux sous-unités catalytiques, ayant 52% d’homologie de séquence et 65%
d’homologie au niveau de leur domaine catalytique (DiDonato et al., 1997; Mercurio et al.,
1997). Au niveau structural, ces kinases sont composées de (Fig. 47):
- Un domaine kinase, une boucle d'activation de type MAP kinase kinase, comprenant le
motif Ser176XXXSer180 pour IKKα et un motif Ser177XXXSer181 pour IKKβ.
- Un domaine en "leucine zipper" permettant la dimérisation
- Un domaine en "hélice-boucle-hélice", indispensable pour l'activation du complexe.
Bien que les fonctions biochimiques d’IKKα et IKKβ semblent être très similaires in
vitro, des analyses génétiques ont montré qu’elles ont des fonctions très différentes in vivo.
Comme pour les souris KO p65, les souris KO IKKβ meurent d’une apoptose du foie après
13-14 jours de naissance. En effet l’absence d’IKKβ se traduit par une forte diminution de la
dégradation d’IκBα (voir plus loin) et l’activation de NF-κB. Dans les cellules KO IKKα et
suite à la stimulation par TNF-α et IL-1, la phosphorylation et la dégradation d’IκBα est
138
Figure 48: Activation des protéines IKK
Modifiée d’après Hans Häcker, H. et al., 2006
Science STKE
139
normale, mais NF-κB perd sa capacité de liaison à l’ADN et d’induction d’expression des
gènes NF-κB dépendants (Li et al., 1999; Sizemore et al., 2002). Ceci indique que la protéine
IKKα joue un rôle dans la transactivation des gènes NF-κB indépendamment de la
dégradation d’IκBα. Par ailleurs, l’activité kinase de IKKα est également requise pour la
dégradation du précurseur p100 induite par NIK « NF-κB inducing kinase » (voir plus loin),
protéine de type MAP3K, mais également par un membre de la famille des MAP kinases JNK
: MEKK1.
La formation d'un complexe actif nécessite l'homodimérisation ou l'hétérodimérisation
des sous unités catalytiques, via les motifs en leucine zipper. Une mutation au niveau de ce
motif abolit l'activité kinase de la protéine. Cependant, in vitro, l'activité kinase des dimères
formés est différente. Ainsi, l'homodimère formé de deux sous-unités IKKβ a une activité
kinase supérieure à l'homodimère IKKα. De plus, au niveau de l'hétérodimère, la
phosphorylation de la sous-unité IKKβ peut être suffisante pour activer le complexe. En effet,
un hétérodimère formé d'une sous-unité IKKα mutée, a une activité kinase similaire à celle
d'un hétérodimère sauvage. Enfin, l'assemblage des complexes pourrait être différent en
fonction du stimulus (Karin and Delhase, 2000).
¾ Activation des dimères IKK
L'activation du complexe dimérique IKK dépend de sa phosphorylation. Comme
d’autres protéines kinases, IKKα et IKKβ contiennent des boucles d’activation au niveau de
leur domaine kinase. Cette région contient des sites spécifiques dont la phosphorylation induit
un changement conformationel permettant l’activation de la kinase (Johnson, Noble, and
Owen, 1996). La mutation de la lysine 44 conservée dans ce domaine, génère une forme
inactive d’IKKα et IKKβ {Mercurio, 1997 #1415; Woronicz, 1997 #1417; Zandi, 1997
#1416}. Le remplacement des sérines 177 et 187 dans la boucle d’activation d’IKKβ par
l’alanine prévient l’activation du complexe (Mercurio et al., 1997). L’activation du dimère
IKK a lieu en plusieurs étapes décrites dans la figure suivante (Fig. 48):
Suite à la formation du dimère, le domaine bHLH interagit avec le domaine
d’activation. Le complexe est alors prêt à être activé. Suite à l’activation de la cellule, l’une
des deux sous-unités IKK est phosphorylée sur leur motifs sérine par une kinase en amont
appelée NIK « NF-κB inducing kinase » et s’en suit une trans-phosphorylation de la
deuxième sous-unité. Le complexe actif phosphoryle alors la protéine inhibitrice IκB. En
140
même temps les protéines IKKs auto-phosphorylent leur régions C-terminales. Lorsque 9
sérines ou plus de la région C-terminale sont phosphorylées, l’interaction entre cette région
qui contient le motif bHLH et le domaine kinase est altérée, à cause de l’accumulation des
charges négatives qui engendrent une répulsion entre les deux domaines. L’activité d’IKK est
alors diminuée, et à ce stade IKK devient plus susceptible d’être davantage inhibée par
l’action des phosphatases.
5-2-2- La protéine IKKγ
La troisième sous unité IKKγ appelée aussi NEMO « NF-κB Essential Modulator »
quant à elle, ne possède pas d’activité kinase intrinsèque mais contient une bHLH et un motif
« Leucine Zipper » connus pour leur rôle dans les interactions protéines-protéines (Karin and
Ben-Neriah, 2000). NEMO est néanmoins un membre important du complexe IKK. En effet,
des mutations de ce gène sont associées à différentes maladies chez l’Homme : Incontinentia
Pigmenti (IP) ; Anhidroti Ectodermal Dysplasia whith Immunodeficiency, liées à une perte
d’activité NF-κB (Doffinger et al., 2001; Smahi et al., 2000). Jusqu’à présent, les mécanismes
de régulation de la voie NF-κB par NEMO restent encore très peu élucidés. Il a été rapporté
qu’après interaction avec différentes molécules de transduction en amont du complexe,
NEMO subit une oligomérisation et active ensuite le complexe IKK (Inohara et al., 2000). La
protéine NEMO est également régulée par phosphorylation, puisqu’une mutation sur les
Ser85 et Ser41 induit l’abolition de la phosphorylation d’IKKβ et IκBα en réponse au TNF-α,
IL-1 ou LPS (Carter et al., 2001; Tarassishin and Horwitz, 2001).
L'ensemble du complexe capable de phosphoryler IκB in vivo et in vitro est nommé
signalosome, son isolement a montré qu'il a une taille de 900 kDa, ce qui suggère la présence
d’autres composants. Deux éléments supplémentaires au complexe IKK ont été identifiés :
CDC37 « Cell Division Cycle 37 » et HSP90 (Chen, Cao, and Goeddel, 2002). L’importance
fonctionnelle de ces protéines a été démontrée par traitement des cellules à la Geldanamycin,
un agent anti-tumoral qui interfère avec la fonction de HSP90. Ce traitement réduit la taille du
signalosome et inhibe son recrutement au TNFR1. Par ailleurs, il n’est pas encore clair si
CDC37 et HSP90 ont un rôle quelconque dans la signalisation en plus de leur rôle dans
l’assemblage du signalosome (Kelliher et al., 1998).
141
Figure 49: Famille des protéines Iκ
κB
Domaine ARD
Modifiée d’après Li, Q. et al., 2002;
Nature reviews Immunology
142
Récemment de nouvelles protéines ont été identifiées : IKK-i (IKKε) et TBK1 (T2K
ou NAK). Bien qu’elles aient une certaine homologie avec IKKβ, ces deux protéines ont des
fonctions distinctes et ne sont pas des composants du signalosome (Kishore et al., 2002).
IKK-i intervient dans la signalisation induite par le LPS mais pas dans celle du TNF dans les
cellules immunitaires. Les souris KO TBK1 meurent d’une apoptose hépatique au 12ème jour
de la phase embryonnaire (Bonnard et al., 2000). Il semble par ailleurs que TBK1 régule
l’activation de la voie NF-κB indépendamment de la dégradation d’IκBα (Bonnard et al.,
2000).
5-3- La protéine NIK
NIK « NF-κB Inducing Kinase », est une kinase qui se place en amont du
signalosome. NIK a d’abord été identifiée par son association à TRAF2 (Malinin et al., 1997)
et sa capacité à activer potentiellement NF-κB quand elle est surexprimée (Ling, Cao, and
Goeddel, 1998; Malinin et al., 1997). L’expression d’une protéine NIK catalytiquement
inactive bloque l’activation de NF-κB et de IKK en réponse à une large gamme de stimuli
incluant TNF-α. Cependant des études récentes ont montré que NIK agit en réponse aux
ligands et pas aux inducteurs tels que leTNF-α (Viatour et al., 2005). NIK peut se lier à IKKα
et l’activer par phosphorylation sur la Ser176, facilitant ainsi la phosphorylation de p100
(Ling, Cao, and Goeddel, 1998; Woronicz et al., 1997). L’activation d’IKKα par NIK peut
également phosphoyler et activer IKKβ et par conséquent médier la phosphorylation de la
protéine IκBα (O'Mahony et al., 2004). Il n’existe pas de preuves convaincantes pour une
interaction directe entre NIK et le signalosome dans les conditions physiologiques.
5-4- Les protéines IκB
Les protéines IκB dont les plus communes sont IκBα, IκBβ et IκBε (Ghosh, May, and
Kopp, 1998), sont des protéines régulatrices caractérisées par la présence de plusieurs régions
ARD « Ankyrin Repeat » de 33 aa qui permettent les interactions protéines-protéines (Fig.
49). D’une manière intéressante, p100 et p105 possèdent également ce domaine ARD qui
peuvent fonctionner comme des protéines IκBs Like, et peuvent ainsi subir une dégradation
protéolytique pour générer les protéines p52 et p50 respectivement. Un autre membre non
143
usuel de la famille IκB est le BcL3 qui, tout en restant spécifiquement lié aux homodimères
p50 et p52, induit l’expression des gènes NF-κB dépendant, ce qui contraste complètement
avec la fonction inhibitrice des autres protéines IκB.
Le schéma classique admet que la protéine IκBα retient NF-κB dans le cytoplasme en
masquant leur signale de localisation nucléaire (NLS). Cependant des études récentes
montrent que la localisation cytoplasmique du complexe NF-κB inactif est en effet le résultat
d’une navette continue entre le cytoplasme et le noyau (Huxford et al., 1998; Malek et al.,
2001). Des études structurales et biochimiques ont montré que seulement un des deux NLS du
dimère NF-κB est masqué par IκBα dans un complexe NF-κB/IκBα, ce qui permet au
complexe de basculer quand même vers le noyau (Ben-Neriah, 2002; Birbach et al., 2002). En
même temps, le signal d’export nucléaire (NES) localisé dans la région N-terminale de la
protéine IκBα permet d’expulser le complexe hors du noyau, et puisque le processus d’export
est plus efficace que le processus d’import, la localisation nucléaire du complexe NFκB/IκBα inactif ne peut être détectée que lorsque le NES est bloqué par la leptomycine B. De
la même manière, le complexe NF-κB/IκBε est capable de voyager activement entre le
cytoplasme et le noyau (Lee and Hannink, 2002). Par contre le complexe NF-κB/IκBβ est
toujours retenu dans le cytoplasme car IκBβ masque les NLS des deux sous-unités NF-κB
simultanément (Tam and Sen, 2001).
L’implication biologique de la navette permanente du complexe entre le cytoplasme et
le noyau n’a pas encore été déterminée. Il a été démontré que IκBα régule l’activation
transitoire du facteur de transcription NF-κB, alors que IκBβ maintient une activation
permanente (May and Ghosh, 1997). En effet, IκBα est rapidement dégradée en réponse à un
stimulus, et grâce à la présence d’un élément de réponse NF-κB sur le promoteur de son gène,
elle sera rapidement synthétisée (Silverman and Maniatis, 2001). Les protéines IκBα néo
synthétisées peuvent ensuite rentrer dans le noyau grâce à leur séquence NLS intrinsèque, et
déplacer NF-κB de son site de liaison à l’ADN et ainsi le transporter vers le cytoplasme.
Contrairement à IκBα, IκBβ est moins sensible aux signaux de dégradation. En effet il a été
rapporté qu’une interaction sélective entre κB-Ras endogène et IκBβ permet l’inhibition de la
dégradation de IκBβ pendant l’activation de NF-κB (Fenwick et al., 2000). Par ailleurs, ne
possédant pas de NLS endogène et n’étant pas inductible par NF-κB, IκBβ néo-synthétisée
est incapable de déplacer NF-κB de son promoteur ou de le faire sortir du noyau, d’où une
activation prolongée de ce facteur de transcription.
144
Figure 50: Processus d’ubiquitinylation
Modifiée d’après Ciechanover, A. et al., 1998;
The EMBO journal
145
Pour la plupart des stimuli, excepté les rayons UV et H2O2, la dégradation d’IκB est
une étape essentielle pour la libération de NF-κB et par conséquent son activation (Karin and
Ben-Neriah, 2000). Une étape cruciale dans ce processus est la phosphorylation de la protéine
IκB sur les sérines N-terminales (Ser32 et Ser36 pour IκBα), médiée par le signalosome. Une
fois phosphorylée, IκBα est ensuite ubiquitynilée sur les Lys21 et Lys22 par la β-TRCP « βtransducing repeat-containing protein », puis dégradée via le protéasome.
¾ L’ubiquitinylation
L’ubiquitinylation est un processus essentiel pour cibler les protéines vers la
dégradation via le protéasome. C’est une modification réversible caractérisée par trois étapes
enzymatiques (Pickart, 2004) (Fig. 50). D’abord l’ubiquitine est activée par une enzyme E1
« Ubiquitine activating enzyme » dans une réaction ATP dépendante. L’ubiquitine activée est
ensuite transferée à une enzyme E2 dite aussi UBC « Ubiquitine conjugating enzyme »
formant ainsi une E2-Ub thioester. Finalement, en présence d’une ubiquitine protéine Ligase
E3, l’ubiquitine est attachée à la protéine cible via une interaction entre la région C-terminale
de l’ubiquitine et le groupe ε-NH2 d’un résidu lysine de la protéine cible. L’ubiquitine
contient sept résidus lysine qui peuvent se lier à d’autres ubiquitines et former une chaîne
polyubiquitine. Typiquement une chaîne poyubiquitine qui cible les protéines vers une
dégradation via le protéasome est liée par les Lys 48 (Chau et al., 1989). Cependant d’autres
chaînes liées par les Lys63 sont également retrouvées dans les cellules, et sont connues pour
réguler la réparation d’ADN et l’activation des protéines kinases via un mécanisme
indépendant de la dégradation (Peng et al., 2003).
L’ubiquitinylation d’IκBα est réalisée par une enzyme E2 de la famille UBC4/5 et
l’enzyme SCF-βTrcP E3 Ligase (Jiang and Struhl, 1998; Margottin et al., 1998). Il existe
deux protéines βTrcP (1 et 2) chez les mammifères. Ces deux protéines se fixent au complexe
SCF via la F-box. Le complexe se lie à l’enzyme E2 qui reconnaît spécifiquement la protéine
IκBα phosphorylée au niveau des Ser32 et Ser36 (Chen, Parent, and Maniatis, 1996; Yaron et
al., 1998) et permet son l’ubiquitinylation au niveau des deux résidus lysines N-terminal (Lys
21/22). IκBα ubiquitinylée toujours liée à NF-κB, est dégradée sélectivement par le
protéasome 26S alors que le complexe NF-κB est épargné (Chen et al., 1995).
Récemment un nouveau mécanisme qui inhibe la dégradation d’IκBα a été identifié.
Des petites molécules dites SUMO « Small Ubiquitine Modified » sont capables de se lier à la
146
Figure 51: Dégradation préférentielle via le protéasome
Zhijian, J.C. 2005;
Nature cell biology
147
protéine IκBα au niveau de la Lys21 ce qui empêche son ubiquitinylation et la rend
complètement résistante à la dégradation par le protéasome. IκBα dite sumoylée reste liée à
NF-κB créant ainsi un complexe NF-κB-IκB-SUMO qui ne répond pas aux signaux
d’induction. La cellule peut en effet utiliser ce mécanisme afin de réguler la quantité de NFκB nécessaire à la transcription. Cette régulation se fait aussi grâce à une enzyme hydrolase
qui rompe la liaison SUMO-IκB (Mahajan et al., 1997). L’activité de cette hydrolase est
tellement importante que la détection du complexe SUMO-IκB est presque impossible dans
des conditions normales.
¾ Dégradation par le protéasome
Un modèle plausible vient d’être proposé (Fig. 51). Selon ce modèle, l’étiquette
ubiquitine du substrat recrute le protéasome à une séquence interne flexible (Chen, 2005),
telle que la GRR « Glycine-Rich Region » de p100 et p105 (Lin and Ghosh, 1996). Cette
région, formerait une boucle en épingle à cheveux qui s’insert dans la chambre protéolytique
du protéasome 20S. La protéolyse commence à la boucle et se poursuit dans les deux
directions N- et C-terminales de la protéine cible. Dans la plupart des cas, la sous unité 19S
du protéasome permet le dépliement des domaines N- et C-terminaux qui passent dans la
chambre de protéolyse afin que la cible soit complètement dégradée. Dans le cas des protéines
p100 et p105, les domaines RHD sont des structures superenroulées, très difficilement
dépliables. Par conséquent, après initialisation à partir de la boucle GRR, la protéolyse se
poursuit le long du polypeptide C-terminal jusqu’à atteindre la fin, alors qu’elle s’arrête quand
elle arrive à la structure RHD superenroulée, ce qui définit la fin de la protéolyse.
5-5- Les voies de signalisation NF-κB
Trois voies distinctes, mettant en jeu différentes kinases, conduisent à l’activation de
NF-κB (Fig. 52). La première voie, dite « classique », est activée par des cytokines proinflammatoires telles que le TNF-α. Elle conduit au recrutement de différentes protéines
adaptatrices dont TRADD « TNF receptor associated death protéin », TRAF2 « TNF receptor
associated factor 2 » et RIP « receptor interacting protein » au niveau de la membrane
plasmique. La formation de ce complexe est suivie du recrutement et de l’activation du
signalosome, complet constitué essentiellement des kinases IKK. Ce complexe va permettre
148
Figure 52 : Les trois voies d’activation de NF-κ
κB
Classique
Alternative
Atypique
Modifiée d’après Viatour, P. et al., 2005;
TRENDS in biochemical sciences
149
la phosphorylation de IκBα liée au complexe NF-κB1 (p50/p65), sur les Ser32 et 36 (Karin
and Ben-Neriah, 2000) et par conséquent son ubiquitinylation et sa dégradation via le
protéasome (Karin and Ben-Neriah, 2000; Viatour et al., 2005), le facteur de transcription
p50/p65 ainsi libre est ensuite transloqué dans le noyau où il va pouvoir exercer son activité
de transactivation de l’expression des gènes NF-κB dépendants. La seconde voie, dite
« alternative », est NIK et IKK-α dépendante. Elle est activée par des ligands tels que la
lymphotoxine B, le CD40 ou des virus tels que HTLV1 ou l’EBV (Viatour et al., 2005). Le
recrutement membranaire de TRAF 2, 3 et 6, qui à leur tour recrutent et activent la kinase
NIK, permet l’activation d’un homodimère IKKα. Cet homodimère va phosphoryler p100, et
seule la région homologue d’IκB-α sur la protéine sera clivée par le protéasome pour donner
p52 (Amir et al., 2004; Fong and Sun, 2002; Pickart, 2004; Xiao, Harhaj, and Sun, 2001).
L’hétérodimère p52/RelB peut alors être transloqué dans le noyau (Viatour et al., 2005). Dans
les deux cas la phosphorylation de la molécule inhibitrice est essentielle à l’activation du
facteur NF-κB (Brown et al., 1995). La troisième voie est dite « atypique », car elle est
indépendante des kinases IKK. Elle est activée suite à l’altération de l’ADN par les UV. Dans
ce cas, la phosphorylation de IκBα se fait sur le groupement C-terminal grâce à une Casein
kinase 2 (CKII) qui est une serine thréonine kinase elle-même activée par la p38 MAP kinase.
Un stress oxydatif peut également conduire à l’activation de NF-κB suite à la phosphrylation
de la Tyr42 par la protéine Syk (Viatour et al., 2005).
5-6- Régulation de l’activité transcriptionnelle des protéines NF-κB
5-6-1- Activation par phosphorylation de p65
Cependant plusieurs preuves montrent que l’activité NF-κB peut être également
régulée par des modifications directes des protéines NF-κB via leur phosphorylation et
acétylation. Plusieurs travaux ont montré la capacité de différentes kinases à induire la
phosphorylation et l’activation de la sous unité p65 du complexe NF-κB, dans le cytoplasme
ou le noyau et selon la nature du stimulus et du type cellulaire (Fig. 53). En effet, la
phosphorylation de p65 sur la Ser276 par la sous unité catalytique de PKA (PKAc) après
dégradation d’IκBα, est essentielle pour une fixation efficace de p65 sur le co-activateur de
transcription CBP « CREB Binding Protein » (Zhong, Voll, and Ghosh, 1998) et déplace le
150
Figure 53 : Modulation de l’activité transcriptionnelle de p65
par phosphorylation
Viatour, P. et al., 2005;
TRENDS in biochemical sciences
151
complexe p50-HDAC1hors de l’ADN (Zhong et al., 2002). La Ser276 peut également être
phosphorylée par MSK1 « mitogen-and stress-activated potein kinase-1 » dans le noyau pour
une activation optimale de p65 par TNF-α {Vermeulen, 2003 #1448}. Ainsi le même résidu,
p65 peut être ciblé par deux kinases dans différents compartiments cellulaires. La Ser311 est
un autre résidu au niveau du domaine N-terminal RHD de p65, constituant une cible de
phosphorylation par une autre kinase, la PKCζ en réponse au TNF-α. De la même manière
que la PKAc, PKCζ active l’interaction de p65 phosphorylée avec CBP et son recrutement
avec l’ARN PolII sur le promoteur IL-6 (Duran, Diaz-Meco, and Moscat, 2003). La
phosphorylation de p65 sur la Ser529 par la CKII en réponse à l’IL-1β (Wang et al., 2000) ou
sur les Ser529 et Ser536 par IKKβ en réponse au TNF-α est également requise pour son
activité transcriptionnelle (Sakurai et al., 1999; Wang et al., 2000). Cette dernière voie
requiert la présence de la MAP3K NIK (Jiang et al., 2003).
5-6-2- Rôle de la phosphorylation dans l’activité de RelB et c-Rel
Plusieurs résidus de RelB sont phosphorylés. La Ser368 semble essentielle à la
dimérisation de RelB et la stabilisation de p100, mais pas à la translocation nucléaire de RelB
(Maier et al., 2003). La phosphorylation de RelB sur la Thr84 et Ser552 dans les cellules
stimulées par l’inomycin induit la dégradation de RelB via le protéasome, bien que la kinase
impliquée ne soit pas identifiée là encore (Marienfeld et al., 2001). Quelles sont les
conséquences de la phosphorylation de RelB sur l’activation de la voie NF-κB alternative
IKKα dépendente ? Et quels sont les gènes cibles de NF-κB régulés par la phosphorylation de
RelB ? De telles interrogations font certainement encore l’objet de plusieurs investigations en
cours.
En revanche, le rôle de la phosphorylation de c-Rel sur la Ser471 dans l’activation de
NF-κB induite par TNF-α, a été démontré. Cette sérine semble être ciblée par une voie PI3K
et PKC dépendante (Martin and Fresno, 2000). De plus, la stimulation des neutrophiles par le
G-CSF « granulocytes-colony-stimulating factor » induit la phosphorylation de c-Rel sur une
tyrosine, ce qui semble augmenter sa capacité de liaison à l’ADN (Druker et al., 1994).
152
Figure 54 : Structure de la chromatine
Modifiée d’après Felsenfeld et Groudine, 2003
Nature
153
5-6-3- Les sous-unités p50 et p52 sont des phosphoprotéines
On connaît beaucoup moins de choses sur la phosphorylation des autres membres NFκB, à part le fait que p50 est phosphorylée suite à la stimulation cellulaire (Hayashi, Sekine,
and Okamoto, 1993). Le fait que p50 soit dépourvu du domaine de transactivation, sa
phosphorylation induite par PI3K/AKT en réponse à l’IL-1 sur la Ser337, localisée au niveau
du RHD, augment la capacité de cette protéine à se lier à l’ADN (Koul et al., 2001; Martin
and Fresno, 2000 ). Le rôle physiologique de la phosphorylation putative de p50 fait l’objet de
plusieurs investigations.
5-6-4- Régulation par la modification des histones
Récemment, un autre mécanisme de régulation de la voie NF-κB a été mis en évidence
impliquant un rôle nucléaire de la protéine kinase IKKα. En effet, il a été montré que suite au
traitement des fibroblastes embryonnaires de souris (MEF) par les cytokines telles que le
TNF-α, IKK-α subit une translocation et une accumulation dans le noyau où elle jouerait un
rôle important dans la régulation de l’expression des gènes NF-κB dépendants (Anest et al.,
2003; Yamamoto et al., 2003c). Ces travaux montrent que IKKα est recruté au niveau du
promoteur des gènes cibles, où elle induit la phosphorylation des histones H3 au niveau de la
Ser10 (Anest et al., 2003), et en conjonction avec la protéine p65, interagit avec l’histone
acétyl transférase (CBP/p300) et induit l’acétylation de l’histone H3 phosphorylée sur la
Lys14. Cette acétylation induit une décondensation de la chromatine au niveau du promoteur
exposant ainsi le site de fixation des facteurs de transcription au niveau du promoteur du gène
cible, augmentant ainsi leur expression.
¾ La chromatine
Chez les eucaryotes, l’ADN génomique mesure environ deux mètres de long. Ainsi,
pour être contenu dans un noyau de quelques μM, il nécessite un niveau de compaction
d’environ 200 000 fois. Le matériel génétique peut être divisé en deux compartiments :
l’euchromatine relâchée et transcriptionnellement active et l’hétérochromatine considérée
comme compacte et silencieuse.
154
Figure 55 : Code des histones
Les différentes modifications post-traductionnelles
Lacoste, N. et al., 2003
Medecine science
155
La chromatine peut être schématisée comme un collier de perles (Fig. 54). Le nucléosome
est constitué d’approximativement 147 paires de bases enroulées, environ 1,65 fois (Luger et
al., 1997), autour d’un octamère d’histones (H2A, H2B, H3 et H4)2 (Khorasanizadeh, 2004).
Entre les nucléosomes, une histone H1chaperonne stabilise l’assemblage des octamères et
facilite la compaction de la chromatine.
Cette forme compactée de la chromatine bloque l’accès et/ou l’assemblage des facteurs de
transcripton. La queue N-terminal des histones qui se dégage en dehors du nucléosome, subit
des modifications post-transcriptionelles (Fig. 55) incluant la méthylation des lysines et
arginines, la phosphorylation des sérines et thréonines, l’ubiquitinylation et l’acétylation des
lysines (Bradbury, 1992). Ces modifications permettent le remodelage de la chromatine et
jouent un rôle central pour supprimer ou au contraire amplifier ces effets répressifs.
a- Acétylation et Déacétylation d’histones
•
Acétylation :
Les deux HAT les plus étudiées, CBP et P300, sont des coactivateurs de beaucoup de
facteurs de transcription notamment Fos, Jun et p53 (Kalkhoven, 2004). L’acétylation des
queues amino-terminales neutralise la charge positive portée par l’azote des lysines ce qui
conduit à une diminution de l’intéraction entre ADN et protéines mais aussi entre les
nucléosomes, menant à une structure chromatinienne plus ouverte et donc plus accessible
pour les facteurs de transcription.
Ainsi, la stimulation des cellules à l’IL-1β induit l’acétylation de l’histone H4 au niveau
du promoteur du GM-CSF « Granulocyte-macrophage colony stimulating factor » (Ito,
Barnes, and Adcock, 2000; Ito et al., 2001). De même, le LPS induit une hyperacétylation des
histones H3 et H4 au niveau du promoteur des gènes IL-8, MIP1α « Macrophage
inflammatory protein 1α » et IL-12/p40, et l’acétylation de l’histone H4 sur le promoteur IL-6
NF-κB-dépendant (Saccani and Natoli, 2002; Saccani, Pantano, and Natoli, 2001). Cette
augmentation de l’acétylation des histones H3 et H4 corrèle avec l’augmentation du
recrutement de l’ARN PolII et l’augmentation de l’expression des gènes (Saccani and Natoli,
2002; Saccani, Pantano, and Natoli, 2001). L’infection virale induit également une
hyperacétylation des histones au niveau du promoteur du gène IFN-β NF-κB-dépendant,
permettant ainsi de mobiliser la réponse cellulaire antivirale (Parekh and Maniatis, 1999).
Bien que différents stimulis induisent une hyperacétylation des histones au niveau des
promoteurs des gènes NF-κB-dépendants, certains gènes précocemment inductibles,
156
notamment IκBα, MIP2 et MnSOD « Manganese superoxyde dismutase », ont des sites NFκB constamment accéssibles au niveau du promoteur, et par conséquent un haut niveau basal
de H4 acétylée (Saccani, Pantano, and Natoli, 2001).
•
Déacétylation
Les HDAC de mammifères sont divisées en deux familles : i) les déacétylases classiques,
capables de retirer les groupements acétyls des histones mais aussi d’autres protéines (Juan et
al., 2000) et ii) les déacétylases dépendantes du NAD+ ou SIRT, qui induisent la
déacétylation en produisant, du nicotinamide et de l’O-acétyl-ADP-ribose, par clivage du
NAD+ (Tanny and Moazed, 2001).
A l’opposé, la déacétylation des histones, conduit à une structure plus fermée de la
chromatine et moins disponible pour la transcription. Ainsi, l’un des mécanismes par lequel
les glucocorticoïdes inhibent l’activation des gènes NF-κB dépendants, implique la
déacétylation des histones. Cette déacétylation se fait en recrutant les « Histones
DeAcetylases » HDAC ou directement en réprimant l’activité des HATs (Ito, Barnes, and
Adcock, 2000; Ito et al., 2001). Etant donné que l’homodimère p50 agit comme un répresseur
de l’activité des gènes NF-κB dépendants, ceci peut être expliqué par le fait que p50 recrute
un complexe contenant les HDAC, qui induit la déacétylation au niveau du site de fixation de
l’homodimère (Zhong et al., 2002).
b- Phosphorylation des histones
En plus de servir comme marqueur de mitose cellulaire, la phosphorylation des
histones a récemment été liée à l’activation de la transcription (Clayton et al., 2000; Wei et
al., 1999). En effet, la phosphorylation de l’histone H3 au niveau de la Ser10, augmente
rapidement quand les cellules quiescentes sont exposées aux stimulis mitogènes et durant
l’induction des gènes très précoces par l’EGF (Barratt et al., 1994; Sassone-Corsi et al.,
1999). De plus, plusieurs stimulis inflammatoires, qui activent NF-κB, induisent la
phosphorylation de la Ser10 et l’acétylation de la Lys14 au niveau de la queue N-terminale de
l’histone H3. La phosphorylation de l’H3 corrèle également avec le recrutement effectif de
NF-κB au niveau du promoteur des gènes IL-6, IL-8, MCP « monocyte chemotactic protein »
et IL-12/p40 (Saccani, Pantano, and Natoli, 2002).
Cette corrélation entre l’activation de NF-κB et la phosphorylation des histones, a été
confirmée par les travaux de Yamamoto et al., et Anest et al., en 2003, montrant que IKKα
157
était capable de phosphoryler la Ser10 de l’histone H3 in vitro et in vivo (Anest et al., 2003;
Yamamoto et al., 2003c). Cependant, certains gènes cibles de NF-κB, tels que Iκbα sont
activés normalement suite à la stimulation par le LPS en absence de recrutement d’IKKα au
promoteur (Saccani, Pantano, and Natoli, 2001). De plus les cellules de souris KO, exprimant
une IKKα catalytiquement inactive, répondent normalement au TNF-α, IL-1 et au LPS, ce
qui indique qu’IKKα n’est pas essentielle à l’activation des gènes NF-κB dépendant (Cao et
al., 2001). Il semblerait donc, que d’autres kinases telles que MSK1 et PKA, qui phophorylent
les résidus sérine de RelA, peuvent phosphoryler la Ser10 de l’H3, en réponse à différents
stimulis (Salvador et al., 2001; Soloaga et al., 2003).
c- Méthylation des histones
Contrairement à l’acétylation, la méthylation des histones ne modifie pas la charge du
nucléosome. En revanche, cette modification peut avoir des effets opposés sur la transcription
des gènes, selon le résidu méthylé par les HMT « Histones methyltransferase » (Kouzarides,
2002; Sanders et al., 2004; Santos-Rosa et al., 2004). Par exemple, la méthylation de l’histone
H4 (Arg4) ou H3 (Arg2, 17, 26) par une « Arginine » methyltransferase telle que CARM1 et
PRMT1 « Protein arginin methyltransferase » respectivement (Stallcup et al., 2000), joue un
rôle positif dans la transcription des gènes. De manière intéressante, la methylation des
résidus lysines sur différentes positions au niveau de la queue N-terminale de l’histone H3,
peut aussi avoir des effets opposés. La méthylation de la Lys9, par la protéine SUV39H,
semble médier la formation d’une hétérochromatine silencieuse et une répression de gènes
(Peters et al., 2002). En revanche, la méthylation de la Lys4 corrèle avec l’activation des
gènes et une chromatine transcriptionellement active (Strahl et al., 1999).
158
Figure 56 : État des connaissances
159
PROBLEMATIQUE
Chez les patients infectés par le virus de l’immunodéficience humaine de type 1, on
observe dès le stade asymptomatique une dérégulation du système immunitaire. En effet, au
fur et à mesure de l’évolution vers le stade SIDA une modification progressive du réseau de
cytokines au profit d’une réponse de type Th2, réponse humorale moins efficace dans la lutte
contre le virus, avec la présence d’IL-4, IL-5 et d’IL-10 dans le sérum des patients (Clerici
and Shearer, 1993; Clerici et al., 1994; Maggi et al., 1994).
Ainsi, la production d’IL-10, une cytokine immunosuppressive, par les PBMC
participerait à la progression de l’infection vers le stade SIDA (Fauci, 1996; Stylianou et al.,
1999; Torres et al., 1998). En effet, les patients les moins producteurs d’IL-10 sont dits « non
progresseurs », et semblent évoluer moins rapidement vers le stade SIDA (Romagnani,
Maggi, and Del Prete, 1994). De nombreux virus utilisent la « stratégie » de l’IL-10 pour
échapper au système immunitaire. Alors que certains produisent leur propre IL-10 viral (tels
que les poxvirus et les herpesvirus) (Johnston and McFadden, 2003), le VIH stimule sa
production par l’hôte.
Les travaux précédents du laboratoire ont permis de montrer que la protéine Tat du VIH-1
via sa région N-terminale 1-45, induit la production d’IL-10 par les monocytes humains du
sang périphérique en agissant au niveau membranaire (Badou et al., 2000). L’analyse des
voies de signalisation initiées par la protéine Tat a montré que, la voie PKC et spécifiquement
les PKC-βΙΙ et -δ jouent un rôle crucial dans l’induction de l’IL-10 (Bennasser et al., 2002).
En aval de la PKC, Tat active la phosphorylation des MAP kinases ERK1/2 et la translocation
nucléaire du facteur de transcription NF-κB, dont l’activation est nécessaire pour la
production de l’IL-10 médiée par Tat (Badou et al., 2000) (Fig. 56).
But de cette étude
1) Caractérisation les voies de signalisation impliquées par la protéine Tat du VIH1, pour induire la production de l’IL-10 dans le monocyte/macrophage humain.
2) Etudie des bases moléculaires d’activation de la voie NF-κB, impliquées dans la
régulation du gène IL-10.
160
RÉSULTATS 161
Article 1
HIV-1 Tat protein induces IL-10 production by an alternative
TNF-α-independent pathway in monocytes: Rôle of PKC-δ and
p38 MAP kinase
Kaoutar Leghmari, Yamina Bennasser, Jean Tkaczuka and Elmostafa Bahraoui
Cellular immunology
Juin 2008, sous presse
162
RESUME DE L’ARTICLE 1
La protéine Tat du VIH-1 stimule la production de l’IL-10 et du TNF-α dans les monocytes
humains. Tenant compte de la capacité du TNF-α à induire la production de l’IL-10, nous
avons analysé le lien entre Tat, TNF-α et l’IL-10 ainsi que l’implication des voies PKC et p38
MAP kinases. Nos résultats ont montré que i) en présence d’anticorps neutralisants anti-TNFα, la production de l’IL-10 n’est que partiellement inhibée ; ii) dans un milieu sans calcium,
alors que la production de TNF-α est complètement abolie, Tat continue d’induire l’IL-10 ;
iii) dans ces conditions, la production d’IL-10 médiée par Tat est associée à l’activation de la
PKC-δ, et iv) en aval des PKC, la p38 MAP kinase est cruciale à la production d’IL-10 TNFα-indépendante. Nos résultats suggèrent donc un nouveau mécanisme, impliquant la protéine
Tat, par lequel le VIH-1 est capable de maintenir une production constante de la cytokine
immunosupressive, l’IL-10, même en absence de TNF-α. Par conséquent, le virus peut
échapper à la surveillance du système immunitaire en favorisant l’établissement d’un état
immunosuppressif.
163
Cellular Immunology 253 (2008) 45–53
Contents lists available at ScienceDirect
Cellular Immunology
j o u r n a l h o m e p a g e : w w w . e l s e v i e r. c o m / l o c a t e / y c i m m
HIV-1 Tat protein induces IL-10 production by an alternative TNF-a-independent
pathway in monocytes: Role of PKC-d and p38 MAP kinase
Kaoutar Leghmari a, Yamina Bennasser a, Jean Tkaczuk b, Elmostafa Bahraoui a,*
a
b
Lab­o­ra­toire d’Immuno-Vi­rol­o­gie, EA 3038, Uni­ver­sité Paul Saba­tier 118, route de Nar­bonne 4R3, 31062 Tou­louse, Ce­dex, France
Lab­o­ra­toire d’Im­mu­nol­o­gie, Hôpi­tal de Rangu­eil, Tou­louse, France
a r t i c l e
i n f o
Article history:
Received 27 Feburary 2008
Accepted 23 April 2008
Available online 9 June 2008
Key­words:
HIV-1
Tat
Human mono­cytes
TNF-a
IL-10
PKC-d
p38MAP kinase
a b s t r a c t
HIV-1 Tat pro­tein stim­u­lates the pro­duc­tion of both TNF-a and IL-10 in human mono­cytes. Tak­ing into
account the abil­ity of TNF-a to induce IL-10 pro­duc­tion, we eval­u­ated the link between Tat, TNF-a and
IL-10 and the impli­ca­tion of PKC and p38 MAP kinase path­ways. Our data showed that (i) in the pres­
ence of neu­tral­iz­ing anti-TNF-a anti­bod­ies, IL-10 pro­duc­tion is only par­tially inhib­ited; (ii) in a cal­ciumfree medium, while TNF-a pro­duc­tion is totally inhib­ited, Tat con­tin­ues to induce IL-10; (iii) under these
con­di­tions, Tat-med­i­ated IL-10 pro­duc­tion is asso­ci­ated with PKC-d acti­va­tion; and (iv) down­stream of
PKC, p38 MAP kinase is cru­cial for TNF-a inde­pen­dent IL10 pro­duc­tion.Over­all, our data sug­gest a new
mech­a­nism, impli­cat­ing Tat pro­tein, by which HIV-1 may main­tain a con­stant pro­duc­tion of the immu­no­
sup­pres­sive IL-10 cyto­kine, even in the absence of TNF-a pro­duc­tion. In con­se­quence, HIV-1 may escape
immune sur­veil­lance and thus pro­mote the estab­lish­ment of an immu­no­sup­pres­sive state.
© 2008 Else­vier Inc. All rights reserved.
1. Intro­duc­tion
HIV-1 pri­mar­ily infects CD4+ T lym­pho­cytes, mono­cytes/
mac­ro­phages, and den­dritic cells [1]. This infec­tion results in
pro­found and selec­tive deple­tion of CD4+ T cells dur­ing the pro­
gres­sion to AIDS. How­ever, before CD4+ T cell deple­tion in HIV-1
infected patients, a generalized immune depres­sion is observed
which impairs a vari­ety of immune func­tions includ­ing both
adap­tive and innate immu­nity and the Th1/Th2 equi­lib­rium [2].
HIV-1 infected patients undergo a pro­gres­sive decrease of the
Th1 cel­lu­lar immune response that results in an increase of the
Th2 humoral immune response med­i­ated by IL-4, IL-6, and IL-10,
inef­fi­cient for virus erad­i­ca­tion [3]. In HIV-1 infected patients,
periph­e­ral blood mono­nu­clear cells (PBMC) pro­duce large quan­
ti­ties of IL-10 in par­al­lel with the alter­ation of CD4+ T cell pro­
lif­er­a­tive func­tion [3]. This anti-inflam­ma­tory IL-10 cyto­kine is
pro­duced by T cells, B cells, mono­cytes, mac­ro­phages and den­
dritic cells [4]. It acts as a potent immu­no­sup­pres­sive cyto­kine
that inhib­its the acti­va­tion of mac­ro­phages by down reg­u­lat­ing
the pro­duc­tion of pro-inflam­ma­tory cyto­kines includ­ing IL-1
and TNF-a [4]. In addi­tion, IL-10 has been shown to inhibit HIV-1
rep­li­ca­tion in mac­ro­phages and the chron­i­cally infected U1 cell
lines [4–6]. Accord­ingly, it has also been reported that injec­tion
of recombinant IL-10 to HIV-1 infected patients is asso­ci­ated
with a viral load reduc­tion [7]. These obser­va­tions cor­re­late with
* Cor­re­spond­ing author. Fax: +33 561 558 667.
E-mail address: bah­ra­[email protected] (E. Bahraoui).
0008-8749/$ – see front matter © 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.cellimm.2008.04.015
the abil­ity of IL-10 to inhibit the pro­duc­tion of anti-inflam­ma­
tory cyto­kines and thus pre­vent their action on the acti­va­tion of
NF-jB tran­scrip­tion fac­tor [4].
Although the first stud­ies sug­gest a direct rela­tion­ship
between IL-10 level increase in HIV-1 infected patient sera
and the pro­gres­sion to AIDS [8,9], this rela­tion­ship remains
to be clearly estab­lished. Indeed, there are other, con­flict­ing
reports sug­gest­ing that increased pro­duc­tion of IL-10 in HIV1 infected human sera is often cor­re­lated with AIDS-asso­ci­
ated non-Ho­dj­kin’s lym­phoma rather than with AIDS dis­ease
pro­gres­sion [10]. The lat­ter obser­va­tion is in agree­ment with
the genetic stud­ies reported by Shin et al. [8]. How­ever, other
stud­ies have dem­on­strated that, in some con­di­tions, IL-10 can
syn­er­gize with inflam­ma­tory cyto­kines to enhance HIV-1 rep­
li­ca­tion [6,11,12].
Our group has dem­on­strated that one of the viral fac­tors
involved in IL-10 pro­duc­tion is HIV-1 Tat pro­tein [13]. This pro­tein
is required for effi­cient HIV-1 viral rep­li­ca­tion [14]. By bind­ing to
the TAR region of the nascent RNA, Tat recruits cel­lu­lar pro­teins
includ­ing cyclin T1 and CDK9, essen­tial for the phos­phor­y­la­tion
and acti­va­tion of RNA polII [15,16].
In addi­tion to its role in HIV-1 trans­ac­ti­va­tion, Tat is found at
the nano­mo­lar level in the sera of HIV-infected patients [17,18]
and could par­tic­i­pate in the path­o­gen­e­sis of HIV-1 infec­tion. Tat
is secreted by infected cells and inter­acts with dif­fer­ent cell types,
whether they are infected or not [19], lead­ing to the alter­ation of
the cyto­kine com­plex net­work and thus to immune response dys­
reg­u­la­tion [20,21].
46
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
Pre­vi­ously, we dem­on­strated that Tat induced IL-10 could be
med­i­ated by TNF-a [13,22]. In the pres­ent study, we show that Tat
pro­tein is also able to stim­u­late IL-10 pro­duc­tion by acti­vat­ing an
alter­na­tive, TNF-a inde­pen­dent path­way. Tak­ing into account the
capac­ity of IL-10 to inhibit pro-inflam­ma­tory cyto­kines includ­ing
TNF-a, we sug­gest a new mech­a­nism, impli­cat­ing Tat pro­tein, by
which HIV-1 may main­tain a con­stant pro­duc­tion of the immu­no­
sup­pres­sive IL-10 cyto­kine, even in the absence of TNF-a pro­duc­
tion. In con­se­quence, HIV-1 escapes immune sur­veil­lance and pro­
motes immu­no­sup­pres­sion.
2. Mate­rial and meth­ods
2.1. Recombinant HIV-1 Tat pro­tein
Recombinant HIV-1 Tat pro­tein was obtained from “Agence
Na­tio­nale de la Recher­che sur le SIDA” (Paris, France).This pro­tein
was puri­fied by three chro­ma­tog­ra­phy steps: cat­ion exchange,
reverse phase and sec­ond cat­ion exchange chro­ma­tog­ra­phies. The
deleted mutant Gst-Tat 1–45 was pro­duced as glu­ta­thi­one-S-trans­
fer­ase (Gst) fusion pro­tein in Esch­e­richia coli and puri­fied by affin­ity
chro­ma­tog­ra­phy as pre­vi­ously described [13,22]. As a con­trol, Gst
was puri­fied in the same con­di­tions and used in the same exper­i­
ments. The level of endo­toxin con­tam­i­na­tion in puri­fied HIV-1 Tat
was assessed by using the Lim­u­lus Ame­bo­cyte Lysate (LAL) assay
(Bi­oSe­pra, Ville­neuve la Gar­enne, France). Tat recombinant pro­
teins are LPS free (less than 0.3 EU/lg) and bio­log­i­cally active as
pre­vi­ously described [13,23].
In some exper­i­ments, 500 ll of Tat (50 nM) was immo­bi­lized in
wells by incu­ba­tion for 2 h at 37 °C. After two washes to elim­i­nate
non-fixed Tat, mono­cytes (106 cells) were added and cul­tured for
24 h. In these con­di­tions, Tat did not enter cells, as assessed by an
intra­cel­lu­lar Tat depen­dent trans­ac­ti­va­tion assay per­formed with
HeLa P4 cells sta­bly trans­fec­ted with a HIV-1 LTR-lacZ con­struct as
pre­vi­ously described [13].
amount of DMSO, the vehi­cle of RO31 82220 and SB 202190 inhib­i­
tors, was used alone or with 10 nM of Tat.
2.4. TNF-a and IL-10 detec­tion by enzyme linked immu­no­sor­bent
assay
TNF-a pro­duc­tion was quan­ti­fied by using a two-site sand­
wich enzyme-linked immu­no­sor­bent assay (ELISA) as pre­vi­ously
described [13]. Briefly the MAB 610 or MAB217 (R&D Sys­tems,
Oxon, UK) mono­clo­nal anti­bod­ies (4 lg/ml) were used for TNF-a
or IL-10 cap­ture respec­tively. Then, the plates were blocked before
addi­tion of the cul­ture super­na­tants (100 ll/well) for cyto­kine cap­
ture. TNF-a and IL-10 were detected by stain­ing using bio­tin­yl­a­ted
anti-TNF-a (BAF 610) or bio­tin­yl­a­ted anti-IL-10 (BAF217) obtained
from R&D Sys­tems. The subsequent steps are the same as those
described in Ba­dou et al. [13].
2.5. Flow cytom­e­try anal­y­sis of intra­cel­lu­lar TNF-a
Mono­cytes (106) iso­lated and cul­tured as described above, were
stim­u­lated with 10 nM of Tat pro­tein in the pres­ence or absence of
cal­cium. Monen­sin (1.725 lg/ml) was added at the same time to
block pro­tein secre­tion and cells were col­lected after 3 and 6 h of
stim­u­la­tion for the assess­ment of the pres­ence of in­tracy­to­plas­mic
TNF-a. Cells were then col­lected and washed with phos­phate buf­
fered saline PBS. Sub­se­quently, they were resus­pended in 100 ll
PBS and stained at room tem­per­a­ture for 20 min with an anti-CD14
mono­clo­nal anti­body con­ju­gated with FITC (Bec­ton–Dick­in­son;
San Jose). After fur­ther PBS wash­ing, the cells were fixed for 10 min
in 200 ll PBS con­tain­ing 1.5% form­al­de­hyde. Finally, the cells were
washed twice and resus­pended in PBS with anti-TNF-a anti­bod­ies
con­ju­gated with all­o­phyc­o­cy­a­nin (APC) (Bec­ton–Dick­in­son; San
Jose) for 30 min at room tem­per­a­ture to stain in­tracy­to­plas­mic
TNF-a. The cells were then washed twice with PBS and ana­lyzed
by flow cytom­e­try.
2.2. Mono­cyte iso­la­tion
2.6. Anal­y­sis of PCK-bII, d, and p38 MAP kinase acti­va­tion
Periph­e­ral blood mono­nu­clear cells (PBMC) were iso­lated from
the buffy coat of healthy HIV-neg­a­tive donors in a Fi­coll den­sity
gra­di­ent (Pharmacia). The PBMC were resus­pended in com­plete
medium (60% AIMV and 30% Is­cove [Gib­co]) con­tain­ing pen­i­cil­
lin (100 IU/ml), strep­to­my­cin (100 lg/ml) and 10% FCS (Foe­tal Calf
Serum). PBMC were then plated at 106 cells/well in 24-well Pri­ma­
ria (Bec­ton–Dick­in­son) tis­sue cul­ture plates. After 24 h of cul­ture at
37 °C in 5% CO2, non-adher­ent cells were removed, and the remain­
ing cells were washed twice, then incu­bated in 1% FCS medium
before stim­u­la­tion with the dif­fer­ent com­pounds tested.
For cal­cium-free exper­i­ments, PBMC were resus­pended in com­
plete medium (60% AIMV and 30% Is­cove). After 24 h of adher­ence
and two washes to remove non-adher­ent cells, mono­cytes were
iso­lated in DMEM with­out cal­cium chlo­ride (CaCl2) (Life tech­nol­
o­gies, France) com­ple­mented with pen­i­cil­lin (100 IU/ml), strep­to­
my­cin (100 lg/ml), sodium pyru­vate (110 mg/ml) and 1% FCS, 2 h
before stim­u­la­tion. In some tests, the medium was sup­ple­mented
with 2 mM CaCl2 (Sigma)
2.6.1. Iso­la­tion of cyto­plas­mic and mem­brane pro­tein extracts for PKC
anal­y­sis
Fol­low­ing treat­ment with Tat or PMA in the cal­cium-free
or com­plete medium, mono­cytes were har­vested and rap­idly
lysed at 4 °C in 100 ll of hypo­tonic buffer A (Tris–HCl 200 mM,
EDTA 2 mM, DTT 1 mM, leu­pep­tin 10 lg/ml, PMSF 1 mM; pH 7.5)
by repeated aspi­ra­tion through a syringe fit­ted with a 21 gauge
nee­dle. Fol­low­ing addi­tion of 300 ll ice-cold sam­ple buffer B
(Tris–HCl 20 mM, EDTA 2 mM, DTT 1 mM, leu­pep­tin 10 lg/ml,
PMSF 1 mM, sucrose 0.33 M; pH 7.5) the lysate was cen­tri­fuged
at 100,000g at 4 °C for 40 min. The super­na­tant, cor­re­spond­ing to
the cyto­plas­mic frac­tion, was col­lected and pro­teins were quan­ti­
fied using a Brad­ford assay and stored at ¡20 °C. The mem­brane
pel­lets were sol­u­bi­lized in 50 ll of cold sam­ple buffer B con­tain­
ing 1% Tri­ton X-100, son­i­cated (1 min, power 2.5) and stored at
¡20 °C.
2.3. Pro­tein kinase C and p38 MAP kinase inhi­bi­tion
Iso­lated mono­cytes were cul­tured in the absence or pres­ence
of cal­cium. Mono­cytes were pre­in­cu­bated for 30 min with RO 31
8220, a PKC inhib­i­tor, or SB 202190, a p38 MAP kinase inhib­i­tor,
and HIV-1 Tat (10 nM) was added for an addi­tional 24 h. A puta­tive
cyto­toxic effect of the dif­fer­ent inhib­i­tors was tested by a try­pan
blue dye exclu­sion assay and none was found to be cyto­toxic (via­
bil­ity was >90%) at the con­cen­tra­tions used. As a con­trol, the same
2.6.2. Iso­la­tion of cyto­plas­mic pro­tein extracts for p38MAP kinase
anal­y­sis
After treat­ment with Tat (10 nM), mono­cytes were har­vested
and rap­idly lysed at 4 °C in 200 ll of Hypo­tonic buffer A (HEPES
10 mM pH 7.9, KCl 10 mM, EDTA 0.1 mM, EGTA 0.1 mM, DTT 1 mM,
PMSF 0.5 mM, Na3VO4 0.2 mM, and NaF 0.05 mM) for 15 min.
Then 12.5 ll of Non­idet P40 10% was added and the lysate was vor­
texed strongly (20 s) before cen­tri­fu­ga­tion (1 min; 14,000 rpm;
4 °C). The super­na­tant cor­re­spond­ing to the cyto­plas­mic frac­tion
was col­lected, quan­ti­fied with a Brad­ford assay and stored at
¡20 °C.
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
2.6.3. Western blot anal­y­sis of PKC trans­lo­ca­tion and p38 MAP kinase
acti­va­tion
Equal amounts of pro­teins (10 or 40 lg) were sub­jected to
10% SDS–PAGE and sep­a­rated pro­teins were trans­ferred to nitro­
cel­lu­lose mem­branes. Immu­no­blot­ting was con­ducted with
either a PKC iso­form-spe­cific anti­body directed against PKC-d
or PKC-bII (1:1000) (Santa Cruz bio­tech­nol­o­gies, Santa Cruz,
CA) or anti-phospho or total p38 MAP kinase (1:1000) (Cell sig­
nal­ling). Mem­brane was blocked with 5% milk in Tris-buf­fered
saline with 0.05% Tween 20 (TTBS) for 1 h, washed four times
with TTBS and then incu­bated with the primary anti­body for
2 h. Immu­no­re­ac­tive bands were detected by incu­ba­tion for
2 h with anti-rab­bit immu­no­glob­u­lins con­ju­gated with horse­
rad­ish per­ox­i­dase (1:1000) (Dako A/S, Ros­kilde, Den­mark). The
mem­branes were visu­al­ized using chemi­lu­mi­nes­cent sub­strate
(Pierce, Rock­ford).
3. Results
3.1. Tat induces IL-10 and TNF-a pro­duc­tion by human mono­cytes
with dif­fer­ent kinet­ics
The effect of HIV-1 Tat pro­tein on the TNF-a and IL-10 pro­duc­
tion by primary human mono­cytes was exam­ined by ELISA. The
treat­ment of mono­cytes by Tat for dif­fer­ent times dem­on­strated
that TNF-a (Fig. 1A, left) and IL-10 (Fig. 1 A right) pro­duc­tions
occurred with dif­fer­ent kinet­ics. The acti­va­tion of mono­cytes
by Tat pro­tein induced TNF-a pro­duc­tion start­ing after 2 h and
47
reach­ing a peak after around 6 h of stim­u­la­tion. In con­trast, IL10 pro­duc­tion became sig­nif­i­cantly detect­able only after 8 h
of stim­u­la­tion by Tat. It increased with stim­u­la­tion time and
peaked after 24 h. These results clearly dem­on­strate that Tat pro­
tein first induces pro­duc­tion of the pro-inflam­ma­tory cyto­kine
TNF-a and, 6 h later, the anti-inflam­ma­tory cyto­kine IL-10 (Fig.
1A).
As shown here and in our pre­vi­ous reports [13,24], the stim­
u­la­tion of human mono­cytes by increas­ing con­cen­tra­tions of
sol­u­ble Tat pro­tein (1 and 10 nM) clearly induced pro­duc­tion of
TNF-a and IL-10 in a dose-depen­dent man­ner after 24 h of stim­u­
la­tion (Fig. 1B). Immo­bi­lized Tat and the deleted mutant Gst-Tat
1–45, unable to be inter­nal­ized by cells, con­tin­ued to stim­u­late
pro­duc­tion of the two cyto­kines in a dose depen­dent man­ner
(Fig. 1B). These results indi­cate that Tat pro­tein acti­vates TNFa and IL-10 pro­duc­tion by mono­cytic cells by act­ing at the cell
mem­brane via its N-ter­mi­nal region. In a neg­a­tive con­trol, when
mono­cytes were stim­u­lated in the same con­di­tions with Gst, no
cyto­kine pro­duc­tion was detected (Fig. 1B). In addi­tion, we deter­
mined that, when mono­cytes were treated with LPS at the limit
of the sen­si­tiv­ity of the LAL assay (50 pg/ml), nei­ther TNF-a nor
IL-10 pro­duc­tion was detected (data not shown), thus exclud­ing
con­tam­i­na­tion of our Tat pro­teins by endo­tox­ins. In addi­tion, pre­
vi­ous neu­tral­iza­tion of Tat with anti-Tat anti­bod­ies, inac­ti­va­tion
with H2O2 oxi­da­tion, or deg­ra­da­tion by tryp­sin totally abol­ished
the capac­ity of Tat to induce IL-10 pro­duc­tion [13] and data not
shown. How­ever, LPS used at 10 and 50 ng/ml induced TNF-a
and IL-10 pro­duc­tion (Fig. 1B).
Fig. 1. Tat induces IL-10 and TNF-a with dif­fer­ent kinet­ics. (A)Kinet­ics of Tat-induced TNF-a and IL-10 stud­ied for 24 h. Mono­cytes were stim­u­lated by 10 nM of Tat and after
2, 4, 6, 8, 12, 16 or 24 h of stim­u­la­tion, cul­ture super­na­tants were recov­ered and the pres­ence of IL-10 and TNF-a was deter­mined in par­al­lel by ELISA. (B) Mono­cytes (106)
were incu­bated with wild type sol­u­ble Tat 1–86 (1, 10 nM), with deleted mutant Gst-Tat 1–45 (1, 10 nM) or with Tat pre­vi­ously immo­bi­lized in the wells (50 nM). Gst pro­tein
(10 nM) was used as the neg­a­tive con­trol, and LPS (10, 50 ng/ml) was used as the positive con­trol. TNF-a and IL-10 pro­duc­tions were mea­sured by ELISA after 6 and 24 h,
respec­tively. The results are expressed in pg/ml. The val­ues are means § SD of three exper­i­ments.
48
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
3.2. Tat induces IL-10 pro­duc­tion via two path­ways
Pre­vi­ous reports have dem­on­strated the capac­ity of TNF-a to
induce the pro­duc­tion of IL-10 [25]. Accord­ingly, in our model, we
dem­on­strated that mono­cytes stim­u­lated by recombinant TNFa (rTNFa) pro­duced IL-10 in a dose-depen­dent man­ner, reach­ing
947 pg/ml (§23) after stim­u­la­tion by 2.5 ng/ml of rTNF-a (Fig. 2A).
As expected, this result clearly dem­on­strated the capac­ity of exog­
e­nous TNF-a to stim­u­late the pro­duc­tion of IL-10 in human mono­
cytes. Fur­ther­more, we showed that this TNF-a-induced IL-10 pro­
duc­tion was totally inhib­ited at the high­est con­cen­tra­tions (5 and
10 lg/ml) of anti-TNF-a anti­bod­ies (Fig. 2B).
Con­sid­er­ing the capac­ity of Tat to induce TNF-a, we won­dered if
the Tat-induced IL-10 pro­duc­tion by mono­cytes was entirely due to
TNF-a pro­duc­tion or could also be med­i­ated by a sec­ond path­way
inde­pen­dent of TNF-a. To ver­ify this and tak­ing into account the
fact that TNF-a pro­duc­tion and sig­nal­ing are cal­cium depen­dent
[26–29], we devel­oped the fol­low­ing com­ple­men­tary pro­to­cols in
which Tat-induced TNF-a pro­duc­tion can be blocked. First, mono­
cytes were treated by Tat (10 nM) in the pres­ence of increas­ing con­
cen­tra­tions of neu­tral­iz­ing anti-TNF-a anti­bod­ies (Fig. 2C). Even in
the pres­ence of the high­est con­cen­tra­tion of anti-TNF-a (10 lg/ml),
IL-10 pro­duc­tion was only par­tially inhib­ited, by 60% (562 § 31 pg/
ml vs 224 § 45 pg/ml) (Fig. 2C), while, in these con­di­tions, total
inhi­bi­tion of TNF-a pro­duc­tion was observed (Fig. 2C). This result
indi­cated that the part of TNF-a induced by Tat in mono­cytes was
only par­tially impli­cated in IL-10 pro­duc­tion, and sug­gested the
exis­tence of a sec­ond path­way for IL-10 pro­duc­tion directly under
the con­trol of Tat. Sec­ond, when mono­cytes were cul­tured in a cal­
cium-free medium, no TNF-a pro­duc­tion was detected after stim­u­
la­tion by Tat. In con­trast, the same cells still pro­duced sig­nif­i­cant
amounts of IL-10 (320 § 20 pg/ml) (Fig. 3A). The TNF-a pro­duc­tion
was restored by the addi­tion of cal­cium chlo­ride (CaCl2, 2 mM) to
the cell cul­ture medium (Fig. 3A). Inter­est­ingly, this TNF-a pro­duc­
tion was accom­pa­nied by an addi­tional increase of IL-10 pro­duc­
tion by about 41.8% (i.e., +230 pg/ml). This find­ing con­firms the con­
tri­bu­tion of TNF-a to Tat-induced IL-10 pro­duc­tion in mono­cytes.
How­ever, in order to exclude the hypoth­e­sis that, in the absence
of cal­cium, TNF-a is syn­the­sized but not secreted, the intra­cel­lu­lar
TNF-a in Tat stim­u­lated mono­cytes was mea­sured. As expected,
cells stim­u­lated by Tat in the pres­ence of cal­cium syn­the­sized TNFa (Fig. 3B). About 30% and 15.5% of cells were TNF-a positive after
3 and 6 h of Tat stim­u­la­tion, respec­tively (Fig. 3B). In con­trast, no
TNF-a positive cells were detected after Tat stim­u­la­tion in a cal­
cium-free medium (Fig. 3B). The same pro­file was obtained with
our positive con­trol LPS (10 ng/ml).
Taken together, these results dem­on­strated that Tat pro­tein, by
act­ing at the cell sur­face, is able to induce IL-10 pro­duc­tion by two
dis­tinct path­ways (i) in a TNF-a depen­dent man­ner, only acti­vated
in the pres­ence of cal­cium and (ii) via a TNF-a inde­pen­dent path­
way which can be directly acti­vated by Tat even in the absence of
extra­cel­lu­lar cal­cium.
3.3. In the absence of TNF-a, Tat-induced IL-10 pro­duc­tion is PKC
depen­dent
In our pre­vi­ous stud­ies, we deter­mined the cru­cial role of the
PKC path­way in IL-10 pro­duc­tion by mono­cytes [13,23]. Thus we
eval­u­ated the role of this path­way in the pres­ence or absence of
extra­cel­lu­lar cal­cium.
To eval­u­ate the role of the PKC path­way in the con­trol of IL-10
pro­duc­tion in the absence of extra­cel­lu­lar cal­cium, primary human
mono­cytes were pre­in­cu­bated with RO31 8220, an inhib­i­tor of
all PKC iso­forms, before stim­u­la­tion by Tat. The results obtained
showed that RO31 8220 inhib­ited IL-10 pro­duc­tion in a dose-depen­
dent man­ner, both in com­plete or cal­cium-free medium. Fur­ther­
more, this inhi­bi­tion became total when the inhib­i­tor was used at
5 lM (Fig. 4A), thus indi­cat­ing that PKC acti­va­tion was cru­cial for
Tat induced IL-10 pro­duc­tion in both the pres­ence and absence of
extra­cel­lu­lar cal­cium.
How­ever, in human mono­cytes, at least 8 iso­forms of PKCs
have been iden­ti­fied [30] and have been clas­si­fied in three groups
based on their abil­ity to be acti­vated by cal­cium and diac­yl­glyc­erol
(DAG): the clas­si­cal PKC-a, -bI, -bII, and -c which need DAG and
cal­cium for their acti­va­tion, the novel PKC-d, -e, and -l which are
acti­vated by DAG but are Ca2+ inde­pen­dent and, finally, the atyp­i­cal
PKC-f which is DAG and Ca2+ inde­pen­dent [31]. Among these PKC
iso­forms, Tat, by act­ing at the cell sur­face, recruits the clas­sic PKCbII and the novel PKC-d, both of which are cru­cial for Tat-induced
IL-10 pro­duc­tion in human mono­cytes [13,23].
In agree­ment with this result, we showed that both PKC-bII
and -d were acti­vated by Tat in the pres­ence of cal­cium as dem­on­
strated by their trans­lo­ca­tion from the cyto­plasm to the mem­brane
(Fig. 4B). Inter­est­ingly, in a cal­cium-free medium, acti­va­tion of the
PKC-d iso­form is induced after 15 and 60 min of stim­u­la­tion by Tat
(Fig. 4B). In con­trast, Tat pro­tein could not induce the acti­va­tion of
PKC-bII in the absence of extra­cel­lu­lar cal­cium (Fig. 4B). Thus, inde­
pen­dently of cal­cium, Tat is able to acti­vate PKC-d but not PKC-bII,
sug­gest­ing that, among PKC iso­forms, PKC-d seems to play a piv­otal
role in Tat induced IL-10 pro­duc­tion in the absence of TNF-a PMA
(phor­bol 12-mir­i­state 13-ace­tate), a PKC acti­va­tor, was used as a
positive con­trol for the induc­tion of IL-10 pro­duc­tion (Fig. 4A) and
acti­va­tion of PKC-bII and -d (Fig. 4B).
3.4. Involve­ment of p38 MAP kinase
Down­stream of PKC-d, we eval­u­ated the involve­ment of p38
MAP kinase, a known potential sub­strate of PKC [32]. Pre­in­cu­ba­
tion of mono­cytes in the pres­ence of cal­cium with SB 202190, a
p38 MAP kinase inhib­i­tor, inhib­ited Tat induced IL-10 pro­duc­tion
(Fig. 5A) by 82.3% when used at 10 lM, while no inhi­bi­tion was
observed when the same amount of DMSO was used in com­bi­na­
tion with Tat 10 nM (Fig. 4A). How­ever, incu­ba­tion of mono­cytes
with SB 202190 in cal­cium-free medium led to 100% IL-10 inhi­bi­
tion (Fig. 5A). These results are in agree­ment with the capac­ity of
Tat pro­tein to acti­vate p38 MAP kinase, in both the pres­ence and
absence of cal­cium (Fig. 5B). There­fore, in the absence of TNF-a,
Tat induced IL-10 pro­duc­tion seems to be strictly depen­dent on
p38 MAP kinase acti­va­tion. Alto­gether, and tak­ing into account the
capac­ity of PKC inhib­i­tors to block IL-10 pro­duc­tion in cal­cium free
medium (Fig. 4A), our data sug­gest that the engage­ment of PKC-d
also appears to be required for down­stream acti­va­tion of p38 MAP
kinase.
4. Dis­cus­sion
HIV-1 Tat pro­tein has been reported to induce TNF-a and IL-10,
in addi­tion to other cyto­kines [22,24]. By act­ing through the acti­va­
tion of NF-jB, TNF-a can poten­ti­ate HIV-1 rep­li­ca­tion [33]. High lev­
els of TNF-a have been observed in serum and brain and in vitro, in
super­na­tant of mono­cytes, PBMC and alve­o­lar mac­ro­phages from
AIDS patients [34]. In addi­tion to its well-described role as a direct
path­o­genic fac­tor in HIV dis­ease [35], TNF-a could also con­trib­
ute, indi­rectly, to immune sys­tem dis­or­der by induc­ing the highly
immu­no­sup­pres­sive IL-10 cyto­kine [4,36]. IL-10 can sup­press the
immune response by inac­ti­vat­ing mac­ro­phages, down reg­u­lat­ing
cell sur­face expres­sion of MHC II anti­gens and dys­re­gu­lat­ing cyto­
kine pro­duc­tion [4,37]. IL-10 can also sup­press HIV-1 rep­li­ca­tion
by act­ing on the inhi­bi­tion of pro-inflam­ma­tory cyto­kines [4] and
by inhib­it­ing Tat func­tion [38]. It has recently been reported that
IL-10 can down reg­u­late cyclin T1 expres­sion through the induc­
tion of its pro­te­ol­y­sis via the pro­tea­some in mac­ro­phages [38].
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
49
Fig. 2. Recombinant TNF-a is able to induce IL-10 pro­duc­tion by mono­cytes. (A) Mono­cytes were stim­u­lated by increas­ing con­cen­tra­tions of recombinant TNF-a (156 to
2500 pg/ml) for 24 h. (B) rTNF-a (20 ng/ml) was pre­vi­ously incu­bated for 1 h at room tem­per­a­ture with increas­ing amounts of anti-TNF anti­bod­ies (0.5, 1, 5, and 10 lg/ml)
before being added to cells for 24 h. (C) Mono­cytes (106) were stim­u­lated by Tat (10 nM) in the absence or in the pres­ence of a neu­tral­iz­ing anti-TNF-a anti­body. After 6 and
24 h, cul­ture super­na­tants were recov­ered and the pres­ence of TNF-a and IL-10 were deter­mined, respec­tively, by ELISA. The results are expressed in pg/ml. The val­ues are
the means § SD of three exper­i­ments.
There­fore, an under­stand­ing of the sig­nal­ing path­ways impli­cated
in the reg­u­la­tion of IL-10 gene expres­sion could be help­ful in devis­
ing strat­e­gies to mod­u­late the immune response.
In our recent stud­ies, we have shown that, in human mono­
cytes, HIV-1 Tat pro­tein induces the acti­va­tion of PKC-a, -bII, -d,
and -e iso­forms, which in turn medi­ate the acti­va­tion of NF-jB and
the expres­sion of TNF-a and IL-10 [23,24]. By using chem­i­cal inhib­
i­tors and oli­go­nu­cleo­tide anti­sense approaches, we iden­ti­fied the
cru­cial role of PKC-bII and PKC-d in the sig­nal­ing path­ways involved
in IL-10 induc­tion by Tat in human mono­cytes [23]. More­over, in
a more recent report and in this study we have dem­on­strated that
Tat-induc­tion of TNF-a by mono­cytes is totally cal­cium depen­dent
[22].
Two ele­ments allowed us to fur­ther inves­ti­gate the rela­tion­ship
between Tat-induced TNF-a and IL-10. First, these cyto­kines are
induced in Tat-acti­vated human mono­cytes with dif­fer­ent kinet­ics.
Sec­ond, stim­u­la­tion of mono­cytes by recombinant TNF-a resulted
in IL-10 pro­duc­tion. There­fore, we inves­ti­gated whether Tat could
induce IL-10 directly and inde­pen­dently of TNF-a pro­duc­tion. For
the sake of clar­ity, in par­al­lel with our original data obtained in
the absence of cal­cium, we have also pre­sented exper­i­ments per­
formed in the pres­ence of cal­cium as reported by our group [13,22]
and oth­ers [39–41]. Our find­ings pre­sented here dem­on­strate that,
when mono­cytes were stim­u­lated by Tat, under con­di­tions where
the TNF-a effect was blocked either by anti-TNF-a anti­bod­ies or
by extra­cel­lu­lar cal­cium pri­va­tion, the mono­cytes con­tin­ued to
50
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
Fig. 3. Tat induces IL-10 by a sec­ond path­way inde­pen­dently of TNF-a. (A) Mono­cytes were incu­bated in a cal­cium-free medium (left) and stim­u­lated by Tat (10 nM). The cal­
cium was restored (right) by sup­ple­ment­ing the medium with cal­cium chlo­ride (2 mM) before Tat stim­u­la­tion. Cul­ture super­na­tants were then recov­ered and the pres­ence
of IL-10 and TNF-a was deter­mined in par­al­lel by ELISA. The results are expressed in pg/ml of cyto­kines. The val­ues are means § SD of three exper­i­ments. (B) Mono­cytes (106),
stim­u­lated or not with 10 nM Tat, in the pres­ence or absence of cal­cium, for 3 or 6 h. Monen­sin was added at the same time in order to block cyto­kine secre­tion. Cells were
stained with anti-CD14 mono­clo­nal anti­body (FITC), fixed with form­al­de­hyde and then stained with anti-TNF-a (APC) mono­clo­nal anti­bod­ies prior to their anal­y­sis by FACS.
Only CD14+ cells (mono­cytes) were ana­lyzed for the pres­ence of TNF-a. LPS (10 ng/ml) was used as positive con­trol.
pro­duce IL-10 fol­low­ing HIV-1 Tat stim­u­la­tion. This sug­gests that
Tat is able to induce IL-10 pro­duc­tion in human mono­cytes by an
alter­na­tive path­way, which is totally inde­pen­dent of cal­cium and
TNF-a. In our pre­vi­ous study [13], we failed to inhibit Tat-induced
IL-10 pro­duc­tion by mono­cytes even in the pres­ence of BAP­TA-AM,
a che­la­tor of intra­cel­lu­lar cal­cium, thus con­firm­ing the inter­ven­
tion of extra­cel­lu­lar cal­cium in Tat-induced IL-10 pro­duc­tion. More­
over, in con­trast to the con­clu­sion advanced by Gee et al., which
involves the mobi­li­za­tion of an intra­cel­lu­lar store of cal­cium [40],
we have dem­on­strated that Tat pro­tein, by act­ing on DHP recep­
tors (di­hy­dro­pyri­din sen­si­tive cal­cium chan­nels), induces an
influx of cal­cium from the extra­cel­lu­lar medium [22]. The impli­
ca­tion of DHP recep­tors was fur­ther dem­on­strated by the inhib­i­
tory effect on cal­cium mobi­li­za­tion and TNF-a pro­duc­tion when
stim­u­la­tion of mono­cytes by Tat was per­formed in the pres­ence of
nimo­di­pine or cal­ci­clu­dine, inhib­i­tors of DHP recep­tors, or in the
pres­ence of spe­cific anti­sense oli­go­nu­cle­o­tides against the a-1 D
sub­unit of DHP recep­tors [22]. Fur­ther­more, the involve­ment of
Tat-DHP recep­tor inter­ac­tion in the con­trol of TNF-a pro­duc­tion is
in agree­ment with our find­ings show­ing that prior immo­bi­li­za­tion
of Tat in cul­ture wells, in order to pre­vent its intra­cel­lu­lar pen­e­tra­
tion, results in an induc­tion of TNF-a sim­i­lar to that obtained with
sol­u­ble Tat pro­tein. This result sup­ports the idea that Tat pro­tein
medi­ates its effect by an action at the cell mem­brane and does not
require its pen­e­tra­tion. This mode of action is also in agree­ment
with the capac­ity of the N-ter­mi­nal Tat 1–45 mutant, which lacks
the basic domain essen­tial for pen­e­tra­tion and nuclear local­i­za­tion
of Tat, to stim­u­late TNF-a and IL-10 pro­duc­tion. How­ever the inabil­
ity of Tat 1–45 to induce the same quan­ti­ties of TNF-a and IL-10
as Tat pro­tein may be related to the more native struc­ture of total
Tat pro­tein.
To fur­ther under­stand the sig­nal­ing impli­cated in this alter­na­
tive path­way acti­vated by Tat, we inves­ti­gated the roles of PKC and
p38 MAP kinase. Using RO 318220, a PKC inhib­i­tor [42], Tat-induc­
tion of IL-10 by mono­cytes was totally blocked in a cal­cium-free
medium as well as in the pres­ence of cal­cium. Fur­ther, we showed
that, in a cal­cium-free medium, Tat induced acti­va­tion of the PKCd, but not PKC-bII, iso­form, as shown by its trans­lo­ca­tion to the
mem­brane. These results are in agree­ment with the char­ac­ter­is­
tics of these two PKC iso­forms since the clas­si­cal PKC-bII, is DAG
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
51
Fig. 4. Role of PKC acti­va­tion in the Tat-induced IL-10 pro­duc­tion in the absence of cal­cium. (A) Mono­cytes (106) cul­tured in a com­plete or cal­cium-free medium were pre­
treated or not with the PKC inhib­i­tor RO31 8220 (2.5 and 5 lM) for 30 min. Tat was then added for 24 h. Cul­ture super­na­tants were recov­ered and the pres­ence of IL-10 was
deter­mined by ELISA. Results are expressed in pg/ml of IL-10 pro­duc­tion. Val­ues are the means § SD of three exper­i­ments from two dif­fer­ent donors. (B) Western blot anal­y­sis
of PKC-BII and-d acti­va­tion by Tat in the pres­ence or absence of cal­cium. Mono­cytes were stim­u­lated by Tat (10 nM) or PMA (100 ng/ml) for 15 and 60 min and PKC trans­lo­ca­
tion to the mem­brane was used as marker of PKC acti­va­tion. Mem­brane (M) and cyto­plas­mic (C) pro­teins were extracted, and ana­lyzed by Western blot using anti-PKC-bII
and -d anti­bod­ies.
Fig. 5. p38 MAPK is cru­cial for Tat-induced IL-10 pro­duc­tion inde­pen­dently of TNF-a. (A) Mono­cytes (106) cul­tured in com­plete medium (left) or in a cal­cium-free medium
(right) were pre­treated or not with the p38 MAP kinase inhib­i­tor SB 202190 (1 and 10 lM) for 30 min. Tat was then added for 24 h. Cul­ture super­na­tants were col­lected and
the pres­ence of IL-10 was deter­mined by ELISA. Results are expressed in pg/ml of IL-10 pro­duc­tion. The absence of TNF-a in the cal­cium-free con­di­tions was ver­i­fied in par­
al­lel. (B) Mono­cytes (4.106) cul­tured in com­plete medium or in cal­cium-free medium were treated by Tat (10 nM) for 10, 30, or 60 min. The p38 MAP kinase acti­va­tion was
ana­lyzed by western blot using an anti­body spe­cific to phospho-p38 MAP kinase, and nor­mal­ized by total p38 MAP kinase rev­e­la­tion.
and cal­cium depen­dent and the novel PKC-d is only depen­dent
on DAG [31]. On the other hand, mono­cyte stim­u­la­tion by Tat in
the pres­ence of SB 202190, a p38 MAP kinase inhib­i­tor, resulted
in partial and total inhi­bi­tion of IL-10 pro­duc­tion in the pres­ence
and absence of cal­cium respec­tively. Sev­eral reports have shown
that p38 MAP kinase is acti­vated down­stream of the PKC path­way
[32,43]. In agree­ment with this, our data sug­gest that PKC-d seems
to be asso­ci­ated with the down­stream acti­va­tion of p38 MAP
kinase, as the two kinases are acti­vated in cal­cium-free medium
after Tat stim­u­la­tion.
In this work, chem­i­cal inhib­i­tors RO 318220 and SB 202190 were
used for the inhi­bi­tion of total PKC iso­forms and p38 MAP kinase
52
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
respec­tively. How­ever, many recent stud­ies have under­lined the
insuf­fi­ciently selec­tive spec­i­fic­ity of these inhib­i­tors [44]. To cir­
cum­vent this lim­i­ta­tion, the acti­va­tion of PKC-bII and -d by Tat was
fur­ther con­firmed by using anti­sense oli­go­nu­cle­o­tides spe­cific for
each PKC iso­form in addi­tion to chem­i­cal inhib­i­tors in our recent
study [23]. Thus, defin­i­tive con­clu­sions require care­ful inter­pre­ta­
tion and need con­fir­ma­tion by com­ple­men­tary approaches using
anti­sense oli­go­nu­cle­o­tides, siR­NA and trans­dom­i­nant neg­a­tive
mutants. Despite this lim­i­ta­tion, if care­fully used, chem­i­cal inhib­
i­tors remain an invalu­able tool for the under­stand­ing of var­i­ous
molec­u­lar and cel­lu­lar mech­a­nisms lead­ing to the devel­op­ment
of new mol­e­cules with ther­a­peu­tic appli­ca­tions as is the case for
most of the drugs cur­rently avail­able.
In sum­mary, the pres­ent study sug­gest the impli­ca­tion of PKCd and p38 MAP kinase as crit­i­cal kinases that sig­nal IL-10 gene
expres­sion both via a TNF-a depen­dent way, which is cal­cium
depen­dent, and via a sec­ond path­way which is cal­cium and TNF-a
inde­pen­dent. This find­ing may have impor­tant bio­log­i­cal sig­nif­i­
cance in the under­stand­ing of the phys­io­pa­thol­ogy of HIV-1 infec­
tion. Taken together, our data allow us to pro­pose the fol­low­ing
model (Fig. 6). After HIV-1 infec­tion, viral com­po­nents, includ­ing
Tat pro­tein, stim­u­late the pro­duc­tion of TNF-a (and other pro­in­
flam­ma­tory cyto­kines), which in turn induce pro­duc­tion of IL-10,
an anti-inflam­ma­tory cyto­kine. Then IL-10 acts as a nat­u­ral ter­mi­
na­tor of cyto­kine pro­duc­tion by acti­vated mono­cyte/mac­ro­phage
cells, and pre­vents the devel­op­ment of a chronic state of inflam­
ma­tion by a subsequent inhi­bi­tion of TNF-a. In con­se­quence,
IL-10 pro­duc­tion via the TNF-a-depen­dent path­way is switched
off. How­ever, in order to ensure unin­ter­rupted pro­duc­tion of this
highly immu­no­sup­pres­sive cyto­kine essen­tial for viral escape
from host immune sur­veil­lance, HIV-1 has devel­oped an alter­na­
tive TNF-a-inde­pen­dent mech­a­nism using its Tat pro­tein. Sta­ples
et al. recently reported that IL-10 is also able to induce its own
pro­duc­tion in primary human mac­ro­phages by acti­vat­ing the tran­
scrip­tion fac­tor Stat3 [45]. Accord­ing to our pro­posed model (Fig.
6), the avail­abil­ity of IL-10 induced by Tat pro­tein may pro­vide
HIV-1 infected cells with a means of escap­ing from immune sur­
Fig. 6. Hypo­thet­i­cal model of trans­duc­tion sig­nals lead­ing to Tat-induced IL-10. Tat
acti­vates IL-10 pro­duc­tion by two path­ways: (i) the first path­way is cal­cium and
TNF-a depen­dent, involv­ing PKC-bII, -d, and p38 MAP kinase and (ii) the sec­ond
path­way is cal­cium inde­pen­dent, involv­ing PKC-d and p38 MAP kinase. In this con­
di­tion a con­stant pro­duc­tion of IL-10 is ensured, even in the absence of TNF- lead­ing
to the estab­lish­ment of a chronic immu­no­sup­pres­sion state impli­cated in the viral
escape from host immune sur­veil­lance.
veil­lance and thus may con­trib­ute to the devel­op­ment of a chronic
car­rier state. In this con­di­tion, con­stant IL-10 pro­duc­tion may con­
fer a sur­vival advan­tage for the virus by pre­vent­ing the imme­di­
ate death of infected mono­cyte/mac­ro­phage cells fol­low­ing direct
HIV-1 rep­li­ca­tion or by the capac­ity of IL-10 to pre­vent apop­to­sis
[46]. By this action, IL-10 may con­trib­ute, on the one hand, to the
estab­lish­ment of latent infec­tion in the mono­cyte/mac­ro­phage
cells, which form a stra­te­gic res­er­voir for HIV-1 infec­tion and, on
the other hand, to the devel­op­ment of immu­no­sup­pres­sion.
Acknowl­edg­ments
This work was sup­ported by Agence Na­tio­nale de Recher­che
sur le SIDA, Cons­eil Région­al Midi-Pyr­énées, SI­DAC­TION and Uni­
ver­sité Paul Saba­tier, Tou­louse. We thank Mar­tine Du­rand for her
tech­ni­cal help and Xavier Con­tre­ras, Marc Mo­reau and Cath­er­ine
Lecl­ere for help­ful dis­cus­sions.
Ref­er­ences
[1] P.R. Clap­ham, A. McKnight, HIV-1 recep­tors and cell tro­pism, Br. Med. Bull. 58
(2001) 43–59.
[2] M. Cler­i­ci, G.M. Shearer, A TH1 TH2 switch is a crit­i­cal step in the eti­ol­ogy of
HIV infec­tion, Immu­nol. Today 14 (1993) 107–111.
[3] M. Cler­i­ci, T.A. Wynn, J.A. Ber­zof­sky, S.P. Blatt, C.W. Hen­drix, A. Sher, et al.,
Role of inter­leu­kin-10 in T helper cell dys­func­tion in asymp­tom­atic indi­vid­u­
als infected with the human immu­no­de­fi­ciency virus, J. Clin. Invest. 93 (1994)
768–775.
[4] K.W. Moore, R. de Waal Mal­efyt, R.L. Coff­man, A. O’Gar­ra, Inter­leu­kin-10 and
the inter­leu­kin-10 recep­tor, Annu. Rev. Immu­nol. 19 (2001) 683–765.
[5] D. Weiss­man, G. Poli, A.S. Fauci, Inter­leu­kin 10 blocks HIV rep­li­ca­tion in mac­
ro­phages by inhib­it­ing the auto­crine loop of tumor necro­sis fac­tor alpha and
inter­leu­kin 6 induc­tion of virus, AIDS Res. Hum. Ret­ro­vir. 10 (1994) 1199–1206.
[6] D. Weiss­man, G. Poli, A.S. Fauci, IL-10 syn­er­giz­es with multiple cyto­kines in
enhanc­ing HIV pro­duc­tion in cells of mono­cytic line­age, J. Acquir. Immune
De­fic. Syn­dr. Hum. Ret­ro­vi­rol. 9 (1995) 442–449.
[7] A.S. Fauci, Host fac­tors and the path­o­gen­e­sis of HIV-induced dis­ease, Nature
384 (1996) 529–534.
[8] H.D. Shin, C. Win­kler, J.C. Ste­phens, J. Bream, H. Young, J.J. Goed­ert, et al.,
Genetic restric­tion of HIV-1 path­o­gen­e­sis to AIDS by pro­moter alleles of IL10,
Proc. Natl. Acad. Sci. USA 97 (2000) 14467–14472.
[9] E. Sty­lia­nou, P. Auk­rust, D. Kvale, F. Muller, S.S. Fro­land, IL-10 in HIV infec­tion:
increas­ing serum IL-10 lev­els with dis­ease pro­gres­sion-down-reg­u­la­tory effect
of potent anti-ret­ro­vi­ral ther­apy, Clin. Exp. Immu­nol. 116 (1999) 115–120.
[10] E.C. Breen, Pro- and anti-inflam­ma­tory cyto­kines in human immu­no­de­fi­ciency
virus infec­tion and acquired immu­no­de­fi­ciency syn­drome, Phar­ma­col. Ther.
95 (2002) 295–304.
[11] J.B. Angel, B.M. Sa­get, M.Z. Wang, A. Wang, C.A. Di­na­rello, P.R. Skol­nik, Inter­
leu­kin-10 enhances human immu­no­de­fi­ciency virus type 1 expres­sion in a
chron­i­cally infected prom­on­o­cy­tic cell line (U1) by a tumor necro­sis fac­tor
alpha-inde­pen­dent mech­a­nism, J. Inter­feron Cyto­kine Res. 15 (1995) 575–
584.
[12] A. Finn­e­gan, K.A. Roe­buck, B.E. Na­kai, D.S. Gu, M.F. Rabbi, S. Song, et al., IL-10
coop­er­ates with TNF-alpha to acti­vate HIV-1 from latently and acutely infected
cells of mono­cyte/mac­ro­phage line­age, J. Immu­nol. 156 (1996) 841–851.
[13] A. Ba­dou, Y. Benn­as­ser, M. Mo­reau, C. Lecl­erc, M. Ben­ki­ra­ne, E. Bah­ra­oui, Tat
pro­tein of human immu­no­de­fi­ciency virus type 1 induces inter­leu­kin-10 in
human periph­e­ral blood mono­cytes: impli­ca­tion of pro­tein kinase C-depen­
dent path­way, J. Virol. 74 (2000) 10551–10562.
[14] M.F. Las­pia, A.P. Rice, M.B. Mathews, HIV-1 Tat pro­tein increases tran­scrip­
tional ini­ti­a­tion and sta­bi­lizes elon­ga­tion, Cell 59 (1989) 283–292.
[15] K. Fu­ji­na­ga, D. Irwin, Y. Hu­ang, R. Ta­ube, T. Ku­rosu, B.M. Pe­ter­lin, Dynam­ics of
human immu­no­de­fi­ciency virus tran­scrip­tion: P-TEFb phos­phor­y­lates RD and
dis­so­ci­ates neg­a­tive effec­tors from the trans­ac­ti­va­tion response ele­ment, Mol.
Cell. Biol. 24 (2004) 787–795.
[16] C.H. Herr­mann, A.P. Rice, Len­ti­vi­rus Tat pro­teins spe­cif­i­cally asso­ci­ate with a
cel­lu­lar pro­tein kinase TAK that hy­per­phosph­ory­lates the car­boxyl-ter­mi­nal
domain of the large sub­unit of RNA poly­mer­ase II: can­di­date for a Tat cofac­tor,
J. Virol. 69 (1995) 1612–1620.
[17] G. Gold­stein, HIV-1 Tat pro­tein as a potential AIDS vac­cine, Nat. Med. 2 (1996)
960–964.
[18] H. Xiao, C. Neu­veut, H.L. Tif­fany, M. Ben­ki­ra­ne, E.A. Rich, P.M. Mur­phy, et
al., Selec­tive CXCR4 antag­o­nism by Tat: impli­ca­tions for in vivo expan­sion
of co­re­cep­tor use by HIV-1, Proc. Natl. Acad. Sci. USA 97 (2000) 11466–
11471.
[19] D.A. Mann, A.D. Fran­kel, Endo­cy­to­sis and tar­get­ing of exog­e­nous HIV-1 Tat
pro­tein, EMBO J. 10 (1991) 1733–1739.
[20] G. Bar­il­lar­i, B. En­sol­i, Angio­genic effects of extra­cel­lu­lar human immu­no­de­fi­
ciency virus type 1 Tat pro­tein and its role in the path­o­gen­e­sis of AIDS-asso­ci­
ated Ka­pos­i’s sar­coma, Clin. Micro­biol. Rev. 15 (2002) 310–326.
K. Legh­mari et al. / Cellular Immunology 253 (2008) 45–53
[21] L. Bu­on­ag­uro, G. Bar­il­lar­i, H.K. Chang, C.A. Bo­han, V. Kao, R. Mor­gan, et al.,
Effects of the human immu­no­de­fi­ciency virus type 1 Tat pro­tein on the expres­
sion of inflam­ma­tory cyto­kines, J. Virol. 66 (1992) 7159–7167.
[22] X. Con­tre­ras, Y. Benn­as­ser, N. Cha­zal, M. Mo­reau, C. Lecl­erc, J. Tkaczuk, et al.,
Human immu­no­de­fi­ciency virus type 1 Tat pro­tein induces an intra­cel­lu­lar cal­
cium increase in human mono­cytes that requires DHP recep­tors: involve­ment
in TNF-alpha pro­duc­tion, Virol­ogy 332 (2005) 316–328.
[23] Y. Benn­as­ser, E. Bah­ra­oui, HIV-1 Tat pro­tein induces inter­leu­kin-10 in human
periph­e­ral blood mono­cytes: involve­ment of pro­tein kinase C-be­taII and delta, FASEB J. 16 (2002) 546–554.
[24] Y. Benn­as­ser, A. Ba­dou, J. Tkaczuk, E. Bah­ra­oui, Sig­nal­ing path­ways trig­gered
by HIV-1 Tat in human mono­cytes to induce TNF-alpha, Virol­ogy 303 (2002)
174–180.
[25] C. Plat­zer, C. Mei­sel, K. Vogt, M. Plat­zer, H.D. Volk, Up-reg­u­la­tion of mono­cytic
IL-10 by tumor necro­sis fac­tor-alpha and cAMP ele­vat­ing drugs, Int. Immu­nol.
7 (1995) 517–523.
[26] K.H. Chen, B.H. Chang, P. Yo­unan, S.G. Shly­kov, B.M. San­born, L. Chan, Increased
intra­cel­lu­lar cal­cium tran­sients by cal­mod­u­lin antag­o­nists dif­fer­en­tially mod­
u­late tumor necro­sis fac­tor-alpha-induced E-selec­tin and ICAM-1 expres­sion,
Ath­ero­scle­ro­sis 165 (2002) 5–13.
[27] A. De, J.M. Krue­ger, S.M. Sima­sko, Tumor necro­sis fac­tor alpha increases cyto­
solic cal­cium responses to AMPA and KCl in primary cul­tures of rat hip­po­cam­
pal neu­rons, Brain Res. 981 (2003) 133–142.
[28] J. Pol­lock, S.M. McFar­lane, M.C. Con­nell, U. Zehavi, P. Van­den­a­be­ele, D.J. Mac­E­wan,
et al., TNF-alpha recep­tors simul­ta­neously acti­vate Ca2+ mobi­li­sa­tion and stress
kinases in cul­tured sen­sory neu­ro­nes, Neu­ro­phar­ma­col­ogy 42 (2002) 93–106.
[29] J.L. Tom­sig, H. Sohma, C.E. Cre­utz, Cal­cium-depen­dent reg­u­la­tion of tumour
necro­sis fac­tor-alpha recep­tor sig­nal­ling by cho­pine, Bio­chem. J. 378 (2004)
1089–1094.
[30] M.M. Mo­nick, A.B. Carter, G. Gu­dm­unds­son, L.J. Geist, G.W. Hun­ninghake,
Changes in PKC iso­forms in human alve­o­lar mac­ro­phages com­pared with
blood mono­cytes, Am. J. Phys­iol. 275 (1998) L389–397.
[31] D. Ron, M.G. Kaza­nietz, New insights into the reg­u­la­tion of pro­tein kinase C
and novel phor­bol ester recep­tors, FASEB J. 13 (1999) 1658–1676.
[32] Y. Ueda, S. Hi­rai, S. Os­ada, A. Su­zuki, K. Miz­uno, S. Ohno, Pro­tein kinase C acti­
vates the MEK-ERK path­way in a man­ner inde­pen­dent of Ras and depen­dent
on Raf, J. Biol. Chem. 271 (1996) 23512–23519.
[33] E.J. Duh, W.J. Ma­u­ry, T.M. Folks, A.S. Fauci, A.B. Rab­son, Tumor necro­sis fac­tor
alpha acti­vates human immu­no­de­fi­ciency virus type 1 through induc­tion of
nuclear fac­tor bind­ing to the NF-kappa B sites in the long ter­mi­nal repeat,
Proc. Natl. Acad. Sci. USA 86 (1989) 5974–5978.
53
[34] S.L. Wes­sel­ingh, C. Power, J.D. Glass, W.R. Tyor, J.C. McAr­thur, J.M. Far­ber, et
al., Intra­ce­re­bral cyto­kine mes­sen­ger RNA expres­sion in acquired immu­no­de­fi­
ciency syn­drome demen­tia, Ann. Neu­rol. 33 (1993) 576–582.
[35] Z.F. Rosen­berg, A.S. Fauci, Im­mu­no­path­o­gen­ic mech­a­nisms of HIV infec­
tion: cyto­kine induc­tion of HIV expres­sion, Immu­nol. Today 11 (1990)
176–180.
[36] M. How­ard, A. O’Gar­ra, Bio­log­i­cal prop­er­ties of inter­leu­kin 10, Immu­nol. Today
13 (1992) 198–200.
[37] S. Red­path, P. Gha­zal, N.R. Gas­co­ig­ne, Hijack­ing and exploi­ta­tion of IL-10 by
intra­cel­lu­lar patho­gens, Trends Micro­biol. 9 (2001) 86–92.
[38] Y. Wang, A.P. Rice, Inter­leu­kin-10 inhib­its HIV-1 LTR-directed gene expres­sion
in human mac­ro­phages through the induc­tion of cyclin T1 pro­te­ol­y­sis, Virol­
ogy 352 (2006) 485–492.
[39] K. Gee, J.B. Angel, W. Ma, S. Mish­ra, N. Gaj­ana­yaka, K. Par­ato, et al., Intra­cel­lu­lar
HIV-Tat expres­sion induces IL-10 syn­the­sis by the CREB-1 tran­scrip­tion fac­tor
through Ser133 phos­phor­y­la­tion and its reg­u­la­tion by the ERK1/2 MAPK in
human mono­cytic cells, J. Biol. Chem. 281 (2006) 31647–31658.
[40] K. Gee, J.B. Angel, S. Mish­ra, M.A. Bla­ho­ianu, A. Kumar, IL-10 reg­u­la­tion by HIVTat in primary human mono­cytic cells: involve­ment of cal­mod­u­lin/cal­mod­u­
lin-depen­dent pro­tein kinase-acti­vated p38 MAPK and Sp-1 and CREB-1 tran­
scrip­tion fac­tors, J. Immu­nol. 178 (2007) 798–807.
[41] J.C. Li, A.S. Lau, A role for mito­gen-acti­vated pro­tein kinase and Ets-1 in the
induc­tion of inter­leu­kin-10 tran­scrip­tion by human immu­no­de­fi­ciency virus1 Tat, Immu­nol­ogy 121 (2007) 337–348.
[42] D.R. Alessi, The pro­tein kinase C inhib­i­tors Ro 318220 and GF 109203X are
equally potent inhib­i­tors of MAP­KAP kinase-1beta (Rsk-2) and p70 S6 kinase,
FEBS Lett. 402 (1997) 121–123.
[43] H.S. Kang, E.K. Park, K.H. Kim, J.Y. Park, J.Y. Choi, H.I. Shin, et al., Recep­tor acti­va­
tor of nuclear fac­tor-kap­paB is induced by a rott­lerin-sen­si­tive and p38 MAP
kinase-depen­dent path­way dur­ing mono­cyte dif­fer­en­ti­a­tion, Mol. Cells 17
(2004) 438–445.
[44] S.P. Davies, H. Red­dy, M. Cai­va­no, P. Cohen, Spec­i­fic­ity and mech­a­nism of
action of some com­monly used pro­tein kinase inhib­i­tors, Bio­chem. J. 351
(2000) 95–105.
[45] K.J. Sta­ples, T. Smal­lie, L.M. Wil­liams, A. Foey, B. Burke, B.M. Fox­well, et al., IL10 induces IL-10 in primary human mono­cyte-derived mac­ro­phages via the
tran­scrip­tion fac­tor Stat3, J. Immu­nol. 178 (2007) 4779–4785.
[46] J.H. Zhou, S.R. Brous­sard, K. Strle, G.G. Fre­und, R.W. John­son, R. Dant­zer, et
al., IL-10 inhib­its apop­to­sis of promy­eloid cells by acti­vat­ing insu­lin recep­tor
sub­strate-2 and phos­pha­ti­dyl­in­o­si­tol 39-kinase, J. Immu­nol. 167 (2001) 4436–
4442.
Article 2
HIV-1 Tat protein induces TNF-α and IL-10 production by
human macrophages: differential implication of PKC-βII and -δ
isozymes and MAP kinases ERK1/2 and p38
Kaoutar Leghmari, Xavier Contreras, Corinne Moureau and Elmostafa Bahraoui
Cellular immunology
Juin 2008, sous presse
164
RESUME DE L’ARTICLE 2
Dans cette étude, nous avons démontré que la protéine Tat du VIH-1 est capable d’induire
l’IL-10 et le TNF-α par les macrophages humains. Nos résultats montrent que la région Nterminale Tat 1-45 induit l’activation de la voie PKC, en agissant au niveau membranaire.
L’inhibition de la voie PKC, par des inhibiteurs chimiques ou après traitement au PMA, abolit
complètement la production de l’IL-10 et du TNF-α. Parmi les 8 isoformes de PKCs
exprimées dans les macrophages, seules les PKC-βII et -δ sont activées par protéineTat
entière ou la Tat 1-45. Cependant, l’inhibition sélective de ces deux isoformes n’affecte que la
production de l’IL-10. En aval des PKC, Tat active les MAP kinases p38 et ERK1/2 et le
facteur de transcription NF-κB. L’utilisation des inhibiteurs chimiques a montré que les MAP
kinases ERK1/2 et le facteur de transcription NF-κB jouent tous les deux un rôle important
dans la production de l’IL-10 et du TNF-α dans les macrophages stimulés par Tat. Cependant,
la MAP kinase p38 semble uniquement impliquée dans la production de l’IL-10 mais pas du
TNF-α.
165
ARTICLE IN PRESS
Cellular Immunology xxx (2008) xxx–xxx
Contents lists available at ScienceDirect
Cellular Immunology
j o u r n a l h o m e p a g e : w w w . e l s e v i e r. c o m / l o c a t e / y c i m m
HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages:
Differential implication of PKC-bII and -d isozymes and MAP kinases ERK1/2 and
p38
Kaoutar Leghmari, Xavier Contreras, Corinne Moureau, Elmostafa Bahraoui*
Lab­o­ra­toire d’Immuno-vi­rol­o­gie des len­ti­vi­rus des pri­ma­tes, Uni­ver­sité Paul Saba­tier 118, route de Nar­bonne bâti­ment 4R3, 31062 Tou­louse, France
a r t i c l e
i n f o
Article history:
Received 26 Feburary 2008
Accepted 26 June 2008
Available online xxxx
Key­words:
Mac­ro­phages
HIV-1
Tat
PKC-bII
PKC-d
p38 MAP kinase
ERK1/2 MAP kinase
NF-jB
IL-10
TNF-a
a b s t r a c t
In this study, we dem­on­strate that HIV-1 Tat pro­tein is able to induce IL-10 and TNF-a in human mac­
ro­phages. We show that N-ter­mi­nal Tat 1-45 frag­ment ini­ti­ates the PKC path­way by act­ing at the mem­
brane. Inhi­bi­tion of PKC path­way, by chem­i­cal inhib­i­tors or after PMA treat­ment, abol­ishes both IL-10 and
TNF-a pro­duc­tion. Among the eight PKC iso­forms pres­ent in mac­ro­phages, we show that only PKC-bII
and -d are acti­vated by Tat or Tat 1-45 in human mac­ro­phages. How­ever, their selec­tive inhi­bi­tion affects
only IL-10 pro­duc­tion. Down­stream of PKC, Tat acti­vates the MAP kinases p38 and ERK1/2 and the tran­
scrip­tion fac­tor NF-jB. Using chem­i­cal inhib­i­tors we show that (i) both ERK1/2 MAP kinase and NF-jB
tran­scrip­tion fac­tor play an impor­tant role in IL-10 and TNF-a pro­duc­tion, in mac­ro­phages stim­u­lated by
Tat. How­ever, p38 MAP kinase seems to be involved only in IL-10 and not TNF-a pro­duc­tion.
© 2008 Elsevier Inc. All rights reserved.
1. Intro­duc­tion
Mac­ro­phages are major tar­gets for infec­tion by human immu­no­
de­fi­ciency virus type 1 (HIV-1) [1–3]. These cells become infected
imme­di­ately after con­tact with the virus and pro­duce high lev­els
of HIV-1 with­out a sig­nif­i­cant cyto­pathic effect [4–6]. Mac­ro­phages
are a major res­er­voir of HIV [1] and con­tinue to pro­duce large
amounts of viral par­ti­cles even fol­low­ing the deple­tion of CD4+
T cells, as dem­on­strated in the SHIV/macaque model [7,8]. In addi­
tion to their role as a pro­duc­tive res­er­voir, inap­pro­pri­ate acti­va­tion
of infected or non-infected mac­ro­phages may con­trib­ute to the
path­o­gen­e­sis of HIV-1 infec­tion. This acti­va­tion can be med­i­ated
by either viral par­ti­cles or sol­u­ble viral pro­teins (gp120, Nef, Tat),
fol­low­ing inter­ac­tions with cell sur­face recep­tors includ­ing CD4,
CCR5 and oth­ers [9–12]. These inter­ac­tions lead to the acti­va­tion
of sev­eral sig­nal­ing path­ways impli­cated in viral rep­li­ca­tion and
the alter­ation of cyto­kine pro­duc­tion. In HIV-1 infected patients,
periph­e­ral blood mono­nu­clear cells pro­duce large amounts of
IL-10, a highly immu­no­sup­pres­sive cyto­kine, and TNF-a, a proinflam­ma­tory cyto­kine, in par­al­lel with the alter­ation of CD4+ T
cells’ pro­lif­er­a­tive func­tion [13–15].
* Cor­re­spond­ing author. Fax: +33 561 558 667.
E-mail address: bah­ra­[email protected] (E. Bahraoui).
IL-10 is pro­duced by T and B lym­pho­cytes, den­dritic cells and
mono­cytes/mac­ro­phages [16]. In addi­tion to its involve­ment in
HIV-1 path­o­gen­e­sis, IL-10 has also been asso­ci­ated with auto­im­
mune and other infec­tious dis­eases. IL-10 inter­feres with the
expres­sion of sev­eral cyto­kines and acces­sory func­tions of mac­
ro­phages. It is thus a potent sup­pres­sor of the effec­tor func­tions
of mac­ro­phages, T cells and nat­u­ral killer cells [16,17]. IL-10 can
also sup­press HIV-1 rep­li­ca­tion (i) by act­ing on the inhi­bi­tion of
pro-inflam­ma­tory cyto­kines [16] and (ii) by inhib­it­ing Tat func­tion
[18]. It has recently been reported that IL-10 might down-reg­u­late
cyclin T1 expres­sion through the induc­tion of its pro­te­ol­y­sis via
the pro­tea­some in mac­ro­phages [18].
In par­al­lel, TNF-a could also con­trib­ute indi­rectly to immune
sys­tem dis­or­ders by induc­ing the highly immu­no­sup­pres­sive IL-10
cyto­kine [16,19], in addi­tion to its well-described role as a direct
path­o­genic fac­tor in HIV-induced neu­ro­log­i­cal dis­ease [15,20].
How­ever, in con­trast to IL-10, this pro-inflam­ma­tory cyto­kine stim­
u­lates virus rep­li­ca­tion in chron­i­cally infected cells [21–24].
By secret­ing a vari­ety of cyto­kines like TNF-a and IL-10, acti­
vated mac­ro­phages par­tic­i­pate in the con­trol of HIV-1 rep­li­ca­tion
and the immune sys­tem dys­reg­u­la­tion. Our group has dem­on­
strated that one of the viral fac­tors involved in IL-10 and TNF-a
pro­duc­tion by mono­cytes is HIV-1 Tat pro­tein [25–27]. In the pres­
ent study, we exam­ined the effect of HIV-1 Tat on the induc­tion of
0008-8749/$ - see front matter © 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.cellimm.2008.06.011
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
IL-10 and TNF-a by mac­ro­phages and char­ac­ter­ized the sig­nal­ing
path­ways involved.
HIV-1 Tat is a 14–16 kDa pro­tein which pro­motes tran­scrip­
tion of the viral genome by inter­act­ing with the trans­ac­ti­va­tion
response ele­ment, located at the 59-end of the nascent viral mRNA
[28]. Dur­ing infec­tion, both in vivo and in vitro, Tat is released into
the extra­cel­lu­lar com­part­ment. Extra­cel­lu­lar Tat can thus be taken
up by neigh­bour­ing cells, and mod­u­lates viral and/or cel­lu­lar func­
tions [29–31]. Pleio­tro­pic func­tions related to HIV infec­tion and
immune dis­or­ders have been described for Tat, includ­ing apop­to­sis
[32], cyto­kine gene mod­u­la­tion and induc­tion of CCR5 and CXCR4
co­re­cep­tor expres­sion [33].
In the pres­ent study, we ana­lyzed the effect of HIV-1 Tat pro­
tein on the IL-10 and TNF-a pro­duc­tion in human mac­ro­phages.
The sig­nal trans­duc­tion stud­ies showed that the PKC path­way is
involved in the induc­tion of the two cyto­kines. Down­stream from
PKC, the acti­va­tion of ERK1/2 MAP kinase and NF-jB ini­ti­ated by
PKC is required, while p38 MAP kinase is only essen­tial for the IL10, but not TNF-a pro­duc­tion.
2.3.1. PKC deple­tion
Mac­ro­phages were depleted of PKCs by treat­ment for 24 h or
48 h, with phor­bol-12-myr­is­tate-13-ace­tate (PMA) (100 ng/ml)
(Cal­bio­chem, Cal­i­for­nia, USA), which is known as a broad PKC acti­
va­tor.
2. Mate­ri­als and meth­ods
2.4. Iso­la­tion of cyto­plas­mic and mem­brane pro­tein extracts
2.1. Iso­la­tion of mono­cytes and dif­fer­en­ti­a­tion in mac­ro­phages
Fol­low­ing treat­ment with Tat, LPS or PMA, mac­ro­phages were
har­vested and rap­idly lysed at 4 °C in 100 ll of hypo­tonic buffer
A (Tris–HCl 200 mM, EDTA 2 mM, DTT 1 mM, leu­pep­tin 10 lg/ml,
PMSF 1 mM; pH 7.5) by repeated aspi­ra­tion through a syringe fit­
ted with a 21 gauge nee­dle. Fol­low­ing addi­tion of 300 ll ice-cold
sam­ple buffer B (Tris–HCl 20 mM, EDTA 2 mM, DTT 1 mM, leu­pep­
tin 10 lg/ml, PMSF 1 mM, sucrose 0.33 M; pH 7.5), the lysate was
cen­tri­fuged at 100,000g at 4 °C for 40 min. The super­na­tant, cor­re­
spond­ing to the cyto­plas­mic frac­tion, was col­lected and pro­teins
were quan­ti­fied using a Brad­ford assay and stored at ¡20 °C. The
mem­brane pel­lets were sol­u­bi­lized in 50 ll of cold sam­ple buffer
B con­tain­ing 1% Tri­ton X-100, son­i­cated (1 min, power 2.5) and
stored at ¡20 °C.
Periph­e­ral blood mono­nu­clear cells (PBMC) were iso­lated
from the buffy coat of healthy HIV-neg­a­tive donors in a Fi­coll
den­sity gra­di­ent (Pharmacia). The PBMC were resus­pended in
com­plete medium (60% AIMV and 30% Is­cove [Gib­co]) con­tain­
ing pen­i­cil­lin (100 IU/ml), strep­to­my­cin (100 lg/ml) and 10% FCS
(Fetal Calf Serum). PBMC were then plated at 5 £ 105 cells/well
in 24-well, Pri­ma­ria (Bec­ton Dick­in­son) tis­sue cul­ture plates,
and main­tained at 37 °C in a humid­i­fied atmo­sphere con­tain­ing
5% CO2. After 45 min, non-adher­ent cells were removed and the
remain­ing cells were washed twice, then incu­bated in a 10% FCS,
1% M-CSF and 1% PS mix­ture. Blood mono­cytes adhered to plas­
tic after 1 h and acquired mac­ro­phage-like mor­phol­ogy within
5 days. The medium was changed every 3 days. On day 7, dif­fer­
en­ti­ated mac­ro­phages were stim­u­lated with the dif­fer­ent com­
pounds tested.
2.2. Recombinant HIV-1 Tat pro­teins
Recombinant HIV-1 Tat (1-86) pro­tein was obtained from
the Agence Na­tio­nale de la Recher­che sur le SIDA (Paris, France).
Wild-type GST-Tat (1-101) and the deleted mutant Gst-Tat 1-45
was pro­duced as glu­ta­thi­one-S-trans­fer­ase (Gst) fusion pro­tein in
Esch­e­richia Coli as pre­vi­ously described [25,34]. As a con­trol, Gst
was puri­fied in the same con­di­tions as described above and used
in the same exper­i­ments. The level of endo­toxin con­tam­i­na­tion
in puri­fied HIV-1 Tat was assessed using the Lim­u­lus ame­bo­cyte
lysate (LAL) assay (Bi­oSe­pra, Ville­neuve la Gar­enne, France). Tat
recombinant pro­teins are LPS free (less than 0.3 EU/lg) and bio­log­
i­cally active, for the trans­ac­ti­va­tion of HIV-1 long ter­mi­nal repeat
(LTR), as pre­vi­ously described [27,35].
2.3. PKC and MAP kinases inhi­bi­tion
Dif­fer­en­ti­ated mac­ro­phages were cul­tured in the absence or
pres­ence of Tat. Mac­ro­phages were pre-incu­bated for 30 min with
RO31-8220, a PKC inhib­i­tor, Hi­spi­din, a PKC-bII inhib­i­tor, or Rott­
lerin, a PKC-d inhib­i­tor (Cal­bio­chem, CA, USA). MAP kinases p38
and ERK1/2 were inhib­ited by using Sb202190 or U0126, respec­
tively. HIV-1 Tat (10 nM) was added for var­i­ous times. A puta­tive
cyto­toxic effect of the dif­fer­ent inhib­i­tors was tested by a try­pan
blue dye exclu­sion assay and none was found to be cyto­toxic (via­bil­
ity was >90%) at the con­cen­tra­tions used.
2.3.2. Treat­ment by oli­go­nu­cle­o­tides
Phosp­horo­thio­ate oli­go­nu­cle­o­tides were syn­the­sized by ­Gen­set
Oligo (Gen­set SA, France). The sequences of anti­sense oli­go­de­oxy­
nu­cleo­tides for PKC-bII and PKC-d are (ACA­TCTACTTAGCTCTT­G
AC) and (GA­ACGGCGCCATGGTGGGGC), respec­tively. Con­trol
sense oli­go­de­oxy­nu­cleo­tides are (GTCAAGAGCTAAGTAGATGT) and
(GCCCCACCATGGCGCCGTTC), respec­tively. These sequences were
selected and tested as described in [27]. Mac­ro­phages were plated
in Is­cove medium (1% FCS) and treated with sense or anti­sense oli­
go­nu­cle­o­tides for 20 h. Mac­ro­phages were washed and incu­bated
with oli­go­nu­cle­o­tides and Tat (10 nM). Iso­form-spe­cific inhi­bi­tion
was assessed by Western blot after 1 h, and IL-10 or TNF-a pro­duc­
tion was mea­sured by ELISA after 24 h.
2.5. Iso­la­tion of cyto­plas­mic and nuclear pro­tein extracts
After treat­ment with Tat (10 nM), mac­ro­phages were har­vested
and rap­idly lysed at 4 °C in 200 ll of hypo­tonic buffer A (Hepes
10 mM pH 7.9, KCl 10 mM, EDTA 0.1 mM, EGTA 0.1 mM, DTT 1 mM,
PMSF 0.5 mM, Na3VO4 0.2 mM, NaF 0.05 mM) for 15 min. Then
12.5 ll of Non­idet P40 10% was added, the lysate was vor­texed
(20 s) before cen­tri­fu­ga­tion (1 min; 14,000 rpm; 4 °C). The super­na­
tant cor­re­spond­ing to the cyto­plas­mic frac­tion was col­lected; the
nucleus pel­lets were sol­u­bi­lized in 100 ll of cold sam­ple buffer B
(Hepes 20 mM pH 7.9, NaCl 0.4 M, EDTA 1 mM, EGTA 1 mM, DTT
1 mM, PMSF 1 mM, Na3VO4 0.2 mM, NaF 0.05 mM) and shaken
strongly for 15 min at 4 °C. After cen­tri­fu­ga­tion, nuclear pro­teins
were col­lected in the super­na­tant, quan­ti­fied with a Brad­ford assay
and stored at ¡20 °C.
2.6. Western blot anal­y­sis
Equal amounts of pro­tein were sub­jected to 10% sodium dode­
cyl sul­fate poly­acryl­amide gel elec­tro­pho­re­sis (SDS–PAGE) and
sep­a­rated pro­teins were trans­ferred to nitro­cel­lu­lose mem­branes.
Immu­no­blot­ting was con­ducted with anti-p38 or anti-phosphop38, anti-ERK1/2 or anti-phospho-ERK1/2, or anti-p65 anti­bod­ies
(1:1000) or with PKC iso­form-spe­cific anti­bod­ies directed against
PKC-bII, -d, -a, -h, -e and -g (1:1000) (Santa Cruz Bio­tech­nol­o­gies,
CA). The mem­branes were blocked with 5% milk in Tris-buf­fered
saline with 0.05% Tris-Tween buf­fered saline (TTBS) 20 for 1 h,
washed four times with TTBS and incu­bated with the primary anti­
body over­night at 4 °C. Immu­no­re­ac­tive bands were detected by
incu­ba­tion for 2 h with horse­rad­ish per­oxy­dase (1:1000) (DAKO
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
A/S, Ros­kilde, Den­mark). Mem­branes were visu­al­ized using a
chemi­lu­mi­nes­cent sub­strate (Pierce, Rock­ford, IL).
2.7. IL-10, TNF-a and IL-12 detec­tion by ELISA
Cyto­kines pro­duc­tion was quan­ti­fied by using a two-site sand­
wich ELISA kit (eBio­science, San Diego, CA). Briefly, plates were
coated with mono­clo­nal cap­ture anti­bod­ies for TNF-a, IL-10 or
IL-12. Then the plates were blocked before addi­tion of the cul­ture
super­na­tants (100 ll/well) for cyto­kine cap­ture. TNF-a, IL-10 and
IL-12 were detected by stain­ing using bio­tin­yl­a­ted anti­bod­ies. The
subsequent steps were the same as those described in [27].
3. Results
3.1. Exog­e­nous Tat pro­tein induces IL-10 and TNF-a pro­duc­tion in
human mac­ro­phages
Mono­cyte-derived mac­ro­phages (0.5 £ 106 cells/well) obtained
by adher­ence after 7 days of cul­ture were stim­u­lated for 24 h in the
pres­ence of sol­u­ble recombinant wild-type Tat 1-86 pro­tein from
HIV-1 Lai, GST-Tat 1-101 or N-ter­mi­nal GST-Tat 1-45 from HIV-1
SF2 (Fig. 1A) at 1, 10 or 100 nM. The amounts of IL-10 (Fig. 1B) and
TNF-a (Fig. 1C) pro­duced in cell super­na­tants were mea­sured by
ELISA. No IL-10 pro­duc­tion was detected in the super­na­tant of
unstim­u­lated mac­ro­phages or mac­ro­phages cul­tured in the pres­
ence of GST alone (Fig. 1B), while stim­u­la­tion with LPS at 100 ng/
ml resulted in the pro­duc­tion of IL-10 (716 ± 48.08 pg/ml). Human
mac­ro­phages treated with var­i­ous con­cen­tra­tions of GST-Tat 1-101
induced dose-depen­dent IL-10 pro­duc­tion from 27.5 ± 4.9 pg/ml
with 1 nM to 697 ± 14.14 pg/ml with 100 nM GST-Tat 1-101. When
mac­ro­phages were stim­u­lated with GST-Tat 1-45, a sim­i­lar doseresponse effect was obtained. The pro­duc­tion of IL-10 var­ied from
13 ± 5.65 pg/ml with 1 nM Tat 1-45 to 526 ± 7.07 pg/ml with 100 nM
(Fig. 1B). The lat­ter result indi­cates that, despite the absence of
basic region 47–57, which is essen­tial for the pen­e­tra­tion of Tat
[36], the N-ter­mi­nal frag­ment Tat 1-45 stim­u­lated the pro­duc­tion
of IL-10 in mac­ro­phages. Thus, these results sug­gest that Tat stim­
u­lates IL-10 pro­duc­tion by act­ing directly at the cell mem­brane
of mac­ro­phages. This con­clu­sion is in agree­ment with the abil­ity
of immo­bi­lized Tat pro­tein to induce IL-10 and TNF-a pro­duc­tion
(data not shown).
The results depicted in Fig. 1C, showed the capac­ity of Tat pro­
tein and the N-ter­mi­nal frag­ment Tat 1-45 to stim­u­late TNF-a
Fig. 1. Tat induces IL-10 and TNF-a by act­ing at the mem­brane level. (A) Struc­ture of wild-type GST-Tat 1-101 and mutants GST-Tat 1-45. (B) Mac­ro­phages (5 £ 105 cells) were
incu­bated with GST-Tat 1-101 (1, 10, 100 nM), GST-Tat 1-45 (1, 10, 100 nM) for 24 h. (C) Mac­ro­phages (5 £ 105 cells) were incu­bated with Tat 1-86 or with GST-Tat 1-45 (10 nM)
for 6 h. As neg­a­tive con­trols, cells were untreated or treated with GST (10, 100 nM) for 6 or 24 h. LPS was used as a positive con­trol, at 100 ng/ml. Cul­ture super­na­tants were
recov­ered and the IL-10 and TNF-a were mea­sured by ELISA. The results are expressed in pg/ml. The val­ues are rep­re­sen­ta­tive of three inde­pen­dent exper­i­ments.
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
Fig. 2. Tat induces TNF-a and IL-10 with dif­fer­ent kinet­ics. Mac­ro­phages were stim­u­lated by 10 nM of Tat1-45 and after 2, 3, 4, 6, 8, 12, 16, 18, 24, 48 or 72 h of stim­u­la­tion.
Untreated cells were used as con­trol designed by “C”. Cul­ture super­na­tants were recov­ered and the pres­ence of (A) TNF-a, (B) IL-10 and (C) IL-12, was deter­mined by ELISA.
The results are expressed in pg/ml. The val­ues are means ± SD of three exper­i­ments.
pro­duc­tion (689.04 ± 44.04 pg/ml vs 667.84 ± 114.56 pg/ml, respec­
tively). In Tat-treated mac­ro­phages, TNF-a and IL-10 pro­duc­tion
occurred with dif­fer­ent kinet­ics, reach­ing a peak after around 6 h
and 12 h, respec­tively (Fig. 2A and B). In addi­tion, we inves­ti­gated
the effect of Tat on IL-12 pro­duc­tion. The results obtained (Fig. 2C)
showed no IL-12 pro­duc­tion in the cell super­na­tants of Tat-treated
mac­ro­phages, dur­ing 48 h of kinetic anal­y­sis.
3.2. The role of the PKC path­way in IL-10 and TNF-a pro­duc­tion
We have pre­vi­ously dem­on­strated that the PKC path­way is
impli­cated in the pro­duc­tion of IL-10 and TNF-a by HIV-1 Tat in
mono­cytes [26,27]. So we won­dered whether these sig­nal­ing path­
ways would be con­served after mono­cytes had dif­fer­en­ti­ated into
mac­ro­phages.
To inves­ti­gate the role of the PKC path­way in Tat-induced IL-10
pro­duc­tion, we first depleted the cel­lu­lar pool of PKCs by pre-treat­
ing mac­ro­phages with PMA (100 ng/ml), an acti­va­tor of clas­si­cal
and novel PKC iso­forms, for 24 or 48 h. The treated mac­ro­phages
were then stim­u­lated by 10 nM Tat 1-45 and IL-10 or TNF-a pro­
duc­tion was mea­sured 24 h and 6 h later, respec­tively (Fig. 3A and
B). The results obtained dem­on­strated a strong inhi­bi­tion of Tatinduced pro­duc­tion of IL-10 (up to 80%) and of TNF-a (up to 50%)
in the mac­ro­phages pre­treated with PMA for 24 h. The inhi­bi­tion
became total after 48 h of treat­ment with PMA (Fig. 3A and B).
These results indi­cate that clas­si­cal and novel, but not atyp­i­cal, PKC
iso­forms have a role in the mech­a­nism of Tat-induced IL-10 and
TNF-a pro­duc­tion in human mac­ro­phages. Although 100 ng/ml is
the con­cen­tra­tion of PMA usu­ally used to induce sig­nal­ing, we ver­
i­fied cel­lu­lar via­bil­ity after 24 h and 48 h using the try­pan blue dye
exclu­sion test. Less than 20% of cells were dead in these con­di­tions
(data not shown).
To fur­ther inves­ti­gate the role of the PKC path­way in the con­
trol of IL-10 and TNF-a induc­tion, we pre-incu­bated mac­ro­phages
with RO31-8220, an inhib­i­tor of all PKC iso­forms, before stim­u­la­
tion with 10 nM of Tat 1-45 pro­tein. Dose-depen­dent inhi­bi­tion of
IL-10 and TNF-a pro­duc­tion resulted in 60% and 63.4% of inhi­bi­
tion, respec­tively, at 1 lM RO31-8220, and reached 100% at 5 lM
(Fig. 3C and D). A sim­i­lar pattern of inhi­bi­tion was obtained when
TNF-a pro­duc­tion was mea­sured at 24 h post-stim­u­la­tion (data not
shown).
Tak­ing into account the effect of IL-10 on IL-12 pro­duc­tion, we
ana­lyzed the pro­duc­tion of the lat­ter cyto­kine after the inhi­bi­tion
of IL-10 pro­duc­tion by RO31-8220 or 48 h of PMA treat­ment even
in these con­di­tions, Tat pro­tein remained unable to induce IL-12
pro­duc­tion in mac­ro­phages (Fig. 3E).
3.3. HIV-1. Tat pro­tein acti­vates PKC-bII and -d iso­forms in
mac­ro­phages
Among the 11 PKC iso­forms char­ac­ter­ized, at least eight are
pres­ent in human mono­cyte/mac­ro­phages, includ­ing PKC iso­forms
a, bI, bII, d, e, l, h and f [37]. Thus, it is not known which PKC iso­
forms are acti­vated by Tat and which are cru­cial for the con­trol of
IL-10 and TNF-a in mac­ro­phages stim­u­lated by Tat.
Mac­ro­phages from healthy donors were stim­u­lated for 30 or
60 min with 10 nM of Tat. PKC iso­forms in the cyto­plas­mic and
cell mem­brane com­part­ments were sep­a­rated and ana­lyzed by
Western blot­ting, using spe­cific anti­bod­ies for each iso­form (Fig.
4A). In unstim­u­lated cells, PKC iso­forms are local­ized essen­tially in
the cyto­plas­mic com­part­ment. As expected, stim­u­la­tion of mac­ro­
phages with PMA at 100 ng/ml for 30 min induced an almost total
trans­lo­ca­tion of the PKC iso­forms from the cyto­plasm to the mem­
brane. Inter­est­ingly, Tat-induced acti­va­tion of the PKC-bII and -d
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
Fig. 3. Role of PKC path­way in IL-10 and TNF-a pro­duc­tion. (A) and (B) The cel­lu­lar pool of PKC was depleted by pre-treat­ing mac­ro­phages with PMA (100 ng/ml), for 24 or
48 h. The cells were washed, then stim­u­lated or not, by GST-Tat 1-45 pro­tein (10 nM). (C) and (D) Mac­ro­phages were pre­treated or not for 60 min with total PKC inhib­i­tor
RO31-8220 (1, 5 lM) before stim­u­la­tion by GST-Tat 1-45 (10 nM). As a neg­a­tive con­trol, untreated cells or GST pro­tein (10 nM) stim­u­lated cells were used. TNF-a and IL-10
pro­duc­tion was mea­sured, respec­tively, 6 or 24 h later by ELISA. (E) The effect of Tat1-45 on IL-12 pro­duc­tion was mea­sured by ELISA, under con­di­tions where IL-10 was
blocked by RO31-8220 or after PKC deple­tion by PMA treat­ment dur­ing 48 h. GST was used as con­trol. Results are expressed in pg/ml. The val­ues are rep­re­sen­ta­tive of three
inde­pen­dent exper­i­ments.
iso­forms after 60 and 30 min of treat­ment, respec­tively. No sig­nif­
i­cant acti­va­tion by Tat was observed for PKC-a, -h or -e iso­forms,
while PKC-g seems to be con­sti­tu­tively active as shown in the
unstim­u­lated cells (Fig. 4A).
We fur­ther focused our study on the effect of N-ter­mi­nal Tat
1-45, which is also able to induce IL-10 and TNF-a pro­duc­tion in
the mac­ro­phages on PKC-bII and -d acti­va­tion. Visual inspec­tion of
the results shown in Fig. 4B clearly indi­cates that Tat 1-45 acti­vates
the trans­lo­ca­tion of PKC-bII and -d iso­forms to the mem­brane. The
com­par­i­son with the ratio val­ues of the PKC iso­form den­si­ties,
between mem­branes and cyto­plas­mic bands, obtained before and
after cell stim­u­la­tion, clearly showed the high capac­ity of Tat pro­
tein to acti­vate the mem­brane trans­lo­ca­tion of these two PKC iso­
forms. For PKC-bII the ratios were 0.44 in unstim­u­lated cells and
1.1 after stim­u­la­tion by Tat1-45. For PKC d, the ratios were 0.51 and
1.11 in con­trol and Tat 1-45 stim­u­lated cells, respec­tively (Fig. 4B
and C). As a con­trol, we showed that stim­u­la­tion of mac­ro­phages
with LPS led to the acti­va­tion of the PKC-d but not the -bII iso­form
(Fig. 4B). The lat­ter result pro­vides an addi­tional argu­ment to sup­
port the absence of LPS con­tam­i­na­tion in our Tat pro­tein prep­a­ra­
tions, in agree­ment with the LAL assay.
3.4. PKC-bII and -d are required for pro­duc­tion of Tat-induced IL-10
but not of TNF-a
The role of PKC-bII and -d iso­forms in the con­trol of IL-10 and
TNF-a expres­sion was tested using non-cyto­toxic con­cen­tra­tions
of Rott­lerin, a PKC-d inhib­i­tor (1 or 5 lM), Hi­spi­din, a PKC-bII inhib­
i­tor (2 or 20 lM) or RO31-8220 (1 or 5 lM), an inhib­i­tor of all PKCs,
before stim­u­la­tion with 10 nM of Tat 1-45 (Fig. 5). As already shown
in Fig. 3, pro­duc­tion of both IL-10 and TNF-a was inhib­ited in the
pres­ence of the total PKC inhib­i­tor RO31-8220 (Fig. 5). Inhi­bi­tion
of PKC-d and PKC-bII led to a strong inhi­bi­tion of IL-10 pro­duc­tion,
which became total at 5 lM Rott­lerin and 20 lM Hi­spi­din, thus sug­
gest­ing the impor­tant role of these two PKC iso­forms in the con­trol
of IL-10 expres­sion in mac­ro­phages stim­u­lated by Tat (Fig. 5A). In
con­trast, nei­ther Rott­lerin nor Hi­spi­din had a sig­nif­i­cant effect on
TNF-a pro­duc­tion in mac­ro­phages (Fig. 5B). This result sug­gests
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
Fig. 4. Sev­eral PKC iso­forms are expressed in mac­ro­phages but only PKC-bII and -d are acti­vated by Tat. (A) Mac­ro­phages were stim­u­lated with Tat 1-86 (10 nM) or, as a
positive con­trol, with PMA for 30 min or 60 min. (B) Mac­ro­phages were stim­u­lated with GST-Tat 1-45 (10 nM), or LPS (100 ng/ml) for 60 min. Mem­brane (M) and cyto­plas­mic
(C) pro­teins were extracted and sep­a­rated on 10% SDS page gel. PKC iso­forms were blot­ted and visu­al­ized by chemi­lu­mi­nes­cence using spe­cific anti­bod­ies. (C) Pre­sen­ta­tion
of the PKC iso­form ratio between the mem­brane and cyto­plas­mic band den­si­ties, obtained before and after Tat (1-45) stim­u­la­tion.
Fig. 5. Tat-induced PKC-bII and -d acti­va­tion is cru­cial for IL-10 but not TNF-a pro­duc­tion in the mac­ro­phages. Mac­ro­phages were pre­treated or not by global PKC inhib­i­tor
RO31-8220 (1, 5 lM), PKC-d inhib­i­tor Rot­tel­er­in (1, 5 lM) or PKC¡bII inhib­i­tor Hi­spi­din (2, 20 lM) for 30 min. GST-Tat 1-45 was then added for 24 h. Cul­ture super­na­tants were
col­lected and (A) IL-10 or (B) TNF-a pro­duc­tion was ana­lyzed by ELISA. Results are expressed in pg/ml. The val­ues are rep­re­sen­ta­tive of three inde­pen­dent exper­i­ments.
the impli­ca­tion of other PKC iso­forms, which remain to be deter­
mined, in the con­trol of TNF-a pro­duc­tion by mac­ro­phages stim­u­
lated by Tat.
To fur­ther char­ac­ter­ize the spec­i­fic­ity of PKC-bII and -d action,
mac­ro­phages were pre-incu­bated with PKC-bII and -d anti­sense oli­
go­nu­cle­o­tides (15 lM) or with the cor­re­spond­ing sense sequences
before stim­u­la­tion by Tat (10 nM). A great inhi­bi­tion of PKC-bII and
-d expres­sion was observed in the pres­ence of their respec­tive anti­
sense oli­go­nu­cle­o­tides (Fig. 6A). This inhi­bi­tion seems to be spe­
cific as the PKC-bII anti­sense oli­go­nu­cleo­tide was unable to inhibit
PKC-d expres­sion and vice versa. More­over, no mod­i­fi­ca­tion of PKC
iso­form expres­sion was observed in the pres­ence of sense oli­go­nu­
cle­o­tides (Fig. 6A). More inter­est­ingly, the inhi­bi­tion of PKC-d or
-bII by their cor­re­spond­ing anti­sense oli­go­nu­cle­o­tides led to inhi­bi­
tion of Tat-induced IL-10 pro­duc­tion by 71.4% ± 0.6 and 48.3% ± 8.4,
respec­tively (Fig. 6B). In agree­ment with the data obtained with
chem­i­cal inhib­i­tors, these results con­firm the cru­cial role of PKC-d
and -bII iso­forms in the sig­nal­ing path­way acti­vated by Tat to con­
trol IL-10 pro­duc­tion in human mac­ro­phages. Here again, as found
with chem­i­cal inhib­i­tors, only a partial reduc­tion of TNF-a pro­duc­
tion, was observed in the pres­ence of PKC-bII and PKC-d anti­sense
oli­go­nu­cle­o­tides (24.5 ± 5.48 and 10.27% ± 6.5 pg/ml, respec­tively)
(Fig. 6B).
Taken together, these data sug­gest the cru­cial role of PKC-bII
and PKC-d in the sig­nal­ing path­way lead­ing to pro­duc­tion of IL-10,
but not of TNF-a, in human mac­ro­phages stim­u­lated by Tat.
3.5. Down­stream of PKC, HIV-1 Tat pro­tein acti­vates MAP kinases
ERK1/2 and p38 in human mac­ro­phages
The acti­va­tion of MAP kinases, includ­ing p38 and ERK1/2, has
been impli­cated in the induc­tion of multiple responses involv­ing
the reg­u­la­tion of cyto­kine genes by NF-jB activ­ity [38]. The effect
of Tat on the acti­va­tion MAP kinases ERK1/2 and p38 in mac­ro­
phages was eval­u­ated after stim­u­la­tion for var­i­ous times (10, 30
or 60 min). Cyto­plas­mic extracts were ana­lyzed by SDS–PAGE and
Western blot­ting with anti­bod­ies spe­cific against phos­phor­y­lated
or non phos­phor­y­lated kinases. Untreated con­trol cells showed no
sig­nif­i­cant phos­phor­y­la­tion of ERK1/2 or p38 (Fig. 7A and B). How­
ever, Tat-induced phos­phor­y­la­tion of ERK1/2 after 10 min of stim­u­
la­tion, which then decreased slightly after 30 and 60 min (Fig. 7A).
As expected, a positive sig­nal was obtained with LPS acti­va­tion.
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
Fig. 6. PKC-bII and -d anti­sense oli­go­nu­cle­o­tides impair IL-10 but not TNF-a pro­duc­tion in the mac­ro­phages. Mac­ro­phages were pre-incu­bated with sense or anti­sense oli­go­
nu­cle­o­tides spe­cific for PKC-d or -bII (15 lM) for 20 h. Mac­ro­phages were then washed and incu­bated with oli­go­nu­cle­o­tides and GST-Tat 1-45 (10 nM). A) After 1 h, mem­brane
(M) and cyto­plas­mic (C) pro­teins were extracted and sep­a­rated on 10% SDS page gel. PKCs were visu­al­ized using an anti-PKC-bII or anti-PKC-d anti­bod­ies and chemi­lu­mi­nes­
cence. (B) After 24 h, cul­ture super­na­tants were col­lected and ana­lyzed by ELISA. Results are expressed in per­cent­age of inhi­bi­tion.
Sim­i­larly, Tat was able to induce p38 acti­va­tion which started at
10 min and per­sisted for at least 60 min after Tat stim­u­la­tion (Fig.
7B).
Alto­gether, these results indi­cate the impor­tance of PKC, MAP
kinases p38 and ERK1/2 and the tran­scrip­tion fac­tor NF-jB in the
3.6. HIV-1. Tat pro­tein acti­vates the tran­scrip­tion fac­tor NF-jB in
mac­ro­phages
We next deter­mined the effect of Tat on the acti­va­tion of NF-
jB in human mac­ro­phages. This assay was per­formed by ana­lyz­
ing the capac­ity of Tat to acti­vate the nuclear trans­lo­ca­tion of the
NF-jB/p65 sub­unit. In the inac­ti­vated cells, NF-jB is seques­trated
in the cyto­plasm by the inhib­i­tor pro­tein IjBa, which masks its
nuclear local­i­za­tion sequence (NLS) [38,39]. Treat­ment of human
mac­ro­phages with Tat (10 nM) for 10 min induced a nuclear trans­lo­
ca­tion of the NF-jB/p65 sub­unit that per­sisted for 60 min (Fig. 7C).
Almost no p65 trans­lo­ca­tion was noted in the unstim­u­lated cells.
As expected, the positive con­trol LPS (100 ng/ml) induced a strong
accu­mu­la­tion of p65 in the nucleus dur­ing 60 min of treat­ment.
This result con­firms that Tat-induced IL-10 pro­duc­tion is cor­re­
lated with Tat-induced NF-jB acti­va­tion in mac­ro­phages (Fig. 7C).
3.7. Inhi­bi­tion of MAP kinases ERK1/2 and p38 and NF-jB acti­va­tion
has dif­fer­ent effects on Tat-induced pro­duc­tion of IL-10 and TNF-a
Because MAP kinases and NF-jB path­ways are acti­vated by Tat
and are known to play an essen­tial role in the con­trol of cyto­kine
gene expres­sion, we eval­u­ated their impli­ca­tion in the IL-10 and
TNF-a pro­duc­tion induced by Tat. To this end, mac­ro­phages were
pre­treated with Sb212190, a chem­i­cal p38 inhib­i­tor. The inhi­bi­tion
of p38 MAP kinase by 5 lM Sb212190 inhib­ited IL-10 pro­duc­tion by
about 64.6% ± 1.11 but had no effect on TNF-a pro­duc­tion, the inhi­
bi­tion observed being less than 10% ± 6.5 (Fig. 8). In con­trast, inhi­bi­
tion of ERK1/2 with 10 lM of U0126, or NF-jB with 200 lM of TLCK
(N-Tosyl lysine chlo­ro­methyl ketone), a ser­ine pro­te­ase inhib­i­tor,
strongly reduced IL-10 pro­duc­tion, by 77.66% ± 4.56 and 69.8% ± 3,
respec­tively, and TNF-a by 43.68% ± 3.53 and 71.5% ± 9, respec­tively
(Fig. 8).
Fig. 7. Tat induces MAP kinases p38 and ERK1/2 and NF-jB/p65 acti­va­tion. Mac­
ro­phages were treated or not with Tat 1-86 (10 nM), or LPS (100 ng/ml), for 10, 30
or 60 min. Cyto­plas­mic and nuclear extracts were ana­lyzed by Western blot using
spe­cific anti­bod­ies for (A) ERK1/2 or phospho-ERK1/2, (B) p38 or phospho-p38 and
(C) NF-jB/p65. Cyto­plas­mic and nuclear frac­tions were nor­mal­ized by anti-actin
and anti-TFIIB, respec­tively.
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
Fig. 8. Impli­ca­tion of MAP kinases p38, ERK1/2 and NF-jB in IL-10 and TNF-a pro­duc­
tion. (A) Mac­ro­phages were pre­treated or not with global PKC inhib­i­tor RO31-8220
(5 lM), p38 inhib­i­tor Sb202190 (5 lM), ERK1/2 inhib­i­tor U0126 (10 lM) or NF-jB
inhib­i­tor TLCK (200 lM) for 60 min. Tat was then added, and cul­ture super­na­tants
were col­lected at 6 or 24 h to ana­lyze TNF-a and IL-10 pro­duc­tion respec­tively, by
ELISA. Results are expressed in per­cent­age of inhi­bi­tion. The val­ues are rep­re­sen­ta­
tive of three inde­pen­dent exper­i­ments.
con­trol of IL-10 gene expres­sion induced by Tat in human mac­ro­
phages. Induc­tion of TNF-a by Tat in mac­ro­phages seems to be p38
MAP kinase inde­pen­dent but impli­cates PKC, ERK1/2 and NF-jB
path­ways.
4. Dis­cus­sion
In con­trast to CD4+ T cells, mac­ro­phages are not depleted dur­
ing the course of HIV-1 infec­tion. How­ever, the acti­va­tion of mac­
ro­phages is a key step both in the estab­lish­ment of HIV-1 infec­tion
by R5 tropic viruses [4] and in the pro­duc­tion of a wide vari­ety
of cyto­kines. A vari­ety of func­tions and fea­tures have been asso­ci­
ated with HIV-1 Tat pro­tein [40–43]. We and oth­ers have recently
shown that, in human mono­cytes, Tat induces pro­duc­tion of IL10 and TNF-a [25,26,44]. The gen­er­a­tion of these cyto­kines in the
serum of HIV-1 infected patients is asso­ci­ated with the devel­op­
ment of HIV path­o­gen­e­sis includ­ing immu­no­log­i­cal dys­func­tions.
IL-10, pro­duced by PBMCs from HIV-1-infected patients, is an
immu­no­sup­pres­sive cyto­kine that increases when patients evolve
towards the AIDS stage of HIV infec­tion. Alter­na­tively, TNF-a, a
pro-inflam­ma­tory cyto­kine, is asso­ci­ated with numer­ous infec­
tious dis­eases includ­ing HIV, the devel­op­ment of neu­ro­log­i­cal dis­
ease and AIDS [45]. TNF-a has been shown to acti­vate virus rep­li­ca­
tion in both chron­i­cally infected cell lines and in periph­e­ral blood
mono­nu­clear cells derived from HIV-1-infected sub­jects [22,46].
How­ever, the role of IL-10 in HIV-1 rep­li­ca­tion in mac­ro­phages in
vitro remains con­tro­ver­sial. While some stud­ies report an inhib­i­
tory effect [18,47,48], oth­ers describe an enhance­ment of viral rep­
li­ca­tion in the pres­ence of IL-10 [49,50] or a dual role depend­ing on
the con­cen­tra­tion and the cyto­kines secreted [51,52].
In this study, we have shown that HIV-1 Tat acts at the extra­cel­
lu­lar level to induce, the pro­duc­tion of TNF-a and IL-10 by human
periph­e­ral blood mono­cyte-derived mac­ro­phages. This indi­cates
that the inter­ac­tion of Tat with a mem­brane recep­tor is suf­fi­cient to
induce the pro­duc­tion of TNF-a and IL-10 by human mac­ro­phages.
This con­clu­sion is in agree­ment with the results obtained with
the N-ter­mi­nal Tat 1-45 frag­ment, which con­tains the cy­stein-rich
domain but not the basic domain respon­si­ble for the pen­e­tra­tion
and nuclear local­i­za­tion of Tat [53]. How­ever, the mem­brane recep­
tor involved in this sig­nal trans­duc­tion remains to be deter­mined.
The anal­y­sis of Tat-induced sig­nal­ing path­ways showed that
PKC acti­va­tion by Tat was essen­tial for the induc­tion of TNF-a and
IL-10 by human mac­ro­phages. Inhi­bi­tion of this sig­nal­ing path­way
by chem­i­cal inhib­i­tors, or after PKC deple­tion by PMA, abol­ishes
TNF-a and IL-10 pro­duc­tion. Because PMA treat­ment depletes only
the clas­si­cal and novel but not atyp­i­cal PKC [54], our data sug­gest
the impli­ca­tion of these two fam­i­lies in the pro­duc­tion of IL-10 and
TNF-a in Tat-stim­u­lated mac­ro­phages. More­over, it is inter­est­ing
to note that, in con­trast with the sit­u­a­tion in the mac­ro­phages, the
pro­duc­tion of TNF-a in human mono­cytes treated by Tat is only
par­tially reg­u­lated by PKC [26]. This dif­fer­ence in the PKC impli­ca­
tion between mono­cytes and mac­ro­phages under­lines the effect of
cell dif­fer­en­ti­a­tion on the mod­i­fi­ca­tion of the recruited sig­nal­ing
and, thus, jus­ti­fies the exten­sion of our study to mac­ro­phages.
Con­sid­er­ing the impor­tance of the PKC path­way in the con­trol of
TNF-a and IL-10 pro­duc­tion in human mac­ro­phages, we ana­lyzed
six of the eight PKC iso­forms (PKC-a, -bII, -d, -e, -g and -l) pres­ent
in human mono­cytes/mac­ro­phages to eval­u­ate which ones were
acti­vated by Tat and sub­se­quently impli­cated in IL-10 and TNF-a
induc­tion. Our data showed that Tat or Tat 1-45 N-ter­mi­nal frag­
ment acti­vated only PKC-bII and PKC-d in human mac­ro­phages.
Here again, we note that PKC-a and -e are not acti­vated by Tat in
human mac­ro­phages, in con­trast to our pre­vi­ous data obtained in
human mono­cytes [26]. Selec­tive inhi­bi­tion of PKC-d, -bII iso­forms
by chem­i­cal inhib­i­tors or by spe­cific anti­sense oli­go­nu­cle­o­tides
has no sig­nif­i­cant effect on Tat-med­i­ated TNF-a induc­tion, but com­
pletely blocks IL-10 pro­duc­tion. Thus, the PKC iso­form(s) involved
in the con­trol of Tat-induced TNF-a remain to be iden­ti­fied. Alto­
gether, our results and those reported by oth­ers, indi­cate that the
abil­ity of Tat to acti­vate PKC iso­forms seems depen­dent on cell dif­
fer­en­ti­a­tion as well as on cell type. This state­ment is in agree­ment
with results reported by Borg­at­ti et al. (1998), who showed that
stim­u­lat­ing the PC12 neu­ron line with Tat selec­tively acti­vated
PKC-a, -e and -f among the iso­forms pres­ent in this cell line (PKCa, -bI, -bII, -d, -e, -g, -l and -f) [55]. In this case, it is note­wor­thy
that, despite the pres­ence of PKC-bII and -d in the PC12 cell line,
they are not acti­vated by Tat. This selec­tiv­ity of acti­va­tion between
human mono­cytes, mac­ro­phages and the PC12 cell line could be
explained by the involve­ment of part­ners upstream of PKC, such as
phos­pho­in­o­si­tol-depen­dent kinase, which plays an essen­tial role in
cell sig­nal­ing by reg­u­lat­ing the acti­va­tion state of the dif­fer­ent PKC
iso­forms. Another expla­na­tion may be the involve­ment of down­
stream part­ners, such as RACKs and STICs, or direct sub­strates [56],
which are expressed and local­ized dif­fer­en­tially accord­ing to the
cell type and the dif­fer­en­ti­a­tion state. At the same time, Mo­nick
et al. (1998) reported that dif­fer­en­ti­a­tion of mono­cytes into alve­
o­lar mac­ro­phages is accom­pa­nied by a con­sid­er­able decrease in
the level of PKC-bII. This dif­fer­en­tial expres­sion of PKC might be
asso­ci­ated with the loss or acqui­si­tion of new func­tions, as shown
by the acti­va­tion of ERK2 and AP-1 in mono­cytes stim­u­lated with
PMA and not in alve­o­lar mac­ro­phages treated under the same con­
di­tions [54].
Down­stream of PKC, we have shown that Tat, via its N-ter­mi­nal
1-45 region, is able to acti­vate p38 and ERK1/2 MAP kinases and the
tran­scrip­tion fac­tor NF-jB. Sev­eral stud­ies have dem­on­strated the
rela­tion­ship between PKC and MAP kinases. Rah­man et al. (2001)
have shown that PKC-d is a crit­i­cal kinase that induces inter­cel­lu­
lar adhe­sion mol­e­cule (ICAM)-1 gene tran­scrip­tion by acti­vat­ing
p38 MAP kinase which, in turn, may increase the tran­scrip­tional
activ­ity of NF-jB in throm­bin-treated endo­the­lial cells [57]. More­
over, PKC acti­va­tion with PMA in mac­ro­phages strongly acti­vates
the MAP kinases p38, JNK and ERK1/2, sug­gest­ing com­plex “crosstalk” between PKC and MAP kinases sig­nal­ing path­ways [58]. In
our study, we have shown that both p38 and ERK1/2 play an impor­
tant role in IL-10 pro­duc­tion in Tat-stim­u­lated mac­ro­phages, as
shown by the inhib­it­ing action of the cor­re­spond­ing inhib­i­tors.
These results are also in agree­ment with the data of Benn­as­ser
et al. (2002) and Li et al. (2007) obtained for human mono­cytes
acti­vated by Tat [27,59]. In con­trast, inhi­bi­tion of p38 had no sig­
nif­i­cant effect on the induc­tion of TNF-a in human mac­ro­phages
stim­u­lated with Tat. This result, how­ever, is in con­trast with recent
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
data reported by Li et al. (2007), which show sig­nif­i­cant inhi­bi­tion
of TNF-a gene tran­scrip­tion and pro­tein syn­the­sis in Tat-treated
mono­cytes in the pres­ence of p38 inhib­i­tors [59]. Here again, this
appar­ent dis­crep­ancy between mono­cytes and mac­ro­phages may
be related to the change of the sig­nal­ing path­ways recruited after
state dif­fer­en­ti­a­tion.
In sum­mary, the pres­ent study shows that HIV-1 Tat pro­tein
still induces IL-10 and TNF-a pro­duc­tion after dif­fer­en­ti­a­tion to
mac­ro­phages, with some spe­cific sig­nal­ing path­ways. How­ever,
the sig­nal­ing path­way involved in mac­ro­phages seems to be dif­
fer­ent from that in mono­cytes. Thus, the PKC path­way, and the
down­stream MAP kinase ERK1/2 and NF-jB tran­scrip­tion fac­tor
are involved in the induc­tion of the two cyto­kines. In con­trast, p38
MAP kinase, even con­trolled by PKC, seems to be required only for
the pro­duc­tion of IL-10, but not of TNF-a. Thus, accord­ing to the
cell type and the dif­fer­en­ti­a­tion state, Tat may recruit dif­fer­ent sig­
nal­ing path­ways able to trans­ac­ti­vate cel­lu­lar genes encod­ing for
cyto­kines. The action of Tat in the positive or neg­a­tive mod­u­la­tion
of sev­eral cyto­kines could account for many bio­log­i­cal effects and
could have impor­tant impli­ca­tions for under­stand­ing the rel­e­vant
aspects of HIV-1 path­o­gen­e­sis.
Acknowl­edg­ments
This work was sup­ported by the Agence Na­tio­nale de Recher­che
sur le SIDA, Cons­eil Région­al Midi-Pyr­énées, SI­DAC­TION and Uni­
ver­sité Paul Saba­tier, Tou­louse.
Ref­er­ences
[1] E. Cas­sol, M. Alf­ano, P. Bi­swas, G. Poli, Mono­cyte-derived mac­ro­phages and
mye­loid cell lines as tar­gets of HIV-1 rep­li­ca­tion and per­sis­tence, J. Leu­koc.
Biol. 80 (2006) 1018–1030.
[2] V. Gill, R.J. Shat­tock, A.R. Free­man, G. Rob­in­son, G.E. Grif­fin, E.C. Gor­don-Smith,
et al., Mac­ro­phages are the major tar­get cell for HIV infec­tion in long-term
mar­row cul­ture and dem­on­strate dual sus­cep­ti­bil­ity to lymph­o­cy­to­tro­pic and
mon­ocy­to­tro­pic strains of HIV-1, Br. J. Hae­ma­tol. 93 (1996) 30–37.
[3] M.S. Melt­zer, M. Na­kam­ura, B.D. Han­sen, J.A. Tur­pin, D.C. Kalt­er, H.E. Gend­el­
man, Mac­ro­phages as sus­cep­ti­ble tar­gets for HIV infec­tion per­sis­tent viral res­
er­voirs in tis­sue and key immu­no­reg­u­la­tory cells that con­trol lev­els of virus
rep­li­ca­tion and extent of dis­ease, AIDS Res. Hum. Ret­ro­vi­ruses 6 (1990) 967–
971.
[4] R. Coll­man, N.F. Has­san, R. Walker, B. God­frey, J. Cut­il­li, J.C. Has­tings, et al., J.
Exp. Med. 170 (1989) 1149–1163.
[5] K. Ked­zierska, S.M. Crow­e, The role of mono­cytes and mac­ro­phages in the path­
o­gen­e­sis of HIV-1 infec­tion, Curr. Med. Chem. 9 (2002) 1893–1903.
[6] E.A. Rich, J.M. Or­en­stein, K.T. Je­ang, A mac­ro­phage-tropic HIV-1 that expresses
green fluo­res­cent pro­tein and infects alve­o­lar and blood mono­cyte-derived
mac­ro­phages, J. Bio­med. Sci. 9 (2002) 721–726.
[7] B. E­te­mad-Mogh­ad­am, D. Rhone, T. Stee­nbeke, Y. Sun, J. Man­ola, R. Gel­
man, et al., Under­stand­ing the basis of CD4(+) T-cell deple­tion in macaques
infected by a sim­ian-human immu­no­de­fi­ciency virus, Vac­cine 20 (2002)
1934–1937.
[8] T. I­gar­ash­i, C.R. Brown, Y. Endo, A. Buck­ler-White, R. Plish­ka, N. Bisc­hof­ber­
ger, et al., Mac­ro­phage are the prin­ci­pal res­er­voir and sus­tain high virus
loads in rhe­sus macaques after the deple­tion of CD4+ T cells by a highly
path­o­genic sim­ian immu­no­de­fi­ciency virus/HIV type 1 chi­mera (SHIV):
Impli­ca­tions for HIV-1 infec­tions of humans, Proc. Natl. Acad. Sci. USA 98
(2001) 658–663.
[9] REVIEWS1030 C.W. Arendt, D.R. Litt­man, HIV: mas­ter of the host cell, Genome
Biol. 2 (2001) REVIEWS1030.
[10] C. Cicala, J. Ar­thos, S.M. Se­lig, G. Den­nis Jr., D.A. Ho­sack, D. Van Ryk, et al., HIV
enve­lope induces a cas­cade of cell sig­nals in non-pro­lif­er­at­ing tar­get cells that
favor virus rep­li­ca­tion, Proc. Natl. Acad. Sci. USA 99 (2002) 9380–9385.
[11] C. de la Fu­ente, F. San­ti­ago, L. Deng, C. Ea­die, I. Zil­ber­man, K. Kehn, et al., Gene
expres­sion pro­file of HIV-1 Tat express­ing cells: a close inter­play between pro­
lif­er­a­tive and dif­fer­en­ti­a­tion sig­nals, BMC Bio­chem. 3 (2002) 14.
[12] A. Sim­mons, V. Alu­vi­hare, A. McMich­ael, Nef trig­gers a tran­scrip­tional pro­
gram in T cells imi­tat­ing sin­gle-sig­nal T cell acti­va­tion and induc­ing HIV vir­u­
lence medi­a­tors, Immu­nity 14 (2001) 763–777.
[13] M. Cler­i­ci, T.A. Wynn, J.A. Ber­zof­sky, S.P. Blatt, C.W. Hen­drix, A. Sher, et al.,
Role of inter­leu­kin-10 in T helper cell dys­func­tion in asymp­tom­atic indi­vid­u­
als infected with the human immu­no­de­fi­ciency virus, J. Clin. Invest. 93 (1994)
768–775.
[14] E. Sty­lia­nou, P. Auk­rust, D. Kvale, F. Muller, S.S. Frol, IL-10 in HIV infec­tion:
increas­ing serum IL-10 lev­els with dis­ease pro­gres­sion--down-reg­u­la­tory
effect of potent anti-ret­ro­vi­ral ther­apy, Clin. Exp. Immu­nol. 116 (1999) 115–
120.
[15] S.C. Wright, A. Jew­ett, R. Mitsu­yasu, B. Bon­av­ida, Spon­ta­ne­ous cyto­tox­ic­ity and
tumor necro­sis fac­tor pro­duc­tion by periph­e­ral blood mono­cytes from AIDS
patients, J. Immu­nol. 141 (1988) 99–104.
[16] K.W. Moore, R. de Waal Mal­efyt, R.L. Coff­man, A. O’Gar­ra, Inter­leu­kin-10 and
the inter­leu­kin-10 recep­tor, Annu. Rev. Immu­nol. 19 (2001) 683–765.
[17] K.W. Moore, A. O’Gar­ra, R. de Waal Mal­efyt, P. Vie­ira, T.R. Mos­mann, Inter­leu­
kin-10, Annu. Rev. Immu­nol. 11 (1993) 165–190.
[18] Y. Wang, A.P. Rice, Inter­leu­kin-10 inhib­its HIV-1 LTR-directed gene expres­sion
in human mac­ro­phages through the induc­tion of cyclin T1 pro­te­ol­y­sis, Virol­
ogy 352 (2006) 485–492.
[19] M. How­ard, A. O’Gar­ra, Bio­log­i­cal prop­er­ties of inter­leu­kin 10, Immu­nol. Today
13 (1992) 198–200.
[20] Z.F. Rosen­berg, A.S. Fauci, Im­mu­no­path­o­gen­ic mech­a­nisms of HIV infec­
tion: cyto­kine induc­tion of HIV expres­sion, Immu­nol. Today 11 (1990)
176–180.
[21] E.J. Duh, W.J. Ma­u­ry, T.M. Folks, A.S. Fauci, A.B. Rab­son, Tumor necro­sis fac­tor
alpha acti­vates human immu­no­de­fi­ciency virus type 1 through induc­tion of
nuclear fac­tor bind­ing to the NF-kappa B sites in the long ter­mi­nal repeat,
Proc. Natl. Acad. Sci. USA 86 (1989) 5974–5978.
[22] T.M. Folks, K.A. Clouse, J. Just­e­ment, A. Rab­son, E. Duh, J.H. Ke­hrl, et al., Tumor
necro­sis fac­tor alpha induces expres­sion of human immu­no­de­fi­ciency virus in
a chron­i­cally infected T-cell clone, Proc. Natl. Acad. Sci. USA 86 (1989) 2365–
2368.
[23] G.E. Grif­fin, K. Leu­ng, T.M. Folks, S. Kun­kel, G.J. Na­bel, Acti­va­tion of HIV gene
expres­sion dur­ing mono­cyte dif­fer­en­ti­a­tion by induc­tion of NF-kappa B,
Nature 339 (1989) 70–73.
[24] L. Osborn, S. Kun­kel, G.J. Na­bel, Tumor necro­sis fac­tor alpha and inter­leu­
kin 1 stim­u­late the human immu­no­de­fi­ciency virus enhancer by acti­va­tion
of the nuclear fac­tor kappa B, Proc. Natl. Acad. Sci. USA 86 (1989) 2336–
2340.
[25] A. Ba­dou, Y. Benn­as­ser, M. Mo­reau, C. Lecl­erc, M. Ben­ki­ra­ne, E. Bah­ra­oui, Tat
pro­tein of human immu­no­de­fi­ciency virus type 1 induces inter­leu­kin-10 in
human periph­e­ral blood mono­cytes: impli­ca­tion of pro­tein kinase C-depen­
dent path­way, J. Virol. 74 (2000) 10551–10562.
[26] Y. Benn­as­ser, A. Ba­dou, J. Tkaczuk, E. Bah­ra­oui, Sig­nal­ing path­ways trig­gered
by HIV-1 Tat in human mono­cytes to induce TNF-alpha, Virol­ogy 303 (2002)
174–180.
[27] Y. Benn­as­ser, E. Bah­ra­oui, HIV-1 Tat pro­tein induces inter­leu­kin-10 in human
periph­e­ral blood mono­cytes: involve­ment of pro­tein kinase C-be­taII and delta, FASEB J. 16 (2002) 546–554.
[28] Y. Wu, J.W. Marsh, Gene tran­scrip­tion in HIV infec­tion, Microbes Infect. 5
(2003) 1023–1027.
[29] H.C. Chang, F. Sa­ma­ni­ego, B.C. Nair, L. Bu­on­ag­uro, B. En­sol­i, HIV-1 Tat pro­tein
exits from cells via a lead­er­less secre­tory path­way and binds to extra­cel­lu­lar
matrix-asso­ci­ated hep­a­ran sul­fate pro­te­o­gly­cans through its basic region, Aids
11 (1997) 1421–1431.
[30] B. En­sol­i, G. Bar­il­lar­i, S.Z. Sal­a­hud­din, R.C. Gallo, F. Wong-Sta­al, Tat pro­tein of
HIV-1 stim­u­lates growth of cells derived from Ka­pos­i’s sar­coma lesions of
AIDS patients, Nature 345 (1990) 84–86.
[31] A.D. Fran­kel, C.O. Pabo, Cel­lu­lar uptake of the tat pro­tein from human immu­no­
de­fi­ciency virus, Cell 55 (1988) 1189–1193.
[32] K. Banki, E. Hut­ter, N.J. Gon­chor­off, A. Perl, Molec­u­lar order­ing in HIV-induced
apop­to­sis. Oxi­da­tive stress acti­va­tion of casp­as­es and cell sur­vival are reg­u­
lated by trans­al­dol­ase, J. Biol. Chem. 273 (1998) 11944–11953.
[33] L. Hu­ang, I. Bos­ch, W. Hof­mann, J. So­dro­ski, A.B. Par­dee, Tat pro­tein induces
human immu­no­de­fi­ciency virus type 1 (HIV-1) co­re­cep­tors and pro­motes
infec­tion with both mac­ro­phage-tropic and T- lym­pho­trop­ic HIV-1 strains, J.
Virol. 72 (1998) 8952–8960.
[34] X. Con­tre­ras, Y. Benn­as­ser, N. Cha­zal, M. Mo­reau, C. Lecl­erc, J. Tkaczuk, et al.,
Human immu­no­de­fi­ciency virus type 1 Tat pro­tein induces an intra­cel­lu­lar cal­
cium increase in human mono­cytes that requires DHP recep­tors: involve­ment
in TNF-alpha pro­duc­tion, Virol­ogy 332 (2005) 316–328.
[35] J.M. Saba­tier, E. Vives, K. Mab­rouk, A. Ben­jouad, H. Ro­chat, A. Du­val, et al., Evi­
dence for neu­ro­toxic activ­ity of tat from human immu­no­de­fi­ciency virus type
1, J. Virol. 65 (1991) 961–967.
[36] E. Vives, P. Char­neau, J. van Ri­et­scho­ten, H. Ro­chat, E. Bah­ra­oui, Effects of the
Tat basic domain on human immu­no­de­fi­ciency virus type 1 trans­ac­ti­va­tion
using chem­i­cally syn­the­sized Tat pro­tein and Tat pep­tides, J. Virol. 68 (1994)
3343–3353.
[37] W.W. Lin, B.C. Chen, Involve­ment of pro­tein kinase C in the UTP-med­i­ated
poten­ti­a­tion of cyclic AMP accu­mu­la­tion in mouse J774 mac­ro­phages, Br. J.
Phar­ma­col. 121 (1997) 1749–1757.
[38] P.A. Bae­uerle, D. Bal­ti­more, NF-kappa B: ten years after, Cell 87 (1996) 13–20.
[39] A. Bir­bach, P. Gold, B.R. Binder, E. Ho­fer, R. de Mar­tin, J.A. Sch­mid, Sig­nal­ing
mol­e­cules of the NF-kappa B path­way shut­tle con­sti­tu­tively between cyto­
plasm and nucleus, J. Biol. Chem. 277 (2002) 10842–10851.
[40] E. Fa­nales-Be­la­sio, A. Caf­aro, A. Cara, D.R. Ne­gri, V. Fi­or­el­li, S. Butto, et al., HIV1 Tat-based vac­cines: from basic sci­ence to clin­i­cal tri­als, DNA Cell Biol. 21
(2002) 599–610.
[41] M. May­ne, C.P. Holden, A. Nath, J.D. Gei­ger, Release of cal­cium from ino­si­
tol 1,4,5-tris­phos­phate recep­tor-reg­u­lated stores by HIV-1 Tat reg­u­lates
TNF-alpha pro­duc­tion in human mac­ro­phages, J. Immu­nol. 164 (2000)
6538–6542.
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
ARTICLE IN PRESS
10
K. Legh­mari et al. / Cellular Immunology xxx (2008) xxx–xxx
[42] A. Nath, K. Co­nant, P. Chen, C. Scott, E.O. Major, Tran­sient expo­sure to HIV-1
Tat pro­tein results in cyto­kine pro­duc­tion in mac­ro­phages and astro­cytes A hit
and run phe­nom­e­non, J. Biol. Chem. 274 (1999) 17098–17102.
[43] M.O. We­sten­dorp, V.A. Shat­rov, K. Schu­lze-Ost­hoff, R. Frank, M. Kraft, M. Los, et
al., HIV-1 Tat poten­ti­ates TNF-induced NF-kappa B acti­va­tion and cyto­tox­ic­ity
by alter­ing the cel­lu­lar redox state, EMBO J. 14 (1995) 546–554.
[44] K. Gee, J.B. Angel, S. Mish­ra, M.A. Bla­ho­ianu, A. Kumar, IL-10 reg­u­la­tion by HIVTat in primary human mono­cytic cells: involve­ment of cal­mod­u­lin/cal­mod­u­
lin-depen­dent pro­tein kinase-acti­vated p38 MAPK and Sp-1 and CREB-1 tran­
scrip­tion fac­tors, J. Immu­nol. 178 (2007) 798–807.
[45] A.K. Tal­ley, S. Dew­hurst, S.W. Perry, S.C. Dol­lard, S. Gum­mul­uru, S.M. Fine, et
al., Tumor necro­sis fac­tor alpha-induced apop­to­sis in human neu­ro­nal cells:
pro­tec­tion by the anti­ox­i­dant N-ace­tyl­cys­te­ine and the genes bcl-2 and crmA,
Mol. Cell. Biol. 15 (1995) 2359–2366.
[46] J.W. Mel­lors, B.P. Grif­fith, M.A. Ortiz, M.L. Lan­dry, J.L. Ryan, Tumor necro­sis
fac­tor-alpha/cac­hec­tin enhances human immu­no­de­fi­ciency virus type 1 rep­li­
ca­tion in primary mac­ro­phages, J. Infect. Dis. 163 (1991) 78–82.
[47] R.E. Ak­ridge, L.K. Oya­fuso, S.G. Reed, IL-10 is induced dur­ing HIV-1 infec­tion
and is capa­ble of decreas­ing viral rep­li­ca­tion in human mac­ro­phages, J. Immu­
nol. 153 (1994) 5782–5789.
[48] M.W. Sa­ville, K. Taga, A. Foli, S. Brod­er, G. To­sa­to, R. Yar­cho­an, Inter­leu­
kin-10 sup­presses human immu­no­de­fi­ciency virus-1 rep­li­ca­tion in vitro
in cells of the mono­cyte/mac­ro­phage line­age, Blood 83 (1994) 3591–
3599.
[49] J.B. Angel, B.M. Sa­get, M.Z. Wang, A. Wang, C.A. Di­na­rello, P.R. Skol­nik, Inter­
leu­kin-10 enhances human immu­no­de­fi­ciency virus type 1 expres­sion in a
chron­i­cally infected prom­on­o­cy­tic cell line (U1) by a tumor necro­sis fac­tor
alpha-inde­pen­dent mech­a­nism, J. Inter­feron Cyto­kine Res. 15 (1995) 575–
584.
[50] M.F. Rabbi, A. Finn­e­gan, L. Al-Har­thi, S. Song, K.A. Roe­buck, Inter­leu­kin-10
enhances tumor necro­sis fac­tor-alpha acti­va­tion of HIV-1 tran­scrip­tion in
latently infected T cells, J. Acquir. Immune De­fic. Syn­dr. Hum. Ret­ro­vi­rol. 19
(1998) 321–331.
[51] D. Weiss­man, G. Poli, A.S. Fauci, Inter­leu­kin 10 blocks HIV rep­li­ca­tion in mac­
ro­phages by inhib­it­ing the auto­crine loop of tumor necro­sis fac­tor alpha and
inter­leu­kin 6 induc­tion of virus, AIDS Res. Hum. Ret­ro­vi­ruses 10 (1994) 1199–
1206.
[52] D. Weiss­man, G. Poli, A.S. Fauci, IL-10 syn­er­giz­es with multiple cyto­kines in
enhanc­ing HIV pro­duc­tion in cells of mono­cytic line­age, J. Acquir. Immune
De­fic. Syn­dr. Hum. Ret­ro­vi­rol. 9 (1995) 442–449.
[53] E. Vives, P. Bro­din, B. Leb­leu, A trun­cated HIV-1 Tat pro­tein basic domain rap­
idly trans­lo­cates through the plasma mem­brane and accu­mu­lates in the cell
nucleus, J. Biol. Chem. 272 (1997) 16010–16017.
[54] M.M. Mo­nick, A.B. Carter, G. Gu­dm­unds­son, L.J. Geist, G.W. Hun­ninghake,
Changes in PKC iso­forms in human alve­o­lar mac­ro­phages com­pared with
blood mono­cytes, Am. J. Phys­iol. 275 (1998) L389–L397.
[55] P. Borg­at­ti, G. Zauli, L.C. Cant­ley, S. Cap­i­tan­i, Extra­cel­lu­lar HIV-1 Tat pro­tein
induces a rapid and selec­tive acti­va­tion of pro­tein kinase C (PKC)-alpha and epsi­lon and -zeta iso­forms in PC12 cells, Bio­chem. Bio­phys. Res. Com­mun. 242
(1998) 332–337.
[56] D. Ron, M.G. Kaza­nietz, New insights into the reg­u­la­tion of pro­tein kinase C
and novel phor­bol ester recep­tors, FASEB J. 13 (1999) 1658–1676.
[57] A. Rah­man, K.N. An­war, S. Ud­din, N. Xu, R.D. Ye, L.C. Plata­nias, et al., Pro­tein
kinase C-delta reg­u­lates throm­bin-induced ICAM-1 gene expres­sion in endo­
the­lial cells via acti­va­tion of p38 mito­gen-acti­vated pro­tein kinase, Mol. Cell.
Biol. 21 (2001) 5554–5565.
[58] M.Q. Lin, Z.L. Chang, Im­mu­no­mod­u­lat­ed Sig­nal­ing in Mac­ro­phages:Reg­u­la­tion
of the MAPK Sig­nal­ing Path­ways by PKA and PKC, Sheng Wu Hua Xue Yu Sheng
Wu Wu Li Xue Bao (Shang­hai) 31 (1999) 701–706.
[59] J.C. Li, A.S. Lau, A role for mito­gen-acti­vated pro­tein kinase and Ets-1 in the
induc­tion of inter­leu­kin-10 tran­scrip­tion by human immu­no­de­fi­ciency virus1 Tat, Immu­nol­ogy 121 (2007) 337–348.
Please cite this article in press as: K. Legh­mari et al., HIV-1 Tat protein induces TNF-a and IL-10 production by human macrophages: ..., Cell.
Immunol. (2008), doi:10.1016/j.cellimm.2008.06.011
Article 3
HIV-1 Tat protein induces IL-10 production in monocytes by
classical and alternative NF-κB pathways
Kaoutar Leghmari, Yamina Bennasserand Elmostafa Bahraoui
European journal of cell biology
Juin 2008, sous presse
166
RESUME DE L’ARTICLE 3
En plus de son rôle crutial dans la réplication virale, la protéine transactivatrice Tat du VIH-1
affecte le système immunitaire en induisant la production des cytokines tels que l’IL-10. Cette
cytokine anti-inflammatoire est augmentée au cours de l’infection VIH, et représente un
excellent moyen par lequel le virus peut induire l’immunodéficience. Dans cette étude, nous
avons montré qu’en agissant au niveau membranaire, la protéine Tat induit l’expression de
l’IL-10 dans les monocytes primaires et les cellules promonocytaires U937, via une voie NFκB- dépendante. L’expression des mutants trans-dominants négatifs des protéines NIK, IKKα
et IKKβ ainsi que la liaison des sous-unités p65 et p52 de NF-κB au niveau du promoteur du
gène IL-10, suggèrent l’implication des deux voies NF-κB, classique et alterntive. Dans les
cellules non stimulées, IKKα est majoritairement localisée au niveau du cytoplasme. De
manière intéressante, nos résultats montrent que Tat induit la translocation d’IKKa du
cytoplasme vers le noyau. Les expériences d’immunoprécipitation de la chromatine (ChIP),
ont révélé que, suite à la stimulation des monocytes par Tat, IKKα et CBP/p300 sont recrutés
au niveau du promoteur du gène IL-10, et l’histone H3 est phosphorylée et acétylée sur la
Ser10 et la Lys14 respectivement. Nous avons montré qu’en amont de NF-κB, les kinases
PKC, ERK1/2 et p38 sont impliquées dans la translocation nucléaire d’IKKα et les
modifications de l’histone H3 au niveau du promoteur IL-10, en accord avec l’implication de
ces kinases dans la production de l’IL-10.
Dans cette étude, nous avons montré que Tat active au moins trois voies de signalisations
simultanément, incluant les voies NF-κB classique et altérnative et IKKα, pour induire la
production de l’IL-10, une cytokine immunosuppressive utilisée par le virus afin d’échapper
aux défences immunitaires.
167
ARTICLE IN PRESS
European Journal of Cell Biology ] (]]]]) ]]]–]]]
www.elsevier.de/ejcb
HIV-1 Tat protein induces IL-10 production in monocytes by classical
and alternative NF-jB pathways
Kaoutar Leghmari, Yamina Bennasser, Elmostafa Bahraoui
Laboratoire d’Immuno-Virologie, EA 3038, Université Paul Sabatier, 118, route de Narbonne, Bâtiment 4R3,
F-31062 Toulouse Cedex, France
Received 20 February 2008; received in revised form 17 June 2008; accepted 30 June 2008
Abstract
The human immunodeficiency virus (HIV) transactivating Tat protein is not only critical for viral replication but
also affects the host immune system by inducing the production of cytokines such as IL-10. This anti-inflammatory
cytokine is upregulated during the course of HIV infection, representing an important pathway by which HIV may
induce immunodeficiency. Here, we show that, by acting at the membrane, Tat induces IL-10 expression in primary
monocytes and promonocytic U937 cells by NF-kB-dependent pathways. The trans-dominant negative mutants of
NF-kB-inducing kinase (NIK), IKKa and IKKb expressed in our transactivation model, in accordance with the
nuclear binding of p65 and p52 NF-kB subunits to the IL-10 promoter, suggest the involvement of both classical and
alternative NF-kB pathways. In inactivated cells, IKKa is localized predominantly in the cytoplasm. Interestingly, Tat
stimulates IKKa translocation from the cytoplasm to the nucleus in monocytes. Chromatin immunoprecipitation
(ChIP) assay experiments, after Tat treatment, revealed IKKa and CBP/p300 recruitment to the IL-10 promoter and
histone H3 phosphorylation (Ser 10) and acetylation (Lys 14) in this region, presumably leading to chromatin
remodeling. We demonstrate that, upstream of NF-kB, PKC, ERK1/2 and p38 MAP kinases are involved in
Tat-induced IKKa nuclear translocation and histone H3 modifications on the IL-10 promoter in accordance with the
role of these three kinases in IL-10 production. As a whole, the study demonstrates that Tat activates at least three
signaling pathways concurrently, including the classical, alternative and IKKa pathways, to promote production of
IL-10.
r 2008 Elsevier GmbH. All rights reserved.
Keywords: HIV-1; Tat; NF-kB; IL-10; IKK-a; PKC; P38 MAP kinase; ERK1/2 MAP kinase; Histone H3; Human monocytes
Introduction
The human immunodeficiency virus type 1 (HIV-1) is
the etiological agent of the acquired immunodeficiency
syndrome (AIDS). The clinical manifestations observed
in HIV-1-infected patients are primarily due to the
capacity of the virus and its components to interfere
Corresponding author. Tel./fax: +33 561 558 667.
E-mail address: [email protected] (E. Bahraoui).
with the immune system. The HIV-1 transactivating
(Tat) protein is thought to participate in this immune
system disorder (Ito et al., 1998).
Tat is a regulatory protein produced very early after
infection and is essential for HIV-1 gene expression,
replication, and infectivity (Wu and Marsh, 2003). The
sequence of the 14- to 16-kDa Tat protein varies from
86 to 104 amino acids depending on the viral isolates.
During acute infection of T cells by HIV-1, Tat is also
released into the extracellular medium (Ensoli et al.,
0171-9335/$ - see front matter r 2008 Elsevier GmbH. All rights reserved.
doi:10.1016/j.ejcb.2008.06.005
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
2
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
1990). Extracellular Tat is taken up by neighboring cells,
infected or not, and modulates viral and/or cellular
functions depending on the protein concentration,
conformational state and cell type (Chang et al., 1997;
Ensoli et al., 1993; Frankel and Pabo, 1988). For
instance, we have previously shown that extracellular
Tat induces IL-10 production by human monocytes in a
dose- and time-dependent manner (Badou et al., 2000).
IL-10 is the founding member of a growing family of
structurally related cytokines including IL-19, IL-20, IL22, IL-24, and IL-26 (Fickenscher et al., 2002). IL-10
was originally called ‘‘cytokine synthesis inhibiting
factor’’ because it can inhibit the transcription and
translation of numerous inflammatory cytokines (Conti
et al., 2003). Therefore, IL-10 is considered to be a
highly immunosuppressive cytokine. It reduces antigen
presentation and either inhibits (Grutz, 2005) or alters
(Anderson and Mosser, 2002) T-cell activation. The
administration of exogenous IL-10 to macrophages can
render them refractory to interferon-g (Kane and
Mosser, 2001) and diminish their responses to lipopolysaccharide (LPS) (Berg et al., 1995). These immunomodulatory activities of IL-10 have resulted in a number
of clinical trials using the recombinant cytokine to
improve autoimmune or inflammatory diseases, including inflammatory bowel disease, rheumatoid arthritis or
psoriasis (Moore et al., 2001). Several pathogens, such
as Leishmania (Miles et al., 2005), vaccinia virus
(Maloney et al., 2005) and mycobacteria (Bleharski
et al., 2003), exploit the immunosuppressive activity of
IL-10 to establish infection. Increasing serum IL-10
levels were also observed in HIV-1-infected patients and
seem to be correlated with AIDS progression (Stylianou
et al., 1999). IL-10 is expressed by a wide variety of
human cell types including CD4+ T cells, Th0, Th1 and
Th2 T cells, CD8+ T cells, and monocytes/macrophages (Moore et al., 1993).
In the immune system, the production of IL-10 must
be highly regulated to control its effects. One of the
paradoxes of this regulation is that the stimuli used to
induce inflammatory cytokine production are often the
same stimuli that induce IL-10 secretion by macrophages. Recent studies have demonstrated that the
control of IL-10 transcription depends not only on the
activation of transcription factors but also on covalent
modifications of the histones associated with the IL-10
promoter (Lucas et al., 2005). These modifications
induce chromatin remodeling and render the IL-10
promoter accessible to transcription factors. Among the
numerous transcription factors that have been implicated in IL-10 transcription, Sp1 (Brightbill et al., 2000),
C/EBP (Liu et al., 2003), Stat 3 (Benkhart et al., 2000),
c-Maf (Cao et al., 2005), and NF-Y (Lin, 2006) have
been shown to bind to the human IL-10 promoter.
Transcription factor NF-kB is a likely candidate for the
transactivation of the IL-10 gene, since the organization
of the IL-10 promoter shows nine potential NF-kB sites
(Eskdale et al., 1997). Moreover, stimulation by Tat
results in the activation of transcription factor NF-kB,
which is correlated with the IL-10 production by human
monocytes (Bennasser and Bahraoui, 2002), IL-6 and
IL-8 expression in human breast cancer cells or
T lymphocytes (Lee et al., 2005; Ott et al., 1998). These
results suggest that NF-kB is implicated in IL-10
promoter activation. However, to date there has been
no direct evidence to support the role of NF-kB in the
transcriptional control of IL-10 expression, although its
role in the regulation of pro-inflammatory cytokines is
well recognized (Ghosh et al., 1998).
Thus, NF-kB is a major transcriptional regulator for
the expression of cytokines that are involved in the
control of the immune and inflammatory response
(Baeuerle and Baltimore, 1996; Baldwin, 1996). NF-kB
is a dimeric transcription factor that consists of REL
family members, including RelA/p65, c-Rel, RelB, p50
and p52 (Li and Verma, 2002). p50 and p52 are derived
from the larger precursors p105 and p100, respectively,
through proteolytic processing by the proteasome. All
NF-kB proteins contain a highly conserved RELhomology domain that is responsible for DNA binding,
dimerization, nuclear translocation, and interaction
with the inhibitory IkB proteins within the cytoplasm.
The IkB proteins bind to NF-kB and block its nuclear
import, thereby inhibiting its transcriptional activity.
The p105 and p100 precursors also contain the IkB-like
repeats that must be degraded to generate the mature
p50 and p52 subunits, respectively. In contrast to the
other NF-kB family members, p50 lacks a transactivation domain and, therefore, usually forms heterodimers
with p65 to bind to NF-kB sites in the nucleus.
Homodimers p50:p50 can also be formed but they act
as a suppressor of inflammatory cytokine gene expression (Ghosh et al., 1998).
Three distinct NF-kB-activating pathways have
emerged (Viatour et al., 2005). Most of our knowledge
concerns the ‘‘classical’’ pathway, which mostly targets
ubiquitous heterodimers p65:p50 and p50:c-Rel. The
critical event in initiating this pathway is activation of
an IkB-phosphorylating protein kinase, IKKb/IKK2,
which occurs within the ‘‘IKK signalosome’’, in
association with a structurally homologous kinase,
IKKa/IKK1, and an adaptor protein, IKKg/NEMO
(Yamaoka et al., 1998). IKKb-mediated phosphorylation of IkBa leads to its proteasomal degradation and
hence activation of its associated NF-kB dimer that
translocates into the nucleus. This pathway is normally
triggered in response to microbial and viral infections or
exposure to pro-inflammatory cytokines such as tumor
necrosis factor a (TNF-a). In contrast, the ‘‘alternative’’
pathway occurs independently of IKKb or NEMO but
is dependent on NF-kB-inducing kinase (NIK) and
IKKa. Activation of this pathway leads to a limited
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
proteasomal processing of the NF-kB2/p100 precursor
protein, allowing the resulting p52 fragment to translocate to the nucleus in association with one of several
NF-kB proteins (mainly RelB) (Xiao et al., 2001a). This
pathway is triggered by cytokines such as lymphotoxin b
(Dejardin et al., 2002), or CD40 ligand (Coope et al.,
2002), and by viruses such as the Epstein–Barr virus
(Eliopoulos et al., 2003). The third signaling pathway is
classified as ‘‘atypical’’ because it is independent of IKK
proteins but it still requires the proteasome and is
triggered by DNA damage such as UV oxidative stress
(Imbert et al., 1996; Tergaonkar et al., 2003).
Recent studies have shown that IKKa, but not IKKb,
constitutively shuttles between cytoplasm and nucleus
(Birbach et al., 2002), thus suggesting that it plays a role
in the nucleus. Independently of its previously described
cytoplasmic role, IKKa functions in the nucleus by
activating the expression of NF-kB-responsive genes
after TNF-a stimulation. IKK-a recruited to NF-kBresponsive promoters interacts with the histone acetyltransferase CBP/p300 (CREB-binding protein). Then it
mediates the phosphorylation and subsequent acetylation of specific residues of histone H3 leading to NF-kBbinding site accessibility (Anest et al., 2003; Yamamoto
et al., 2003) by chromatin remodeling.
We have previously shown that extracellular Tat 1-45,
which lacks the basic domain necessary for its internalization, is able to induce IL-10 production by human
monocytes. Investigations of the mechanisms involved
in signal transduction showed that the protein kinase C
(PKC) pathway, and strictly PKC-d and -bII isoforms,
played an essential role in Tat-induced IL-10 production
(Badou et al., 2000; Bennasser et al., 2002). In addition,
NF-kB is activated and is crucial for IL-10 production
by Tat (Badou et al., 2000) although the NF-kB
activation pathway(s) induced by Tat remained to be
defined.
In the current study, we investigated the human
monocyte NF-kB signaling pathway(s) implicated in
Tat-induced IL-10 production and the mechanism of
NF-kB regulation by Tat.
Materials and methods
Monocyte isolation
Peripheral blood mononuclear cells (PBMC) were
isolated from the buffy coat of healthy HIV-negative
donors in a ficoll (Pharmacia) density gradient. The
PBMC were resuspended in complete medium (60%
AIMV and 30% Iscove [Gibco-BRL, Grand Island,
NY]) containing penicillin (100 IU/ml), streptomycin
(100 mg/ml), and 10% fetal calf serum (FCS). PBMC
were then plated at a density of 106 cells/well in 12-well
3
Primaria tissue culture plates (Becton Dickinson). After
5 or 24 h of culture at 37 1C in 5% CO2, non-adherent
cells were removed and the remaining cells were washed
twice and then incubated with the different compounds
tested. Promonocytic U937 cells were used for the
transactivation assays.
Proteins and constructs
Recombinant HIV-1 Tat 1-86 protein was obtained
from ‘Agence Nationale de la Recherche sur le SIDA’
(Paris, France). The level of endotoxin contamination
was assessed using the Limulus amebocyte lysate assay
(Bio-Sepra, Villeneuve la Garenne, France). Deleted
mutants Gst-Tat 1-45 and Gst-Tat 30-72 were produced
as glutathione-S-transferase (Gst) fusion proteins in
Escherichia coli and purified as previously described
(Badou et al., 2000). As a control, Gst was purified
under the same conditions and in the same experiments.
All these constructions were LPS free (o0.3 EU/mg) and
biologically active (Badou et al., 2000). Wild-type
plasmids pMKmyc NIK, pEV IKKa-T7, pcDNA
IKKb-Flag, and trans-dominant negative mutants
pMKmyc NIK (KK429/430AA), pEV IKKa-T7
(K44M) and pcDNA IKKb-Flag (K44A), which lacked
their kinase activity (Geleziunas et al., 1998), were a
kind gift from R. Geleziunas.
NF-jB transactivation assay
Transfections were performed using the DEAE
dextran system according to the manufacturer’s protocol. In brief, U937 promonocytic cells were prepared at
5 105 cells/well (one well of a 24-well plate). Two
micrograms of pCMV-bgalactosidase, 2 mg of pNF-kBluciferase and 4 ml DEAE dextran (500 mg/ml) were
prepared in a final volume of 250 ml serum- and
antibiotic-free RPMI. In some experiments, 1 mg of
plasmids encoding wild-type or mutant proteins (NIK,
IKKa, IKKb) were added at the same time. The mix was
added gently to 750 ml cell suspension, and transfected
cells were incubated for 24 h at 37 1C, 5% CO2. Before
Tat stimulation, cells were washed with serum-free
RPMI and then incubated in RPMI with 1% FCS and
1% penicillin and streptomycin. After a further 24 h,
luciferase and b-galactosidase activities were measured
with luciferase assay reagent (Promega) and chlorophenolred-b-galactoside (CPRG), respectively.
Protein kinase C and MAP kinases inhibition
Isolated monocytes were cultured in the absence or
presence of Tat. Monocytes were pre-incubated for 30 min
with RO 318220, a total PKC isoform inhibitor (Keller
and Niggli, 1993), SB 202190, a p38 MAPK inhibitor, or
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
4
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
PD 98059, a MAPK ERK1/2 inhibitor (Davies et al.,
2000). Tat (10 nM) or TNF-a (20 ng/ml) was added for
additional times (60 min before protein extraction or 24 h
before ELISA). A putative cytotoxic effect of the different
inhibitors was tested by the trypan blue dye exclusion
assay, and none were found to be cytotoxic (viability was
490%) at the concentrations used.
Isolation of cytoplasmic and nuclear protein extracts
After incubation with Tat (10 nM) or TNF-a
(20 ng/ml), monocytes were harvested and rapidly lysed
at 4 1C in 200 ml of hypotonic buffer A (10 mM HEPES,
pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA,
1 mM DTT, 0.5 mM PMSF, 0.2 mM Na3VO4, 0.05 mM
NaF) for 15 min. Then 12.5 ml Nonidet P40 (10%) was
added and the lysate was strongly vortexed (20 s) before
centrifugation (1 min; 15,366g; 4 1C). The supernatant
corresponding to the cytoplasm was collected; the
nucleus pellets were solubilized in 100 ml cold sample
buffer B (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM
EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF,
0.2 mM Na3VO4, 0.05 mM NaF), and strongly shaken
for 15 min at 4 1C. After centrifugation, nuclear proteins
were collected in the supernatant, quantified by a
Bradford assay and stored at 20 1C.
Western blot analysis
Equal amounts of protein (10–40 mg) were subjected to
10% SDS-PAGE and the separated proteins were
transferred to a nitrocellulose membrane. Immunoblotting was conducted with rabbit anti-IKKa, anti-p65, antip52 antibodies (Santa Cruz Biotechnology), or specific
antibodies against total or phosphorylated ERK1/2 and
p38 MAP kinases (Cell SignalingTechnology). To control
the product of transfection, 100 mg of transfected or
untransfected cell extracts were tested using anti-Flag,
anti-myc or anti-T7 antibodies to detect IKKb, NIK and
IKKa proteins, respectively. The membrane was blocked
with 5% low-fat milk in Tris-buffered saline with 0.05%
Tween 20 (TTBS) for 1 h, washed with TTBS, and
incubated with the primary antibody overnight at 4 1C.
Immunoreactive bands were detected by incubation for
2 h with swine anti-rabbit immunoglobulins conjugated
with horseradish peroxidase (DAKO A/S, Roskilde,
Denmark). Proteins of interest were visualized using a
chemiluminescent substrate (Pierce, Rockford, IL).
were washed thoroughly with ice-cold PBS and lysed for
10 min in buffer A (5 mM PIPES, pH 8, 85 mM KCl, 0.5%
Nonidet P40, 0.5 mM PMSF, 10 mg/ml leupeptin, 0.2 mM
Na3VO4, 0.05 mM NaF). After mechanical homogenization, the nuclei were pelleted by centrifugation and
resuspended for 10 min in buffer B (50 mM Tris-HCl,
pH 8.1, 10 mM EDTA, 1% SDS, 0.5 mM PMSF, 10 mg/ml
leupeptin, 0.2 mM Na3VO4, 0.05 mM NaF). Chromatin
was sheared by sonication to an average size of
approximately 200–300 bp and pre-cleared for 2 h at 4 1C
with protein A and G agarose saturated by salmon sperm
DNA (200 mg/ml) and BSA (500 mg/ml). Chromatin
solutions were precipitated overnight at 4 1C using antip65, anti-p52, anti-IKKa, anti-phospho-H3 (Ser 10), and
acetylated H3 (Lys 14), or anti-CBP/p300 antibodies (all
from Santa Cruz Biotechnology) or beads alone. Immune
complexes were collected with BSA-saturated protein A
and G agarose for 1 h and washed following the
manufacturer’s protocol. Input and immunoprecipitated
chromatin was incubated with RNase A (3 mg/ml) at 65 1C
overnight. DNA was released by proteinase K digestion
(10 mg/ml) for 90 min at 45 1C and then extracted using
GFX PCR columns (Amersham). Precipitated DNA was
analyzed by PCR (30–40 cycles) using hot start Taq PCR
Master Mix (Q.Biogen) or Syber green Mix UDG. The
primers 50 -CCACAATCAAGGTTTCCCGGC-30 and 50 CCACAGCTGAGGGCCTCTGC-30 were designed to
amplify a 344 to 97 region relative to the transcription
start site of the human IL-10 promoter, containing at least
1 NF-kB-binding site (EMBL accession number Z30175).
Immunoprecipitation assay
After treatment with Tat or TNF-a, nuclear fractions
of monocytes were incubated with anti-IKKa antibodies
at 4 1C overnight before incubation for 2 h at 4 1C with
protein and A and G agarose saturated by salmon sperm
DNA (200 mg/ml) and BSA (500 mg/ml). Immune complexes were washed extensively using immunoprecipitation buffer (20 mM Tris-HCl, pH 8.1, 200 mM NaCl,
0.5% NP-40, 0.5 mM PMSF, 10 mg/ml leupeptin,
0.2 mM Na3VO4, 0.05 mM NaF). Retained proteins
were analyzed by Western blot using anti-IKKa,
-acetylated H3 (Lys 14), or -CBP/p300 antibodies.
Results
Chromatin immunoprecipitation assay (ChIP)
Extracellular Tat is able to induce IL-10 production
in U937 cells via NF-jB pathways
ChIP analysis was performed following a protocol
provided by Upstate Biotechnology under modified
conditions. After Tat (10 nM) stimulation, 8 106 monocytes were fixed with 1% formaldehyde. After 5 min, cells
As with primary human monocytes, Tat is able to
induce IL-10 production in U937 cells (Fig. 1A).
However, according to Franchimont et al. (1999), the
U937 cell line produces a very low level of IL-10
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
Il-10pg/ml
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
1000
900
800
700
600
500
400
300
200
100
0
Monocytes
-
5
U937
10
100
-
10
100
(nM)
20
10 nM
100 nM
15
10
5
0
-
20
30
Stimulation time (Hours)
Transactivation fold/control
Transactivation fold/control
Tat(1-86)
40
3
2.5
2
1.5
1
0.5
0
-
Tat
1-86
Immobilized
Tat
Gst
Gst-Tat
1-45
Gst-Tat
30-72
Fig. 1. Tat induces NF-kB activation in the promonocytic cell line U937 by acting at the membrane. (A) Monocytes or U937 cells
(106) were stimulated by Tat for 24 h, and secreted IL-10 was measured by ELISA. (B) U937 cells (5 105) were transfected with
pNF-kB-Luc and pCMV-b-galactosidase. After 24 h transfected cells were stimulated with Tat 1-86, and transactivation kinetics
were monitored. (C) Transfected cells were stimulated with soluble Tat 1-86, mutants Gst-Tat 1-45 and Gst-Tat 30-72 (all at 10 nM),
or with Tat previously immobilized in the wells (50 nM) for 30 h. Unstimulated cells or cells stimulated with Gst were used as
negative controls. The transactivation by NF-kB was evaluated by measuring luciferase activity and normalized by b-galactosidase
activity.
compared with primary monocytes, even when treated
with 100 nM Tat. To demonstrate that Tat induced
NF-kB activation, we developed and validated a
transfection approach using U937 cells as transactivation
model. U937 cells were co-transfected with an
NF-kB reporter plasmid, pNF-kB-Luc, expressing the
luciferase gene under the control of four NF-kB sites, and
pCMV-bGal, expressing the b-galactosidase gene under
the control of the CMV promoter. Incubation of
transfected cells with Tat induced NF-kB activation
(as measured by luciferase gene transactivation) in a
dose-dependent manner with a maximum induction of
19-fold at 30 h with 100 nM of Tat 1-86 (Fig. 1B).
More interestingly, immobilized Tat or Gst-Tat 1-45
N-terminal fragment, which are unable to be internalized,
still induced NF-kB activation to the same level as that
induced by soluble Tat (Fig. 1C). However, the deleted
mutant Gst-Tat 30-72 protein was unable to induce NFkB transactivation (Fig. 1C). These findings are in
agreement with the results described previously for
monocytes (Badou et al., 2000). In the control experiment, no NF-kB activation was observed with Gst alone.
Tat induces nuclear translocation of p65
and p52 NF-jB subunits
To further characterize the relationship between Tatinduced NF-kB activation and IL-10 production, we
first monitored the nuclear translocation of the NF-kB
p65 and p52 proteins. Nuclear extracts from primary
monocytes treated or not with Tat 1-86 protein (Tat)
were analyzed by Western blot. As expected, p65 was
not found in the nucleus of unstimulated cells but, after
10 min of stimulation, Tat induced p65 nuclear translocation, which was still detectable up to 60 min (Fig. 2A).
Thus, Tat activates the classical pathway, leading to p65
nuclear translocation. More interestingly, as found
with HTLV-1 Tax (Qu et al., 2004), Tat also induced
the activation of p52, which was found in the nucleus
after 30 min and accumulated up to 60 min (Fig. 2A).
This result suggests that Tat activates both classical
and alternative NF-kB pathways, while TNF-a
activates only classical pathway, as shown by its
capacity to induce p65 but not p52 nuclear translocation
(Fig. 2A).
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
6
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
TNF-α
Tat 1-86
min
C
10
30
60
10
30
60
p65
p52
TFIIB
% input
0.3
C Tat 30
p65
0.2
p52
0.1
0
min
N
C
Tat 30
p65
C
Tat 30
p52
C
Tat 30
Input
N
Fig. 2. Tat induces recruitment of p65 and p52 to the IL-10 promoter. (A) Primary monocytes (107 cells) were stimulated or not with
Tat 1-86 (10 nM) or TNF-a (20 ng/ml). Nuclear extracts were prepared and analyzed by Western blot. Anti-TFIIB was used as a
loading control. (B) Monocytes were treated or not with 10 nM Tat 1-86 for 30 min, and ChIP assays were performed with anti-p65,
anti-p52 or without (N) antibodies. The proportion of co-immunoprecipitated IL-10 promoter was analyzed by quantitative realtime PCR.
The nuclear p65 and p52 NF-jB subunits bind to the
IL-10 gene promoter
However, to be active, the nuclear NF-kB proteins of
each pathway (p65 and p52) must be able to reach their
binding sites on the IL-10 gene promoter, otherwise they
return to the inactive form in the cytoplasm. The
recruitment of NF-kB proteins p65 and p52 at the IL-10
promoter region was monitored using the ChIP assay.
Monocytes were treated or not by Tat for 30 min,
and nuclear extracts were analyzed by ChIP using
antibodies directed against p65 or p52. In agreement
with the results described above, quantitative
real-time (Fig. 2B, left panel) and final-time (Fig. 2B,
right panel) PCR analysis demonstrated the recruitment
of p65 or p52 to the putative NF-kB-binding site of the
IL-10 promoter in Tat-treated but not in unstimulated
control cells. The specificity of the ChIP assay was
confirmed by the lack of IL-10 promoter immunoprecipitation in the absence of p65- or p52-specific
antibodies (N).
Tat-induced NF-jB activation requires NIK, IKKa
and IKKb kinases
To investigate whether NF-kB activation induced by
Tat required NIK, IKKa and/or IKKb kinases, transdominant kinase-negative NIK KK429/430AA, IKKa
K44M and IKKb K44A were expressed in the transactivation model. Transfected cells were then incubated in
the presence of Tat 1-86 (Fig. 3A) or Gst-Tat 1-45
(Fig. 3B). The results demonstrated that inhibition
of endogenous NIK led to a decrease in NF-kB
transactivation by 53% and 30% in the presence of
Tat 1-86 and Gst-Tat 1–45, respectively. Similarly,
inhibition of IKKa and IKKb reduced Tat 1-86-induced
NF-kB transactivation by 60% and 82%, respectively,
and Gst-Tat 1-45-induced transactivation by 50% and
88%, respectively. Interestingly, when both IKKa and
IKKb were inhibited, transactivation was totally inhibited (Fig. 3A, B). In accordance with this result,
overexpression of wild-type NIK or IKKa+b in U937
cells resulted in a 5.5- and 6.2-fold increase in Tatinduced NF-kB activation, respectively (Fig. 3C). The
expression of transfected plasmid products is shown in
Fig. 3D.
Tat induces the nuclear translocation of endogenous
IKKa in monocytes
To address the question whether Tat was also able to
induce nuclear translocation of IKKa, nuclear extracts
from human monocytes stimulated with Tat or TNF-a
(positive control) were analyzed by SDS-PAGE and
immunoblotted with antibodies against IKKa. Stimulation of monocytes with Tat as well as with internalization-impaired Gst-Tat 1-45 resulted in marked nuclear
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
120
Tat 1-86
100
80
60
40
20
0
-
Tat
IKKα
NIK
IKKβ
IKK α +β
Tat 1-45
Percentage of Tat-induced
NF-κB transactivation
Percentage of Tat-induced
NF-κB transactivation
120
100
80
60
40
20
0
-
Tat
Kinases targeted by negative
trans-dominant mutant
8
NF-κB transactivation fold
7
IKKα
IKKβ
IKK α+β
Kinases targeted by negative
trans-dominant mutant
C
Tat 1-86
7
NIK
pMK myc NIK
K429/430AA
Wt
myc
Actin
6
5
4
C
pEV IKKα Τ7
Wt
K44M
C
pcDNA IKKβ Flag
Wt
K44A
T7
Actin
3
2
1
0
-
IKK α+β
NIK
Tat
Wt Plasmids
Flag
Actin
Fig. 3. The NF-kB activation by Tat implicates NIK, IKKa and IKKb. U937 cells (5 105) were transfected with pNF-kB-Luc,
pCMV-b-galactosidase and plasmids encoding (A, B) trans-dominant kinase-negative NIKKK429/430AA, IKKaK44M and
IKKbK44A or (C) wild-type NIK or IKKa+b. After 24 h, transfected monocytes were stimulated by (A, C) Tat 1-86 or (B) Gst-Tat
1-45 at 10 nM for an additional 24 h. Unstimulated or vector-transfected cells were used as controls. The transactivation by NF-kB
was evaluated by measuring luciferase activity and normalized by b-galactosidase activity. (D) U937 cells were left untransfected
(C) or transfected by wild-type or mutant pMK myc NIK, pEV IKKa T7 and pcDNA IKKb Flag plasmids. After 24 h, cells were
lysed and analyzed by Western blot performed on the cytoplasmic fraction using tag-specific antibodies. Anti-actin was used as
loading control.
TNFα
Tat 1-86
min
C
10
30
60
120
10
30
60
120
IKKα
TFIIB
Tat 1-86
min
C
30
60
accumulation of IKKa (Fig. 4A, B). In control
experiments, no IKKa was observed in the nuclear
fraction of unstimulated or Gst-treated cells. These
results suggest that Tat induced nuclear translocation of
endogenous IKKa by acting at the cell membrane.
Gst-Tat 1-45
Gst
30
60
IKKα
Tat-induced recruitment of IKKa to the IL-10 gene
promoter is associated with histone H3 modifications
TFIIB
Fig. 4. Tat induces nuclear accumulation of endogenous
IKKa. Monocytes were stimulated or not with 10 nM Tat
1-86 (A, B), 20 ng/ml TNF-a (A), or 10 nM Gst-Tat 1-45 (B),
for the times indicated. Unstimulated cells or treatment with
10 nM Gst for 60 min were used as negative controls. Nuclear
extracts were analyzed by Western blot. Anti-TFIIB was used
as a loading control.
We next investigated whether in Tat-stimulated
human monocytes IKKa was recruited to the NF-kBbinding site in the IL-10 gene promoter region, and
whether such recruitment was associated with chromatin
remodeling activities.
Monocytes were treated for various times with Tat,
and ChIP assays were performed on the nuclear extracts
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
8
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
by using antibodies directed against IKKa, CBP,
phospho-histone H3 (Ser10), and acetyl-histone H3
(Lys14). Quantitative real-time PCR analysis was used
to determine the percentage of IL-10 promoter
input DNA that was bound to these proteins. In
response to stimulation with Tat, the recruitment of
IKKa and CBP to the IL-10 promoter was detected
30 min after treatment and was present for at least
60 min (Fig. 5A). Further, treatment of monocytes
with Tat resulted in increased phosphorylation of
serine 10 and acetylation of lysine 14 in histone H3 at
30 and 60 min of stimulation (Fig. 5A). The high
standard deviation is due to the difference of responses
between the three donors from which monocytes were
isolated.
One potential effect of histone H3 phosphorylation
has been proposed to be associated with the
recruitment and activation of histone acetyltransferases
(HAT) (Cheung et al., 2000; Lo et al., 2000). The
HAT activity of CBP acetylates the N-terminal
tails of histone H3 during transcriptional activation
(Lo et al., 2000; Strahl and Allis, 2000). Given the
fact that IKKa plays a role in the phosphorylation
1.2
% input
1
0.8
0.6
0.4
0.2
IKKα
C
CBP
Tat
p-H3
Tat 60’
Tat 30’
C
Tat 30’
Ac-H3
Tat 60’
C
Tat 60’
C
Tat 30’
Tat 60’
C
Tat 30’
Tat 30’
Tat 60’
C
0
N
TNFα
IKKα
CBP
Ac-H3
Anti-IKKα immunoprecipitation
Fig. 5. Tat treatment leads to IKKa association and histone
H3 modifications on the IL-10 promoter. (A) Monocytes
(107 cells) were treated with 10 nM Tat 1-86 for 30 or 60 min,
and ChIP assays were performed with the indicated antibodies.
The proportion of co-immunoprecipitated IL-10 promoter was
analyzed by quantitative real-time PCR. (B) After treatment of
monocytes with Tat or TNF-a, the nuclear fraction of
monocytes was incubated with anti-IKKa-specific antibodies
at 4 1C overnight before incubation for 2 h at 4 1C with protein
A and G agarose. Co-immunoprecipitated proteins were
analyzed by Western blot.
of serine 10 of histone H3 (Anest et al., 2003),
it was possible that IKKa might form a complex
with CBP and histone H3 on the IL-10 promoter to
increase transcription. The interactions of these
proteins were analyzed by co-immunoprecipitation and
Western blot analysis of nuclear extracts prepared
from monocytes stimulated for 60 min by Tat or by
TNFa as a positive control. Both CBP and acetylated
histone H3 were co-immunoprecipitated by IKKa
antibodies (Fig. 5B).
PKC, ERK1/2 and p38 MAP kinases are implicated
in Tat-induced nuclear translocation of IKKa
We next investigated whether the Tat-induced nuclear
translocation of IKKa could be regulated by PKC and
the downstream ERK1/2 and p38 MAP kinase pathways.
We first monitored the kinetics of activation of
ERK1/2 and p38 MAP kinases in monocytes
treated with Tat. Monocytes were stimulated with Tat
(10 nM) or TNF-a (20 ng/ml) for 10, 30 or 60 min.
The activation of ERK1/2, also called p42/p44, and p38
MAP kinase led to their phosphorylation on
Thr202/Tyr204 and Thr180/Tyr182, respectively. No
significant activation of ERK1/2 was detected
after 10 min of Tat treatment (Fig. 6A). However, after
30 min of Tat stimulation, a transient but strong
activation of p42 and p44 was noted. In contrast,
p38 MAP kinases were continuously activated from
10 min onward and persisted after 60 min of stimulation
by Tat (Fig. 6A). TNF-a induced ERK1/2 and p38
MAP kinase phosphorylation from 10 to 60 min of
stimulation (Fig. 6A).
Secondly, the effects of specific chemical inhibitors of
PKC, ERK1/2 and p38 MAP kinases (used at non-toxic
concentrations) on the Tat-induced IL-10 production
were tested (Fig. 6B). Inhibition of all PKC isoforms
by RO 318220 induced a strong inhibition of IL-10
production at 1 mM, which became total at 5 mM
(Fig. 6B). In contrast, we observed only a partial
inhibition of IL-10 production (46% and 67%
of inhibition) by the p38 MAP kinase inhibitor SB
202190 at 1 and 5 mM, respectively, and 2% and 30% by
the MAP kinase ERK1/2 inhibitor PD 98059 at 1 and
5 mM, respectively (Fig. 6B). These results confirm that,
in contrast to the crucial role of PKC signaling, ERK1/2
and p38 MAP kinases are only partially implicated in
IL-10 production induced by Tat in human monocytes.
Similar results were obtained after TNF-a stimulation
(Fig. 6C).
The implication of these kinase pathways in the Tatinduced nuclear translocation of IKKa was assessed
using the same kinase inhibitors. As shown in Fig. 7A,
Tat-induced nuclear translocation of IKKa was totally
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
TNF-α
Tat 1-86
10
C
min
9
30
60
C
10
30
60
Phospho-p38
Phospho-p44
Phospho-p42
Actin
1600
1200
600
500
400
IL-10 pg/ml
IL-10 pg/ml
1400
300
200
1000
800
600
400
200
100
0
TNF-α (20ng/ml)
RO 318220 (μM)
SB 202190 (μM)
PD 98059 (μM)
0
(10 nM)
Tat
RO 318220 (μM)
SB 202190 (μM)
(μM)
PD 98059
-
+
-
+
1
-
+
5
-
+
5
-
+
1
-
+
1
+
5
-
+
-
+
1
-
+
10
-
+
1
-
+
10
-
+
1
+
5
Fig. 6. Activation of PKC and MAP kinases is implicated in Tat-induced IL-10 production. (A) Monocytes (107 cells) were
stimulated or not with 10 nM Tat 1-86 or 20 ng/ml TNF-a, and cytoplasmic extracts were analyzed by Western blot using antibodies
against phospho-p38 or phospho-ERK1/2 protein. Anti-actin was used as a loading control. (B, C) Monocytes were pretreated or
not with specific inhibitors for PKC (RO 318220), p38 MAP kinase (SB 202190) or ERK1/2 MAP kinase (PD 98059) for 30 min
before being stimulated by Tat 1-86 (B) or TNF-a (C). Twenty-four hours later, culture supernatants were recovered and IL-10
production was quantified by ELISA. The values are the means7SD of triplicates. Similar results were obtained with cells isolated
from three different donors.
Tat 1-86 (10 nM)
-
30
60
RO 318220 (5 μM)
SB 202190 (5 μM)
PD 98059 (5 μM)
30
60
30
60
30
60
-
-
-
-
-
-
+
+
-
-
-
-
-
-
+
+
-
-
-
-
-
-
-
-
-
+
+
min
IKK α
TFIIB
TNF-α (20 ng/ml)
-
30
30
30
30
RO 318220 (5 μM)
-
-
+
-
-
SB 202190(10 μM)
-
-
-
+
-
PD 98059 (10 μM)
-
-
-
-
+
min
IKKα
TFIIB
Fig. 7. PKC and MAP kinases are implicated in Tat-induced nuclear translocation of IKKa. Monocytes were pretreated or not with
specific inhibitors for PKC (RO 318220), p38 MAP kinases (SB 202190) or ERK1/2 MAP kinases (PD 98059) for 30 min before
being incubated with (A) Tat 1-86 or (B) TNF-a. Nuclear extracts were analyzed by Western blot. Anti-TFIIB was used as a loading
control.
inhibited when the PKC pathway was blocked by RO
318220, but only partially inhibited when the ERK1/2 or
p38 MAP kinases were inhibited. In monocytes treated
with TNF-a, only p38 MAP kinase was implicated in
stimulus-induced nuclear translocation of IKKa
(Fig. 7B).
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
10
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
Tat-induced IKKa and NF-jB subunit recruitment to
the IL-10 gene promoter is also regulated by PKC,
ERK1/2 and p38 MAP kinases
In additional studies, the implication of PKC, ERK1/2
and p38 MAP kinases in IKKa, NF-kB subunit
IKKα
α
% Input
0.2
0.15
0.1
0.05
0
CBP
% Input
0.06
0.04
0.02
p-H3
Ac-H3
% Input
% Input
p65
% Input
0
0.3
Discussion
We have previously demonstrated that extracellular
Tat induces production of IL-10, a highly immunosuppressive cytokine, via PKC, MAP kinase ERK1/2 and
NF-kB pathways in human monocytes (Badou et al.,
2000; Bennasser and Bahraoui, 2002). Different binding
elements, including NF-kB, Sp-1, AP-1, STATs, NF-IL-6,
Ets-1, CREB/ATF, and C/EBP, are located in the IL-10
promoter region and have been suggested to be of
importance in tissue-specific and differentiationdependent IL-10 transcription (Brenner et al., 2003).
Nine potential binding sites for NF-kB have been
located in the human IL-10 promoter (Eskdale et al.,
1997). Tat has been reported to activate NF-kB in a
variety of cell types, such as endothelial cells, lymphocytes (T and B) and astrocytes (Conant et al., 1996;
Cota-Gomez et al., 2002; Ott et al., 1998). In this study,
we have demonstrated that Tat activates both classical
and alternative NF-kB pathways and stimulates the
nuclear translocation of IKKa to induce IL-10 production in monocytes.
The transactivation assay showed that, by acting at
the membrane, extracellular Tat induced NF-kB activation in U937 cells. Two signaling cascades for NF-kB
activation, triggered by Tat, were involved. The first is
the classic pathway that requires IKKa, IKKb and p65
and p50 subunits. The second is the alternative pathway
0.2
0.1
0
1.2
1
0.8
0.6
0.4
0.2
0
0.3
0.2
0.1
p52
% Input
0
0.15
0.1
0.05
N
% Input
0
0.2
0.15
0.1
0.05
0
(10 nM)
−
+
+
+
+
SB 202190 (5 μM)
−
−
+
−
−
(5 μM)
−
−
−
+
−
RO 318220 (5 μM)
−
−
−
−
+
Tat
PD 98059
recruitment and histone H3 modifications to the IL-10
gene promoter (Fig. 8) were tested. Human monocytes
(pre-incubated with kinase inhibitors for 30 min) were
treated with Tat and subsequently analyzed by ChIP
assays. In agreement with the data presented above, Tatinduced IKKa recruitment to the IL-10 promoter was
significantly blocked after PKC and p38 MAP kinase
inhibition. ERK1/2 MAP kinase inhibitors blocked
recruitment even more strongly. Similarly, p38 MAP
kinase inhibition led to a partial inhibition of histone H3
phosphorylation, which was completely blocked in the
presence of PKC and ERK1/2 inhibitors. Further,
inhibition of these three kinases strongly prevented the
CBP, p65 and p52 recruitment and histone H3 acetylation on the IL-10 promoter, after Tat stimulation
(Fig. 8).
Fig. 8. PKC, ERK1/2 and p38 MAP kinases are implicated
in Tat-induced histone modifications. Monocytes (107 cells)
were pretreated or not with specific inhibitors for PKC
(RO 318220), p38 MAP kinases (SB 202190) or ERK1/2
MAP kinases (PD 98059) for 30 min before being stimulated
by (A) Tat 1-86 for 60 min. ChIP assays were performed with
the antibodies indicated or without antibodies (N). The
proportion of co-immunoprecipitated IL-10 promoter was
analyzed by quantitative real-time PCR.
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
requiring NIK, IKKa and p52 subunit. Inhibition of
endogenous NIK, IKKa or IKKb by their respective
trans-dominant negative mutants reduced the Tatinduced transactivation tested in our model. Accordingly, the simultaneous expression of the IKKa and
IKKb trans-dominant negative mutants totally abolished the Tat-induced transactivation in the cells,
suggesting a synergistic role of IKKa and IKKb in
the NF-kB activation induced by Tat. These findings are
also in line with the nuclear accumulation of NF-kB
subunits p65 and p52 in response to Tat stimulation
of human primary monocytes. These results support
the activation of both classical and alternative
NF-kB pathways induced by Tat in monocytic cells.
Similarly, it has been shown that the transactivating Tax
protein from HTLV-1 is also able to activate both the
classical and non-classical NF-kB pathways (Harhaj
and Harhaj, 2005; Sun and Yamaoka, 2005; Xiao et al.,
2001b).
However, while Tat mediates signaling, including
phospholipase A2 and PKC pathways, by acting at the
cell membrane (Badou et al., 2000), HTLV-1 Tax has an
intracellular action involving a direct interaction with
IKKg, which is essential for the NF-kB activation (Chu
et al., 1999; Harhaj and Sun, 1999; Jin et al., 1999).
Our experiments were performed with the whole Tat
1-86 protein, which is able to be internalized (Gee et al.,
2006). However, the kinetics used in this study ranged
from 15 to a maximum of 60 min after Tat stimulation
and were not sufficient for Tat internalization as
described by Vendeville et al. (2004). These authors
have shown that Tat enters the cells by slow internalization kinetics at 37 1C, beginning at 1 h and reaching a
maximum at 8 h. This observation is also in agreement
with the capacity of Tat 1-45, a mutant lacking the basic
domain essential for Tat internalization, to activate
IL-10 production in monocytes. Thus, we can conclude
that the signal transduction pathways observed in this
study are mainly due to an extracellular action of Tat by
interaction with membrane receptor(s) that remain to be
defined. In this study, Tat effects were observed at
10 nM. This concentration is comparable to the physiological one. In fact, different studies have reported that
Tat is found at the nanomolar range in the serum of
HIV-1-infected patients (Westendorp et al., 1995; Xiao
et al., 2000). However, if we take into account the ability
of Tat to adsorb on a variety of cellular receptors, it is
likely that this concentration is underestimated. In
addition, this concentration is probably higher in the
vicinity of the active HIV replication sites. So we can
consider that a concentration of 10 nM Tat could be
reached in vivo, at least at these sites.
Although they are often activated concurrently, the
classical and the alternative NF-kB activation pathways
seem to have distinct regulatory functions (Bonizzi and
Karin, 2004; Hayden and Ghosh, 2004; Silverman and
11
Maniatis, 2001). The classical pathway is, in general,
activated by ligands for cellular receptors to promote
cell survival and the production of cytokines, chemokines and adhesion molecules (Bonizzi and Karin, 2004;
Hayden and Ghosh, 2004), whereas the alternative
pathway seems to be further implicated in the regulation
of the development of lymphoid organs and the adaptive
immune response (Beinke and Ley, 2004; Hayden and
Ghosh, 2004; Lawrence et al., 2005; Silverman and
Maniatis, 2001). However, the activation of both the
classical and alternative NF-kB pathway elements
by the same ligand has also been described as a
classical NIK-dependent pathway, induced by CD70
(Ramakrishnan et al., 2004). Thus, our results suggest
that Tat may also activate a similar classical NIKdependent pathway in human monocytes to activate
IL-10 production.
By acting at the cell membrane, Tat also modulates
the cellular localization of IKKa. In the absence of Tat,
IKKa is mostly present in the cytoplasm but, after
primary human monocyte stimulation with Tat, endogenous IKKa translocates to the nucleus. This
nuclear localization is totally inhibited when the
stimulation is performed in the presence of PKC
inhibitors. This result is in agreement with our previous
finding showing the crucial role of PKC in the signaling
pathway activated by Tat in human monocytes (Badou
et al., 2000; Bennasser et al., 2002). In a recent study,
Harhaj et al. (2007) have shown that HTLV-1 Tax
protein is also able to modulate the subcellular
localization of IKKa and IKKg. In T lymphocytes
transformed by HTLV-1 or expressing Tax protein,
IKKa and IKKg became predominantly localized within
perinuclear sites that co-locate with the Golgi apparatus.
Moreover, the Golgi localization of IKKa by Tax seems
to be IKKg dependent (Harhaj et al., 2007). Thus, in our
model, it would be of interest to analyze the role of
IKKg on the nuclear translocation of IKKa in primary
monocytes treated by Tat.
Compaction of DNA is associated with gene repression. However, to be active, the nuclear NF-kB proteins
must be able to reach their binding sites on the IL-10
gene promoter. In order to allow transcription,
some histones around which DNA is wrapped
undergo modifications including phosphorylation and
acetylation. Histone H3 is one of the main histone
proteins involved in the structure of chromatin in
eukaryotic cells. The N-terminal tail of histone H3 can
undergo several modifications that influence cellular
processes. Phosphorylation on serine 10 and acetylation
on lysine 14 are commonly seen in genes that are being
actively transcribed into RNA. The nuclear role of IKKa,
described by Yamamoto et al. (2003) and Anest et al.
(2003), leading to phosphorylation and subsequent acetylation of histone H3, may be one of the mechanisms
used by some signal transducers to increase promoter
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
12
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
accessibility and optimize target gene expression. This
information allowed us to focus our investigations on
histone H3 modifications after Tat stimulation.
Thus, in our study, we showed that Tat induced
translocation of IKKa into the nucleus associated with
histone H3 modification in the IL-10 promoter region of
primary monocytes. Given the fact that IKKa plays a role
in phosphorylation of histone H3 at serine 10 (Anest et al.,
2003) and the recruitment of HAT (Cheung et al., 2000;
Lo et al., 2000), we can propose kinetics for the
recruitment of different factors by analyzing our ChIP
assay data. First, Tat induces a nuclear translocation and
recruitment of IKKa to the IL-10 promoter. Once there,
the kinase IKKa may phosphorylate histone H3 on serine
10 and subsequently recruit CBP to the IL-10 promoter.
CBP acetylates the phosphorylated histone H3 on lysine
14, leading to a chromatin opening and thus increasing
positive IL-10 regulation by facilitating the access of
NF-kB proteins p65 and p52 to their binding sites on the
promoter (Fig. 9). Here, we have shown a positive role of
IKKa in regulating IL-10 gene transcription. However, it
is interesting to note that IKKa can also contribute
to suppression of NF-kB activity by accelerating both
the turnover of p65 and c-Rel, and their removal from
pro-inflammatory gene promoters, thus contributing to
resolution of inflammation (Lawrence et al., 2005).
In previous studies, we and others have shown that
PKC, ERK1/2 and p38 MAP kinases are activated in
monocytes by Tat (Badou et al., 2000; Bennasser et al.,
2002; Gee et al., 2007; Li and Lau, 2007; Li et al., 2005)
and play a crucial role in Tat-induced IL-10 production
(Badou et al., 2000; Bennasser et al., 2002). Other
studies have also shown a strong regulation of PMAinduced ERK1/2 and p38 MAP kinase activation by
PKCd (Kang et al., 2004; Ueda et al., 1996).
In the present study, we further showed the implication
of these kinases in Tat-induced nuclear translocation of
IKKa, recruitment of IKKa, CBP, p65, and p52 subunits
to, and histone H3 phosphorylation and acetylation in the
IL-10 gene promoter region. Whereas Tat-induced IL-10
production and nuclear translocation of IKKa were shown
to be only partially regulated by ERK1/2 and p38 MAP
kinases (Figs. 6 and 7), these kinases seem to play a very
important role in histone H3 phosphorylation and
acetylation in response to Tat (Fig. 8). This observation
is in accordance with a recent report by Lucas et al. (2005),
who demonstrated the involvement of ERK1/2 activation
in the phosphorylation of serine 10 on histone H3 at
the IL-10 promoter, thus making it more accessible to
transcription factors like Sp1 and STAT3, generated in
response to p38 activation following macrophage Fc-gR
ligation. Similarly, our data suggest the implication of
PKC, ERK1/2 and p38 MAP kinases in the activation of
IL-10 gene expression by regulating chromatin modifications and the recruitment of transcription factors in
monocytes stimulated with Tat. The apparent discrepancy
between the partial (Figs. 6 and 7) and total (Fig. 8) effect,
obtained with MAP kinase inhibitors, may be due to the
Fig. 9. Model of Tat-induced NF-kB pathways leading to IL-10 production in monocytes. By interacting with a (yet unknown)
receptor at the cell membrane, Tat induces activation of PKC, in particular PKC-bII PKC-d, ERK1/2 and p38 MAP kinases. The
induction of these pathways activates the classical and alternative NF-kB pathways. In parallel, Tat induces translocation of IKKa
into the nucleus and binding to the IL-10 promoter. Once there, IKKa may phosphorylate histone H3 on serine 10 and subsequently
recruit CBP to the IL-10 promoter. CBP acetylates the phosphorylated histone H3 on lysine 14, leading to a chromatin opening,
thus facilitating access of NF-kB proteins p65 and p52 to their binding sites on the promoter.
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
decrease of their inhibitory action with time. This question
needs to be further investigated with other approaches,
such as siRNA.
Finally, taking our data into account, we propose a
model of the NF-kB pathway induced by Tat to
optimize IL-10 production in monocytic cells (Fig. 9).
Our model suggests that, by interacting at the membrane with a receptor that remains to be identified, Tat
induces PKC activation (Badou et al., 2000; Belardelli
and Gresser, 1996; Bennasser and Bahraoui, 2002).
Downstream of the PKC pathway, Tat activates MAP
kinases, including ERK1/2 and p38. The induction of
these pathways may in part activate the classical NF-kB
NIK-dependent pathway and, in parallel, induce IKKa
translocation into the nucleus associated with chromatin
remodeling. The latter mechanism may enhance the
accessibility of NF-kB proteins to their specific binding
sites on the IL-10 promoter. In conclusion, Tat
mobilizes various cellular mechanisms that cooperate
to increase IL-10 production by the monocytes via
NF-kB activation.
Understanding the regulation of IL-10 expression in
HIV infection is important for deciphering the dysregulation of the cytokine network induced by HIV and, more
broadly, understanding how HIV infection induces a state
of immunodeficiency. Targeting the NF-kB pathway
might be a potential strategy for treating and preventing
immune response depression in HIV-1-infected patients.
Acknowledgements
This work was supported by Agence Nationale de
Recherche sur le SIDA, Conseil Régional MidiPyrénées, SIDACTION, and Université Paul Sabatier,
Toulouse. We thank Dr. Fabienne Rayne for reading
the manuscript. We thank Dr. Romas Geleziunas for his
kind gift of plasmids.
References
Anderson, C.F., Mosser, D.M., 2002. Cutting edge: biasing
immune responses by directing antigen to macrophage Fc
gamma receptors. J. Immunol. 168, 3697–3701.
Anest, V., Hanson, J.L., Cogswell, P.C., Steinbrecher, K.A.,
Strahl, B.D., Baldwin, A.S., 2003. A nucleosomal function
for IkappaB kinase-alpha in NF-kappaB-dependent gene
expression. Nature 423, 659–663.
Badou, A., Bennasser, Y., Moreau, M., Leclerc, C., Benkirane,
M., Bahraoui, E., 2000. Tat protein of human
immunodeficiency virus type 1 induces interleukin-10
in human peripheral blood monocytes: implication of
protein kinase C-dependent pathway. J. Virol. 74,
10551–10562.
Baeuerle, P.A., Baltimore, D., 1996. NF-kappa B: ten years
after. Cell 87, 13–20.
13
Baldwin Jr., A.S., 1996. The NF-kappa B and I kappa B
proteins: new discoveries and insights. Annu. Rev. Immunol. 14, 649–683.
Beinke, S., Ley, S.C., 2004. Functions of NF-kappaB1 and
NF-kappaB2 in immune cell biology. Biochem. J. 382,
393–409.
Belardelli, F., Gresser, I., 1996. The neglected role of type I
interferon in the T-cell response: implications for its clinical
use. Immunol. Today 17, 369–372.
Benkhart, E.M., Siedlar, M., Wedel, A., Werner, T., ZieglerHeitbrock, H.W., 2000. Role of Stat3 in lipopolysaccharide-induced IL-10 gene expression. J. Immunol. 165,
1612–1617.
Bennasser, Y., Bahraoui, E., 2002. HIV-1 Tat protein induces
interleukin-10 in human peripheral blood monocytes:
involvement of protein kinase C-betaII and -delta. FASEB
J. 16, 546–554.
Bennasser, Y., Badou, A., Tkaczuk, J., Bahraoui, E., 2002.
Signaling pathways triggered by HIV-1 Tat in
human monocytes to induce TNF-alpha. Virology 303,
174–180.
Berg, D.J., Kuhn, R., Rajewsky, K., Muller, W., Menon, S.,
Davidson, N., Grunig, G., Rennick, D., 1995. Interleukin10 is a central regulator of the response to LPS in murine
models of endotoxic shock and the Shwartzman reaction
but not endotoxin tolerance. J. Clin. Invest. 96, 2339–2347.
Birbach, A., Gold, P., Binder, B.R., Hofer, E., De Martin, R.,
Schmid, J.A., 2002. Signaling molecules of the NF-kappa B
pathway shuttle constitutively between cytoplasm and
nucleus. J. Biol. Chem. 277, 10842–10851.
Bleharski, J.R., Li, H., Meinken, C., Graeber, T.G., Ochoa,
M.T., Yamamura, M., Burdick, A., Sarno, E.N., Wagner,
M., Rollinghoff, M., Rea, T.H., Colonna, M., Stenger, S.,
Bloom, B.R., Eisenberg, D., Modlin, R.L., 2003. Use of
genetic profiling in leprosy to discriminate clinical forms of
the disease. Science 301, 1527–1530.
Bonizzi, G., Karin, M., 2004. The two NF-kappaB activation
pathways and their role in innate and adaptive immunity.
Trends Immunol. 25, 280–288.
Brenner, S., Prosch, S., Schenke-Layland, K., Riese, U.,
Gausmann, U., Platzer, C., 2003. cAMP-induced interleukin-10 promoter activation depends on CCAAT/enhancer-binding
protein
expression
and
monocytic
differentiation. J. Biol. Chem. 278, 5597–5604.
Brightbill, H.D., Plevy, S.E., Modlin, R.L., Smale, S.T., 2000.
A prominent role for Sp1 during lipopolysaccharidemediated induction of the IL-10 promoter in macrophages.
J. Immunol. 164, 1940–1951.
Cao, S., Liu, J., Song, L., Ma, X., 2005. The protooncogene cMaf is an essential transcription factor for IL-10 gene
expression in macrophages. J. Immunol. 174, 3484–3492.
Chang, H.C., Samaniego, F., Nair, B.C., Buonaguro, L.,
Ensoli, B., 1997. HIV-1 Tat protein exits from cells via a
leaderless secretory pathway and binds to extracellular
matrix-associated heparan sulfate proteoglycans through its
basic region. Aids 11, 1421–1431.
Cheung, P., Allis, C.D., Sassone-Corsi, P., 2000. Signaling to
chromatin through histone modifications. Cell 103, 263–271.
Chu, Z.L., Shin, Y.A., Yang, J.M., Didonato, J.A., Ballard,
D.W., 1999. IKKgamma mediates the interaction of
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
14
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
cellular IkappaB kinases with the Tax transforming protein
of human T cell leukemia virus type 1. J. Biol. Chem. 274,
15297–15300.
Conant, K., Ma, M., Nath, A., Major, E.O., 1996. Extracellular human immunodeficiency virus type 1 Tat protein
is associated with an increase in both NF-kappa B binding
and protein kinase C activity in primary human astrocytes.
J. Virol. 70, 1384–1389.
Conti, P., Kempuraj, D., Frydas, S., Kandere, K., Boucher,
W., Letourneau, R., Madhappan, B., Sagimoto, K.,
Christodoulou, S., Theoharides, T.C., 2003. IL-10 subfamily members: IL-19, IL-20, IL-22, IL-24 and IL-26.
Immunol. Lett. 88, 171–174.
Coope, H.J., Atkinson, P.G., Huhse, B., Belich, M., Janzen, J.,
Holman, M.J., Klaus, G.G., Johnston, L.H., Ley, S.C.,
2002. CD40 regulates the processing of NF-kappaB2 p100
to p52. EMBO J. 21, 5375–5385.
Cota-Gomez, A., Flores, N.C., Cruz, C., Casullo, A., Aw,
T.Y., Ichikawa, H., Schaack, J., Scheinman, R., Flores,
S.C., 2002. The human immunodeficiency virus-1 Tat
protein activates human umbilical vein endothelial cell
E-selectin expression via an NF-kappa B-dependent mechanism. J. Biol. Chem. 277, 14390–14399.
Davies, S.P., Reddy, H., Caivano, M., Cohen, P., 2000.
Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem. J. 351,
95–105.
Dejardin, E., Droin, N.M., Delhase, M., Haas, E., Cao, Y.,
Makris, C., Li, Z.W., Karin, M., Ware, C.F., Green, D.R.,
2002. The lymphotoxin-beta receptor induces different
patterns of gene expression via two NF-kappaB pathways.
Immunity 17, 525–535.
Eliopoulos, A.G., Caamano, J.H., Flavell, J., Reynolds, G.M.,
Murray, P.G., Poyet, J.L., Young, L.S., 2003. Epstein–Barr
virus-encoded latent infection membrane protein 1 regulates the processing of p100 NF-kappaB2 to p52 via an
IKKgamma/NEMO-independent signalling pathway. Oncogene 22, 7557–7569.
Ensoli, B., Barillari, G., Salahuddin, S.Z., Gallo, R.C., WongStaal, F., 1990. Tat protein of HIV-1 stimulates growth of
cells derived from Kaposi’s sarcoma lesions of AIDS
patients. Nature 345, 84–86.
Ensoli, B., Buonaguro, L., Barillari, G., Fiorelli, V.,
Gendelman, R., Morgan, R.A., Wingfield, P.,
Gallo, R.C., 1993. Release, uptake, and effects of extracellular human immunodeficiency virus type 1 Tat protein
on cell growth and viral transactivation. J. Virol. 67,
277–287.
Eskdale, J., Kube, D., Tesch, H., Gallagher, G., 1997.
Mapping of the human IL10 gene and further characterization of the 50 flanking sequence. Immunogenetics 46,
120–128.
Fickenscher, H., Hor, S., Kupers, H., Knappe, A., Wittmann,
S., Sticht, H., 2002. The interleukin-10 family of cytokines.
Trends Immunol. 23, 89–96.
Franchimont, D., Martens, H., Hagelstein, M.T., Louis, E.,
Dewe, W., Chrousos, G.P., Belaiche, J., Geenen, V.,
1999. Tumor necrosis factor alpha decreases, and interleukin-10 increases, the sensitivity of human monocytes to dexamethasone: potential regulation of the
glucocorticoid receptor. J. Clin. Endocrinol. Metab. 84,
2834–2839.
Frankel, A.D., Pabo, C.O., 1988. Cellular uptake of the Tat
protein from human immunodeficiency virus. Cell 55,
1189–1193.
Gee, K., Angel, J.B., Ma, W., Mishra, S., Gajanayaka, N.,
Parato, K., Kumar, A., 2006. Intracellular HIV-Tat
expression induces IL-10 synthesis by the CREB-1 transcription factor through Ser133 phosphorylation and its
regulation by the ERK1/2 MAPK in human monocytic
cells. J. Biol. Chem. 281, 31647–31658.
Gee, K., Angel, J.B., Mishra, S., Blahoianu, M.A., Kumar, A.,
2007. IL-10 regulation by HIV-Tat in primary human
monocytic cells: involvement of calmodulin/calmodulindependent protein kinase-activated p38 MAPK and Sp-1
and CREB-1 transcription factors. J. Immunol. 178,
798–807.
Geleziunas, R., Ferrell, S., Lin, X., Mu, Y., Cunningham Jr.,
E.T., Grant, M., Connelly, M.A., Hambor, J.E., Marcu,
K.B., Greene, W.C., 1998. Human T-cell leukemia
virus type 1 Tax induction of NF-kappaB involves
activation of the IkappaB kinase alpha (IKKalpha)
and IKKbeta cellular kinases. Mol. Cell. Biol. 18,
5157–5165.
Ghosh, S., May, M.J., Kopp, E.B., 1998. NF-kappa B and Rel
proteins: evolutionarily conserved mediators of immune
responses. Annu. Rev. Immunol. 16, 225–260.
Grutz, G., 2005. New insights into the molecular mechanism
of interleukin-10-mediated immunosuppression. J. Leukoc.
Biol. 77, 3–15.
Harhaj, E.W., Harhaj, N.S., 2005. Mechanisms of persistent
NF-kappaB activation by HTLV-I Tax. IUBMB Life 57,
83–91.
Harhaj, E.W., Sun, S.C., 1999. IKKgamma serves as a docking
subunit of the IkappaB kinase (IKK) and mediates
interaction of IKK with the human T-cell leukemia virus
Tax protein. J. Biol. Chem. 274, 22911–22914.
Harhaj, N.S., Sun, S.C., Harhaj, E.W., 2007. Activation of
NF-kappa B by the human T cell leukemia virus type I Tax
oncoprotein is associated with ubiquitin-dependent
relocalization of I kappa B kinase. J. Biol. Chem. 282,
4185–4192.
Hayden, M.S., Ghosh, S., 2004. Signaling to NF-kappaB.
Genes Dev. 18, 2195–2224.
Imbert, V., Rupec, R.A., Livolsi, A., Pahl, H.L., Traenckner,
E.B., Mueller-Dieckmann, C., Farahifar, D., Rossi, B.,
Auberger, P., Baeuerle, P.A., Peyron, J.F., 1996. Tyrosine
phosphorylation of I kappa B-alpha activates NF-kappa B
without proteolytic degradation of I kappa B-alpha. Cell
86, 787–798.
Ito, M., Ishida, T., He, L., Tanabe, F., Rongge, Y., Miyakawa,
Y., Terunuma, H., 1998. HIV type 1 Tat protein inhibits
interleukin 12 production by human peripheral blood
mononuclear cells. AIDS Res. Hum. Retroviruses 14,
845–849.
Jin, D.Y., Giordano, V., Kibler, K.V., Nakano, H., Jeang,
K.T., 1999. Role of adapter function in oncoproteinmediated activation of NF-kappaB. Human T-cell leukemia virus type I Tax interacts directly with IkappaB kinase
gamma. J. Biol. Chem. 274, 17402–17405.
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
Kane, M.M., Mosser, D.M., 2001. The role of IL-10 in
promoting disease progression in leishmaniasis. J. Immunol. 166, 1141–1147.
Kang, H.S., Park, E.K., Kim, K.H., Park, J.Y., Choi, J.Y.,
Shin, H.I., Jun, C.D., Kang, S.S., Kim, S.Y., 2004.
Receptor activator of nuclear factor-kappaB is induced by
a rottlerin-sensitive and p38 MAP kinase-dependent pathway during monocyte differentiation. Mol. Cells 17,
438–445.
Keller, H.U., Niggli, V., 1993. The PKC-inhibitor Ro 31-8220
selectively suppresses PMA- and diacylglycerol-induced
fluid pinocytosis and actin polymerization in PMNs.
Biochem. Biophys. Res. Commun. 194, 1111–1116.
Lawrence, T., Bebien, M., Liu, G.Y., Nizet, V., Karin, M.,
2005. IKKalpha limits macrophage NF-kappaB activation
and contributes to the resolution of inflammation. Nature
434, 1138–1143.
Lee, Y.W., Hirani, A.A., Kyprianou, N., Toborek, M., 2005.
Human immunodeficiency virus-1 Tat protein up-regulates
interleukin-6 and interleukin-8 expression in human breast
cancer cells. Inflamm. Res. 54, 380–389.
Li, J.C., Lau, A.S., 2007. A role for mitogen-activated protein
kinase and Ets-1 in the induction of interleukin-10
transcription by human immunodeficiency virus-1 Tat.
Immunology 121, 337–348.
Li, Q., Verma, I.M., 2002. NF-kappaB regulation in the
immune system. Nat. Rev. Immunol. 2, 725–734.
Li, J.C., Lee, D.C., Cheung, B.K., Lau, A.S., 2005. Mechanisms for HIV Tat upregulation of IL-10 and other
cytokine expression: kinase signaling and PKR-mediated
immune response. FEBS Lett. 579, 3055–3062.
Lin, S.C., 2006. Identification of an NF-Y/HMG-I(Y)-binding
site in the human IL-10 promoter. Mol. Immunol. 43,
1325–1331.
Liu, Y.W., Tseng, H.P., Chen, L.C., Chen, B.K., Chang, W.C.,
2003. Functional cooperation of Simian virus 40 promoter
factor 1 and CCAAT/enhancer-binding protein beta
and delta in lipopolysaccharide-induced gene activation
of IL-10 in mouse macrophages. J. Immunol. 171,
821–828.
Lo, W.S., Trievel, R.C., Rojas, J.R., Duggan, L., Hsu, J.Y.,
Allis, C.D., Marmorstein, R., Berger, S.L., 2000. Phosphorylation of serine 10 in histone H3 is functionally linked
in vitro and in vivo to Gcn5-mediated acetylation at lysine
14. Mol. Cell 5, 917–926.
Lucas, M., Zhang, X., Prasanna, V., Mosser, D.M., 2005.
ERK activation following macrophage FcgammaR ligation
leads to chromatin modifications at the IL-10 locus.
J. Immunol. 175, 469–477.
Maloney, G., Schroder, M., Bowie, A.G., 2005. Vaccinia virus
protein A52R activates p38 mitogen-activated protein
kinase and potentiates lipopolysaccharide-induced interleukin-10. J. Biol. Chem. 280, 30838–30844.
Miles, S.A., Conrad, S.M., Alves, R.G., Jeronimo, S.M.,
Mosser, D.M., 2005. A role for IgG immune complexes
during infection with the intracellular pathogen Leishmania. J. Exp. Med. 201, 747–754.
Moore, K.W., O’Garra, A., De Waal Malefyt, R., Vieira, P.,
Mosmann, T.R., 1993. Interleukin-10. Annu. Rev. Immunol. 11, 165–190.
15
Moore, K.W., De Waal Malefyt, R., Coffman, R.L., O’Garra,
A., 2001. Interleukin-10 and the interleukin-10 receptor.
Annu. Rev. Immunol. 19, 683–765.
Ott, M., Lovett, J.L., Mueller, L., Verdin, E., 1998. Superinduction of IL-8 in T cells by HIV-1 Tat protein is
mediated through NF-kappaB factors. J. Immunol. 160,
2872–2880.
Qu, Z., Qing, G., Rabson, A., Xiao, G., 2004. Tax deregulation of NF-kappaB2 p100 processing involves both betaTrCP-dependent and -independent mechanisms. J. Biol.
Chem. 279, 44563–44572.
Ramakrishnan, P., Wang, W., Wallach, D., 2004. Receptorspecific signaling for both the alternative and the canonical
NF-kappaB activation pathways by NF-kappaB-inducing
kinase. Immunity 21, 477–489.
Silverman, N., Maniatis, T., 2001. NF-kappaB signaling
pathways in mammalian and insect innate immunity. Genes
Dev. 15, 2321–2342.
Strahl, B.D., Allis, C.D., 2000. The language of covalent
histone modifications. Nature 403, 41–45.
Stylianou, E., Aukrust, P., Kvale, D., Muller, F., Froland,
S.S., 1999. IL-10 in HIV infection: increasing serum IL-10
levels with disease progression – down-regulatory effect of
potent anti-retroviral therapy. Clin. Exp. Immunol. 116,
115–120.
Sun, S.C., Yamaoka, S., 2005. Activation of NF-kappaB by
HTLV-I and implications for cell transformation. Oncogene 24, 5952–5964.
Tergaonkar, V., Bottero, V., Ikawa, M., Li, Q., Verma, I.M.,
2003. IkappaB kinase-independent IkappaBalpha degradation pathway: functional NF-kappaB activity and
implications for cancer therapy. Mol. Cell. Biol. 23,
8070–8083.
Ueda, Y., Hirai, S., Osada, S., Suzuki, A., Mizuno, K., Ohno,
S., 1996. Protein kinase C activates the MEK-ERK
pathway in a manner independent of Ras and dependent
on Raf. J. Biol. Chem. 271, 23512–23519.
Vendeville, A., Rayne, F., Bettache, N., Montcourrier, P.,
Beaumelle, B., 2004. HIV-1 uses coated pits to enter T-cells
before translocating from acidified endosomes and eliciting
biological responses. Mol. Biol. Cell 15, 2347–2360.
Viatour, P., Merville, M.P., Bours, V., Chariot, A., 2005.
Phosphorylation of NF-kappaB and IkappaB proteins:
implications in cancer and inflammation. Trends Biochem.
Sci. 30, 43–52.
Westendorp, M.O., Frank, R., Ochsenbauer, C., Stricker, K.,
Dhein, J., Walczak, H., Debatin, K.M., Krammer, P.H.,
1995. Sensitization of T cells to CD95-mediated
apoptosis by HIV-1 Tat and gp120. Nature 375,
497–500.
Wu, Y., Marsh, J.W., 2003. Gene transcription in HIV
infection. Microbes Infect. 5, 1023–1027.
Xiao, H., Neuveut, C., Tiffany, H.L., Benkirane, M., Rich,
E.A., Murphy, P.M., Jeang, K.T., 2000. Selective CXCR4
antagonism by Tat: implications for in vivo expansion of
coreceptor use by HIV-1. Proc. Natl. Acad. Sci. USA 97,
11466–11471.
Xiao, G., Harhaj, E.W., Sun, S.C., 2001a. NF-kappaBinducing kinase regulates the processing of NF-kappaB2
p100. Mol. Cell 7, 401–409.
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
ARTICLE IN PRESS
16
K. Leghmari et al. / European Journal of Cell Biology ] (]]]]) ]]]–]]]
Xiao, G., Cvijic, M.E., Fong, A., Harhaj, E.W., Uhlik, M.T.,
Waterfield, M., Sun, S.C., 2001b. Retroviral oncoprotein
Tax induces processing of NF-kappaB2/p100 in T cells:
evidence for the involvement of IKKalpha. EMBO J. 20,
6805–6815.
Yamamoto, Y., Verma, U.N., Prajapati, S., Kwak, Y.T.,
Gaynor, R.B., 2003. Histone H3 phosphorylation by IKK-
alpha is critical for cytokine-induced gene expression.
Nature 423, 655–659.
Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S.T.,
Weil, R., Agou, F., Kirk, H.E., Kay, R.J., Israel, A.,
1998. Complementation cloning of NEMO, a component of
the IkappaB kinase complex essential for NF-kappaB
activation. Cell 93, 1231–1240.
Please cite this article as: Leghmari, K., et al., HIV-1 Tat protein induces IL-10 production in monocytes by classical and alternative NF-kB
pathways. Eur. J. Cell Biol. (2008), doi:10.1016/j.ejcb.2008.06.005
Article 4
Toll-Like Receptor 4 plays a pivotal role in Tat-induced IL-10
and TNF-α production by monocytes: a novel Tat receptor
Kaoutar Leghmari, Fabienne Rayne, Nawal Ben Haij, Corinne Moreau and
Elmostafa Bahraoui
En rédaction
168
RESUME DE L’ARTICLE 4
La protein Tat du VIH-1 induit la production de l‘IL-10 et du TNF-α en agissant au niveau
membranaire, via sa région 1-45 N-terminale. Dans cet article, nous avons montré, pour la
première fois, l’implication du TLR4 comme récepteur pour la protéine Tat. Nos résultats
montrent que i) le traitement des monocytes humains avec des anticorps anti-TLR4, bloque
totalement la capacité de Tat à induire la production de l‘IL-10 et du TNF-α; ii) la protéine
Tat totale ou le fragment Tat 1-45 sous forme de protéines de fusion avec la Gst, sont
capables d’interagir directement avec le TLR4 membranaire ou sous forme soluble. Comme
contrôle, aucune interaction n’est observée avec le fragement 30-72 de Tat ni avec la Gst
seule ; ii) l’activation de la PKC-βII, des MAP kinases ERK1/2 et p38 par Tat est totalement
inhibée par les anticorps anti-TLR4, dans le monocyte humain.
L’ensemble de ces résultats indique que le virus VIH-1 via sa protéine Tat, recrute la voie du
TLR4 pour l’induction de l’IL-10, une cytokine fortement immunosuppressive, lui permettant
l’établissement d’un état favorable à la réplication et la persistance virale.
169
1
Title: Toll-Like Receptor 4 plays a pivotal role in Tat-induced IL-10 and TNF-α
production by monocytes: a novel Tat receptor
Running title: HIV-1 Tat induces IL-10 production
Kaoutar Leghmari, Fabienne Rayne, Nawal Ben Haij, Corinne Moreau, and
Elmostafa Bahraoui*
Laboratoire d’Immuno-Virologie, EA 3038, Université Paul Sabatier 118, route de
Narbonne 31062 Toulouse Cedex, France,
* Corresponding author:
- Address : Laboratoire d’Immuno-Virologie, Université Paul Sabatier 118, route de
Narbonne bâtiment 4R3, 31062 Toulouse, France
- Tel: (33) 561 558 667
- Fax: (33) 561 558 667
- e-mail: [email protected]
2
Abstract
We have previously shown that HIV-1Tat protein induced IL-10 and TNF-α by acting
at the cell membrane level, via its N-terminal 1-45 region. In this study, we determined for the
first time, the nature of Tat receptor implicated in this cytokine production. We demonstrated
that, when treated by anti-TNR4 antibodies, monocytes stimulated by Tat failed to produce
IL-10 and TNF-α cytokines. Moreover, TLR4 inhibition results on a significant diminution of
PKC-βII and -δ; MAP kinases ERK1/2 and p38; and the downstream NF-κB pathway
activation. The immunoprecipitation assays, performed by different fragment of Gst-Tat have
shown that only Gst-Tat 1-45 and 1-101, but not Gst-Tat 30-72 proteins, was able to interact
directly with TLR4. Our results suggest that TLR4 may be the potential Tat receptor
implicated in the activation of the signaling pathways involved in IL-10 and TNF-α
production by monocytes.
3
INTRODUCTION
HIV-1 infects primarily CD4+ T lymphocytes, monocytes/macrophages, and dendritic
cells (Clapham and McKnight, 2001). Before T cells depletion, HIV-1 infected patients
undergo a progressive decrease of the Th1 cellular immune response that results in an
increase of the Th2 humoral immune response mediated by IL-4, IL-6 and IL-10, inefficient
in virus control. In HIV-1 infected patients, peripheral blood mononuclear cells (PBMC)
produce large quantities of IL-10 in parallel to the alteration of CD4+ T cell proliferative
function (Clerici et al., 1994). In our previous studies, we have shown that HIV-1 Tat protein
by interacting with the cell membrane, induces IL-10 and TNF-α production by monocytes
(Badou et al., 2000; Bennasser et al., 2002; Bennasser and Bahraoui, 2002).
Tat is a regulatory protein of HIV-1, produced early after infection and is essential for
HIV-1 gene expression, replication, and infectivity (Wu and Marsh, 2003). In addition to its
role in HIV-1 transactivation, Tat is also released into the extracellular medium (Ensoli et al.,
1990) and is found in the sera of HIV-infected patients (Ensoli et al., 1993; Goldstein, 1996).
Extracellular Tat is taken up by neighbouring cells, and modulates viral and/or cellular
functions depending on the protein concentration, conformational state and cell type (Chang
et al., 1997; Ensoli et al., 1993; Frankel and Pabo, 1988). Several receptors were reported to
interact with different regions of Tat protein. For example, the N-terminal region interacts
with CD26 receptor, the cystein-rich region interacts with CCR2, CCR3 and CXCR4
chemokine receptors (Albini et al., 1998; Jeang, Xiao, and Rich, 1999), the tripeptide RGD
(arginine-glycine-aspartate) with dendritic cell integrins αvβ3 and α1β5, the basic region with
membrane lipids and the vascular endothelial growth factor receptor (Rubartelli et al., 1998)
and heparan sulphate proteoglycans (HSPG) (Chang et al., 1997; Marty et al., 2004; Tyagi et
al., 2001).
4
The N-terminal fragment Tat 1-45, which is deleted from the basic domain essential
for its internalization, is able to stimulate, like total native Tat protein, TNF-α and IL-10
production, in human monocytes/macrophages via PKC, MAP kinase ERK1/2 and NF-κB
pathways (Badou et al., 2000; Bennasser et al., 2002; Bennasser and Bahraoui, 2002). Thus,
the crucial question is to investigate the nature of cell membrane receptor, recruited by HIV1Tat protein, to activate the signaling pathways leading to TNF-α and IL-10 production.
We first, asked, what are the receptors described in the literature for their ability to
induce TNF-α and IL-10 production, by activating similar signaling pathways to those we
have already described for Tat. Accordingly, we investigate the eventual implication of TLR4
as potential receptor for the following reasons: i) TLR4 is largely expressed on
monocytes/macrophages; ii) It is used by LPS to induce IL-10 in monocytes; iii) Many viral
proteins, including the RSV (respiratory syncitial virus) fusion protein and G protein from
VSV (vesicular stomatite virus). This recognition plays an important role in the detection and
clearance of viral pathogens by the immune system (Barton, 2007). Finally, MMTV
glycoprotein induces IL-10 production by B lymphocytes via TLR4 (Rassa et al., 2002); iv)
TLR4 initiates a cascade of serine/threonine kinases, including MAPK (ERK1/2 and p38),
PKC and downsteam NF-κB pathways, resulting in leading to the transcription of genes
involved in inflammation (Barton and Medzhitov, 2003; Chow et al., 1999; Kubo-Murai et
al., 2007; Swantek et al., 2000; Yang et al., 1998).
The host immune response plays an essential role in the control of viral, parasites and
microbial components during the early phase of infection. These controls are mediated by
host immune receptors including NOD (nucleotide binding and oligonucleotide dimerization
domain) like receptor ( NLR), RIG-I-(retinoic acid inducible gene-I) and some CLR ( C-type
lectin receptor) which detect some conserved microbial motifs termed PAMP (pathogen
associated motif pattern) and stimulate in one hand an innate immune response (Interferon ,
5
natural killer cells, RLO, other cytokines and chemokines…) and on the other hand, the
adaptive immune response. However some viruses are able to manipulate these host immune
host receptors to be used as viral receptors for virus infection or to deregulate the immune
system (Stack et al., 2005; Zhou et al., 2008).
In the present work we show that HIV-1, by its Tat protein recruits TLR4 to stimulate
IL-10, a highly immunosuppressive cytokine. As consequence, the virus could escape
immune surveillance and induce the development of immunosuppressive states favourable for
opportunistic infections.
6
MATERIAL AND METHODS
Monocytes isolation and PBMC were isolated from the buffy coat of healthy HIV-negative
donors in a ficoll density gradient (Pharmacia). The PBMC were resuspended in complete
medium (60% AIMV and 30% Iscove [Gibco-BRL, Grand Island, NY]) containing penicillin
(100 IU/ml), streptomycin (100 µg/ml), and 10% fetal calf serum (FCS). PBMC were then
plated at a density of 106 cells/well in 12-well Primaria (Becton Dickinson) tissue culture
plates. After 5h or 24h of culture at 37°C in 5% CO2, non adherent cells were removed, and
the remaining cells were washed twice and then incubated with the different compounds
tested.
HEK 293 cell lines. Human embryonic kidney 293 T cell lines wild type are 293 cells that
express the SV40 large T antigen (this would allow episomal replication of plasmids that have
the SV40 Ori). YFP-TLR4 and YFP-TLR4-MD2 are 293 cells stably transfected with human
TLR4 and/or MD2 fused at the C terminus with yellow fluorescent protein. 293 Fc TLR4 are
cells stably secreting the TLR4-Fc chimeric constructs, generated by retroviral transduction of
HEK 293cells. The TLR4-Fc protein consisted of the entire extracellular domain of human
TLR4 (aa 1-632) fused in frame with the C-terminal 233 aa Fc portion of mouse IgG2a,
modified by addition of the linker sequence GAAGGG. The 293 YFP-TLR4, YFP-TLR4MD2 and TLR4-Fc are a kind gift from Dr. Alberto Visintin, National Institut of Health,
Bethesda, MD 20892-1360). Cell lines were maintained in complete medium (DMEM 10%
FCS, 100 µg/ml penicillin/streptomycin and 100µg/ml G418) at 37°C in a humidified 5%
CO2 incubator.
7
Proteins and constructs. Recombinant HIV-1 Tat 1-86 protein was obtained from ‘Agence
Nationale de la Recherche sur le SIDA’ (Paris, France). The level of endotoxin contamination
was assessed by using the Limilus amebocyte lysate assay (Bio-Sepra, villeneuve la Garenne,
France). Gst-Tat 1-101 or deleted mutants Gst-Tat 1-45 and Gst-Tat 30-72 were produced as
glutathione-S-transferase (Gst) fusion proteins in Escherichia coli, and purified as previously
described (Badou et al., 2000). As control, Gst was purified under the same conditions and in
the same experiments. All these constructions are LPS free (<0.3 EU/µg) and biologically
active, as described (Badou et al., 2000). In some experiments, gluthation bids were activated
by cyanogen bromide (CNBr), to make covalent protein ligation.
Isolation of cytoplasmic and nuclear protein extracts. Monocytes were pretreated with
anti-TLR4 (1 µg/ml), 60 min before incubation with Tat (10 nM) for an additional hour.
Monocytes were then lysed at 4°C in 200 µl of hypotonic buffer A (Hepes 10 mM pH 7.9,
KCl 10 mM, EDTA 0.1 mM, EGTA 0.1 mM, DTT 1 mM, PMSF 0.5 mM, Na3VO4 0.2 mM,
NaF 0.05 mM) for 15 min. Then 12.5 µl of Nonidet P40 10 % was added and the lysate was
strongly vortexed (20 s) before centrifugation (1 min; 15366 g; 4°C). The supernatant
corresponding to the cytoplasm was collected; the nucleus pellets were solubilized in 100 µl
of cold sample buffer B (HEPES 20 mM, pH 7.9, NaCl 0.4 M, EDTA 1 mM, EGTA 1 mM,
DTT 1 mM, PMSF 1 mM, Na3VO4 0.2 mM, NaF 0.05 mM), and strongly shaken for 15 min
at 4°C. After centrifugation, nuclear proteins were collected in the supernatant, quantified by
a Bradford assay and stored at - 20°C.
Isolation of cytoplasmic and membrane protein extracts
Monocytes were preatreated or not by anti-TLR4 (1 µg/ml) for 60 min. Following
treatment with Tat or PMA, monocytes were harvested and rapidly lysed at 4°C in 100 µl of
hypotonic buffer A (Tris HCl 200 mM, EDTA 2 mM, DTT 1 mM, leupeptin 10 µg/ml, PMSF
8
1 mM; pH 7.5) by repeated aspiration through a syringe fitted with a 21 gauge needle.
Following addition of 300 µl ice-cold sample buffer B (Tris HCl 20 mM, EDTA 2 mM, DTT
1 mM, leupeptin 10 µg/ml, PMSF 1 mM, sucrose 0.33 M; pH 7.5) the lysate was centrifuged
at 100 000 g at 4°C for 40 minutes. The supernatant, corresponding to the cytoplasmic
fraction, was collected and proteins were quantified using a Bradford assay and stored at -20
°C. The membrane pellets were solubilized in 50 µl of cold sample buffer B containing 1 %
Triton X-100, sonicated (1 minute, power 2.5) and stored at - 20°C.
Western blot analysis. Equal amounts of protein (10 - 40 µg) were subjected to 10% SDSPAGE and the separated proteins were transferred to a nitrocellulose membrane.
Immunoblotting was conducted with rabbit anti-p65 antibodies (Santa Cruz biothechnology),
or specific antibodies against total or phosphorylated ERK1/2 and p38 MAP kinases (cell
signalling). The membrane was blocked with 5 % low fat milk in Tris-buffered saline with
0.05 % Tween 20 (TTBS) for 1 h, washed with TTBS, and incubated with the primary
antibody overnight at 4°C. Immunoreactive bands were detected by incubation for 2 h with
swine anti-rabbit immunoglobulins conjugated with horseradish peroxidase (DAKO A/S,
Roskilde, Denmark). Proteins of interest were visualized using a chemiluminescent substrate
(Pierce, Rockford, IL).
Immunoprecipitation assay. Equal amounts of Gst, Gst-Tat 1-45, Gst-Tat 30-72 or Gst-Tat 1-101
proteins coupled to glutathione agarose bids were first saturated by salmon sperm DNA (200 µg/ml)
and BSA (500 µg/ml) 2 h at 4°C. After extensive washing by immunoprecipitation buffer (Tris 20 mM
PH 8.1, Nacl 200 mM, NP-40 0.5%, PMSF 0.5 mM, Leupeptine 10 µg/mL, Na3VO4 0.2 mM, NaF
0.05 mM), each fusion protein was incubated with total cellular extracts from HEK 293T cells or HEK
293-TLR4 cells (500 µg) or with soluble recombinant TLR4/MD2 (R & D system). Immune
9
complexes were washed extensively using and retained proteins were analyzed by western blot using
anti-TLR4 antibodies.
10
Results
IL-10 and TNF-α production is specifically induced by HIV-1 Tat protein in human
monocytes.
We have previously shown that HIV-1 Tat protein induces IL-10 and TNF-α
production by human monocytes (Badou et al., 2000). This effect is specifically induced by
Tat protein and not by an eventual contamination with endotoxins, as shown by the following
arguments. i) On one hand, monocytes were stimulated by increasing concentrations of
recombinant Tat (1-86), wild type synthetic Tat or acetylated (K50) synthetic Tat protein (Fig.
1). Synthetic Tat protein induces IL-10 and TNF-α production in dose dependent manner, but
failed when it was acetylated on lysine 50 (K50) (Fig. 1); ii) Anti-Tat antibodies blocked the
active effect of Tat (data not shown); iii) When Tat protein was previously treated by trypsin
(1 hour at 37°C) before incubation with monocytes, IL-10 and TNF-α-induced Tat production
was completely abolished after trypsin digestion or heat treatment (Fig. 2), suggesting that Tat
(1-86) was digested or denatured under these conditions. While such treatments had no effect
on the ability of LPS to produce these cytokines (Fig. 2). Also, oxidation of Tat protein by
H2O2, abolished totally its capacity to induce TNF-α and IL-10 production (data not shown).
TLR4 is implicated in IL-10 and TNF-α production induced by Tat in monocytes.
To investigate the role of TLR4 as potential receptor implicated in Tat-induced IL-10
and TNF-α production, monocytes were pre-treated with anti-TLR4 antibodies (1µg/ml) for
60 min before stimulation 24 h by LPS (0.1, 1 or 10 ng/ml) or with increasing concentrations
of Tat (1, 10 and 100 nM). As expected, the results showed that IL-10 and TNF-α production,
induced by LPS, is totally blocked under these conditions (Fig. 3A), confirming the
specificity of anti-TLR4 antibodies.
11
Similarly, when monocytes where stimulated with Tat, IL-10 and TNF-α production
was completely inhibited, in the presence of anti-TLR4 antibodies (Fig. 3A). This inhibition
was relatively diminished when Tat concentration was increased. Thus IL-10 and TNF-α
production was inhibited by 85.2% and 89.1% respectively, at 100 nM of Tat (Fig. 3A). These
finding suggest the important role of TLR4 in this pathway. As controls, TLR4 isotype (Fc
region of Ig) or anti-TLR2 antibodies has no effect on Tat induced activation (Fig. 3B).
Activation by PMA, a PKC activator witch have an intracellular action, was not affected by
the inhibition of TLR4 (Fig. 3A), suggesting that TLR4 specific antibody acts at the
membrane level, by interfering with Tat-TLR4 interaction, but do not disturb the downstream
signaling pathways.
TLR4 activation may require the accessory proteins, CD14 essential for LPS
signaling. It is interesting to note that while anti-CD14 antibodies inhibit totally IL-10
production induced by LPS, it has no effect on Tat-induced IL-10 production (Fig. 3B). This
later finding is of importance indicating that, in contrast to LPS, Tat signaling is CD14
independent.
Anti-TLR4 antibodies compete with Tat at the monocytes membrane level.
To investigate the affinity of Tat for TLR4 at the cell membrane, three complementary
approaches were used: dose-response, competition and kinetics studies (Fig. 4A). i) When
monocytes were previously treated by increasing amounts of anti-TLR4 (0.01 to 1 µg/ml) for
60 min before stimulation with Tat (10 nM) (Fig. 4A, dose-response panel), IL-10 production
was blocked in a dose dependent manner by (32.5% and 98%) at 0.01 and 1 µg/ml of antiTLR4 respectively. However, a strong inhibition of TNF-α production (92.3%) was observed
only at 1µg/ml of anti-TLR4.
12
ii) When Tat (10 nM) was added simultaneously with increasing concentrations of anti-TLR4
(0.01, 0.1 and 1 µg/ml) to the monocytes, we observed a strong competition between the two
molecules (Fig.4A, panel competition). Only a partial inhibition of IL-10 and TNF-α
production (51% and 70% respectively) was observed in the presence of highest concentration
of
anti-TLR4 (1 µg/ml) (Fig.4A, competition panel). iii) Finally, monocytes were pre-
incubated with Tat at various times (5, 10, 30 or 60 min), before adding anti-TLR4 (0.1 or 1
µg/ml) for 24 h (Fig. 4A, kinetic panel). The level of IL-10 inhibition decreased from 97%,
when cells were in contact with Tat 5 min before adding anti-TLR4 (0.1 µg/ml), to 31% of
inhibition only when Tat was incubated 60 min with monocytes before adding anti-TLR4
antibodies. Tat-induced-TNF-α and IL-10 production was significantly inhibited (88,6%) at
early time Tat preincubation (5 and 10 min) before addition of anti-TLR4 (1 µg/ml) (Fig. 4A,
kinetic panel, right). At 1 µg/ml , anti-TLR4 was unable to inhibit Tat-induced cytokines
production (Fig. 4A, kinetic panel, right).
In addition, when cells were washed after 60 min of anti-TLR4 pre-incubation, and
then Tat added for 24 h, we restored cytokines production by about 50% (Fig. 4B).
Together, these results suggested that Tat induced IL-10 and TNF-α production is
mediated after a direct or indirect Tat-TLR4 interaction on monocytes membrane.
The N-terminal region of Tat protein is implicated in the TLR4-dependent production of
IL-10 and TNF-α by monocytes.
We have previously shown that the N-terminal region 1-45 of Tat was able to induce
IL-10 and TNF-α production in human monocytes/macrophages (Badou et al., 2000;
Bennasser et al., 2002; Bennasser and Bahraoui, 2002). Here, we investigated whether this
region used TLR4, to signal in monocytes (Fig. 5). Monocytes were pre-treated or not with
13
anti-TLR4 (1 µg/ml), and then stimulated by the whole protein, Gst-Tat (1-101), N-terminal
region, Gst-Tat (1-45) lacking the basic region essential for its internalization, or Gst-Tat (3072) lacking the N-terminal region (Fig. 5A). As expected, Gst-Tat (1-101) and Gst-Tat (1-45)
induced IL-10 and TNF-α approximately at the same level. However, neither Gst-Tat (30-72)
nor Gst were able to induce cytokines production (Fig. 5B). This result, confirms that the
active domain of Tat protein is located at the N-terminal region (1-45). The pre-treatment with
anti-TLR4 strongly diminished IL-10 and TNF-α production induced by Gst-Tat (1-101). A
similar strong inhibition was obtained when monocytes were stimulated by Gst-Tat (1-45),
whereas no effect was observed with Gst-Tat (30-72) (Fig. 5B).
This result, suggest that Tat protein, by its N-terminal region 1-45, induces IL-10 and
TNF-α production via TLR4. Thus, we asked if Tat is able to interact and form stable
complex with TLR4.
The N-terminal region of Tat interacts with TLR4 and/or its MD2 co receptor.
To investigate the interaction between Tat and TLR4, two complementary coimmunoprecipitation approaches were performed, using glutathione-agarose beads previously
coupled to Gst-Tat 1-101, Gst-Tat 1-45, Gst-Tat 30-72 or Gst proteins (Fig. 6). Immobilized
proteins were first incubated with total protein extracts from HEK 293-YFP-TLR4 cell lines,
stably expressing TLR4 protein coupled to YFP (yellow fluorescent protein), at the cell
membrane. As controls, protein extracts from non transfected HEK 293T were tested. Stable
complexes between Tat and TLR4 were analyzed by SDS-PAGE and western blot using
specific anti-TLR4 antibodies (Fig. 6A). As expected, no TLR4 was detected in the presence
of non transfected HEK 293T protein extracts (Fig. 6A, down panel). However, we showed
that TLR4 was retained in the presence of Gst-Tat (1-45) and Gst-Tat (1-101) but not Gst-Tat
14
(30-72) or Gst alone. These results showed that Tat 1-101 and Tat 1-45, but not Tat 30-72, are
able to interact physically with TLR4.
To further characterize this interaction, we performed the same experiments by using
purified soluble TLR4 recombinant protein associated to MD2 coreceptor. The obtained
results showed that sTLR4/MD2 was able to interact with Gst-Tat (1-101) and Gst-Tat (1-45)
proteins, but not with Gst or Gst-Tat (30-72), non covalently immobilized on glutathione
agarose (Fig. 6B, left). Similar results were obtained when the same proteins were covalently
immobilized on cyanogens bromide (CNBr) sepharose beads (Fig. 6B, right). All together
these results indicate that Tat interacts physically with TLR4 and/or MD2, and activates
TLR4 pathway leading to IL-10 and TNF-α production.
TLR4 is implicated in the activation of Tat-induced signaling pathways.
We have already shown that Tat induces IL-10 and TNF-α production via NF-κB,
MAP kinases ERK1/2 (Badou et al., 2000; Leghmari et al., 2008). Thus we investigated
whether TLR4 is implicated in the activations of these signaling pathways in response to Tat
(Fig. 7). To this end, monocytes were pre-treated or not with anti-TLR4 (1 µg/ml) before
stimulation by Tat or LPS. As expected, in the absence of anti-TLR4 antibodies, NF-κB and
p38 and ERK1/2 MAP kinase pathways were clearly activated, as shown by the nuclear
translocation of NF-κB/p65 subunit, and the phosphorylation of p38 and ERK1/2 MAP
kinases (Fig. 7). In contrast, monocytes preincubation with anti-TLR4 antibodies blocked
totally the activation of these signaling pathways. These results are in agreement with our
previous data showing the implication of NF-κB and p38 and ERK1/2 MAP kinases in the
control of Tat-induced IL-10 and TNF-α production.
15
FIGURE LEGENDS
Figure 1. Tat induces specifically IL-10 and TNF-α production in human monocytes.
Monocytes were stimulated by increasing concentrations of Tat (1-86) (1, 10 or 100 nM) or
wild type and mutant synthetic Tat protein (10, 100, 500 nM). Culture supernatants were
recovered and the IL-10 and TNF-α were measured by ELISA. The results are expressed in
pg/ml. The values are representative of three independent experiments.
Figure 2. Tat-induced cytokines production is not du to endotoxins contamination.
Monocytes were stimulated by LPS 10 ng/ml or Tat 10 nM. To test the absence of endotoxin,
Tat protein was pre-incubated with trypsin 1µg/ml, for 1h at 37°C or inactivated by heating
30 min at 100°C, before monocytes stimulation. As positive control, LPS was also treated by
trypsin at 1h at 37°C. As negative control, monocytes were unstimulated or treated with
trypsin alone or with LPS or Tat incubated 1h at 37°C. Culture supernatants were recovered
and the IL-10 and TNF-α were measured by ELISA. The results are expressed in pg/ml. The
values are representative of three independent experiments.
Figure 3. TLR4 is implicated in Tat-induced IL-10 and TNF-α production.
A) Monocytes were pre-treated or not with anti-TLR4 antibodies (1µg/ml) for 60 min before
stimulation 24 h by LPS (0.1, 1 or 100 ng/ml) or increasing concentrations of Tat (1, 10 and
100 nM), or PMA (10 ng/ml). B) Monocytes were pre-treated or not with anti-TLR4, antiTLR4 isotype, anti-TLR2 or anti-CD14 antibodies (1µg/ml) for 60 min before stimulation 24
h with Tat (10 nM).Culture supernatants were recovered and the IL-10 and TNF-α were
measured by ELISA. The results are expressed in pg/ml. The values are representative of
three independent experiments.
Figure 4. Anti-TLR4 antibodies compete with Tat at the monocytes membrane level.
16
A) Dose-response panel: Monocytes were previously treated by increasing amounts of antiTLR4 for 60 min before stimulation with Tat. Competition panel: Tat (10 nM) was preincubated with anti-TLR4 at increasing concentrations (0.01, 0.1 and 1 µg/ml) before adding
to the monocytes. Kinetic panel: Monocytes were pre-incubated with Tat at various times (5,
10, 30 or 60 min), before adding anti-TLR4 (0.1 or 1 µg/ml) for 24 h. B) Monocytes were pretreated or not with anti-TLR4 antibodies (0.1 or 1µg/ml) for 60 min and then washed twice
before stimulation 24 h by Tat (10 nM). Culture supernatants were recovered and the IL-10
and TNF-α were measured by ELISA. The results are expressed in pg/ml. The values are
representative of three independent experiments.
Figure 5. The N-terminal region of Tat protein is implicated in the TLR4-dependent
production of IL-10 and TNF-α by monocytes.
A) Structure of wild-type GST-Tat 1-101 and mutants GST-Tat 1-45 or Gst-Tat 30-72. B)
Monocytes were pre-treated or not with anti-TLR4 (1 µg/ml), and then stimulated by the
whole protein, Gst-Tat (1-101), N-terminal region, Gst-Tat (1-45) lacking the basic region
essential for its internalization, or Gst-Tat (30-72) lacking the N-terminal region (at 10 nM for
24h). Culture supernatants were recovered and the IL-10 and TNF-α were measured by
ELISA. The results are expressed in pg/ml. The values are representative of three independent
experiments.
Figure 6. The N-terminal region of Tat interacts with TLR4 and/or its MD2 co receptor.
A) Gst-Tat (1-45) and Gst-Tat (1-101) or Gst-Tat (30-72) proteins were immobilized on
gluthation agarose column, and incubated with total protein extracts from HEK 293-YFPTLR4 cell lines, stably expressing TLR4 protein. As control, we used wild type HEK 293T
protein extracts B) immobilized Gluthation-Gst-Tat proteins or Gst-Tat covalently
immobilized on sepharose bids activated by cyanogens bromide were incubated soluble TLR4
17
recombinant protein associated to MD2 coreceptor (sTLR4/MD2). The immunoprécipitated
TLR4 was analysed by western blot using anti-TLR4 antibodies.
Figure 7. TLR4 is implicated in the activation of Tat-induced signaling pathways.
Monocytes were pre-treated or not with anti-TLR4 (1 µg/ml) before stimulation by Tat or
LPS for 30 min. Cytoplasmic and nuclear extracts were analyzed by western blot using
specific antibodies for ERK1/2 or phospho-ERK1/2, p38 or phospho-p38 and NF-κB/p65.
Cytoplasmic and nuclear fractions were normalized by total proteins or anti-TFIIB
respectively.
18
References
Albini, A., Ferrini, S., Benelli, R., Sforzini, S., Giunciuglio, D., Aluigi, M. G., Proudfoot, A. E.,
Alouani, S., Wells, T. N., Mariani, G., Rabin, R. L., Farber, J. M., and Noonan, D. M. (1998).
HIV-1 Tat protein mimicry of chemokines. Proc Natl Acad Sci U S A 95(22), 13153-8.
Badou, A., Bennasser, Y., Moreau, M., Leclerc, C., Benkirane, M., and Bahraoui, E. (2000). Tat
protein of human immunodeficiency virus type 1 induces interleukin-10 in human peripheral
blood monocytes: implication of protein kinase C-dependent pathway. J Virol 74(22), 1055162.
Barton, G. M. (2007). Viral recognition by Toll-like receptors. Semin Immunol 19(1), 33-40.
Barton, G. M., and Medzhitov, R. (2003). Toll-like receptor signaling pathways. Science 300(5625),
1524-5.
Bennasser, Y., Badou, A., Tkaczuk, J., and Bahraoui, E. (2002). Signaling pathways triggered by HIV1 Tat in human monocytes to induce TNF-alpha. Virology 303(1), 174-80.
Bennasser, Y., and Bahraoui, E. (2002). HIV-1 Tat protein induces interleukin-10 in human peripheral
blood monocytes: involvement of protein kinase C-betaII and -delta. Faseb J 16(6), 546-54.
Chang, H. C., Samaniego, F., Nair, B. C., Buonaguro, L., and Ensoli, B. (1997). HIV-1 Tat protein
exits from cells via a leaderless secretory pathway and binds to extracellular matrix-associated
heparan sulfate proteoglycans through its basic region. Aids 11(12), 1421-31.
Chow, J. C., Young, D. W., Golenbock, D. T., Christ, W. J., and Gusovsky, F. (1999). Toll-like
receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem 274(16),
10689-92.
Clapham, P. R., and McKnight, A. (2001). HIV-1 receptors and cell tropism. Br Med Bull 58, 43-59.
Clerici, M., Wynn, T. A., Berzofsky, J. A., Blatt, S. P., Hendrix, C. W., Sher, A., Coffman, R. L., and
Shearer, G. M. (1994). Role of interleukin-10 in T helper cell dysfunction in asymptomatic
individuals infected with the human immunodeficiency virus. J Clin Invest 93(2), 768-75.
Ensoli, B., Barillari, G., Salahuddin, S. Z., Gallo, R. C., and Wong-Staal, F. (1990). Tat protein of
HIV-1 stimulates growth of cells derived from Kaposi's sarcoma lesions of AIDS patients.
Nature 345(6270), 84-6.
Ensoli, B., Buonaguro, L., Barillari, G., Fiorelli, V., Gendelman, R., Morgan, R. A., Wingfield, P., and
Gallo, R. C. (1993). Release, uptake, and effects of extracellular human immunodeficiency
virus type 1 Tat protein on cell growth and viral transactivation. J Virol 67(1), 277-87.
Frankel, A. D., and Pabo, C. O. (1988). Cellular uptake of the tat protein from human
immunodeficiency virus. Cell 55(6), 1189-93.
Goldstein, G. (1996). HIV-1 Tat protein as a potential AIDS vaccine. Nat Med 2(9), 960-4.
Jeang, K. T., Xiao, H., and Rich, E. A. (1999). Multifaceted activities of the HIV-1 transactivator of
transcription, Tat. J Biol Chem 274(41), 28837-40.
Kubo-Murai, M., Hazeki, K., Sukenobu, N., Yoshikawa, K., Nigorikawa, K., Inoue, K., Yamamoto,
T., Matsumoto, M., Seya, T., Inoue, N., and Hazeki, O. (2007). Protein kinase Cdelta binds
TIRAP/Mal to participate in TLR signaling. Mol Immunol 44(9), 2257-64.
Leghmari, K., Bennasser, Y., Tkaczuk, J., and Bahraoui, E. (2008). HIV-1 Tat protein induces IL-10
production by an alternative TNF-alpha-independent pathway in monocytes: Role of PKCdelta and p38 MAP kinase. Cell Immunol.
Marty, C., Meylan, C., Schott, H., Ballmer-Hofer, K., and Schwendener, R. A. (2004). Enhanced
heparan sulfate proteoglycan-mediated uptake of cell-penetrating peptide-modified liposomes.
Cell Mol Life Sci 61(14), 1785-94.
Rassa, J. C., Meyers, J. L., Zhang, Y., Kudaravalli, R., and Ross, S. R. (2002). Murine retroviruses
activate B cells via interaction with toll-like receptor 4. Proc Natl Acad Sci U S A 99(4), 22816.
Rubartelli, A., Poggi, A., Sitia, R., and Zocchi, M. R. (1998). HIV-I Tat: a polypeptide for all seasons.
Immunol Today 19(12), 543-5.
19
Stack, J., Haga, I. R., Schroder, M., Bartlett, N. W., Maloney, G., Reading, P. C., Fitzgerald, K. A.,
Smith, G. L., and Bowie, A. G. (2005). Vaccinia virus protein A46R targets multiple Tolllike-interleukin-1 receptor adaptors and contributes to virulence. J Exp Med 201(6), 1007-18.
Swantek, J. L., Tsen, M. F., Cobb, M. H., and Thomas, J. A. (2000). IL-1 receptor-associated kinase
modulates host responsiveness to endotoxin. J Immunol 164(8), 4301-6.
Tyagi, M., Rusnati, M., Presta, M., and Giacca, M. (2001). Internalization of HIV-1 tat requires cell
surface heparan sulfate proteoglycans. J Biol Chem 276(5), 3254-61.
Wu, Y., and Marsh, J. W. (2003). Gene transcription in HIV infection. Microbes Infect 5(11), 1023-7.
Yang, R. B., Mark, M. R., Gray, A., Huang, A., Xie, M. H., Zhang, M., Goddard, A., Wood, W. I.,
Gurney, A. L., and Godowski, P. J. (1998). Toll-like receptor-2 mediates lipopolysaccharideinduced cellular signalling. Nature 395(6699), 284-8.
Zhou, S., Halle, A., Kurt-Jones, E. A., Cerny, A. M., Porpiglia, E., Rogers, M., Golenbock, D. T., and
Finberg, R. W. (2008). Lymphocytic Choriomeningitis Virus (LCMV) infection of CNS glial
cells results in TLR2-MyD88/Mal-dependent inflammatory responses. J Neuroimmunol
194(1-2), 70-82.
20
IL-10
TNF-α
-
1
10
Tat ((1-86))
100
10
100
500
Synthetic
y
Tat wt
Figure 1
10
100
500
Synthetic
y
Tat K50
(nM)
21
IL-10
TNF-α
-
LPS
37°C
Trypsin Tat (1-86)
LPS
37°C
Trypsin
Tat (1-86)
Figure 2
Heated
Trypsin
22
A
IL-10
TNF-α
anti-TLR4 (1µg/ml)
-
-
+
0.1
-
+
1
-
+
100
-
+
1
-
+
10
Tat (1-86) (nM)
LPS (ng/ml)
Figure 3
-
+
100
-
+
10
PMA (ng/ml)
23
B
‐
Tat (1-86)
Figure 3
24
IL-10
IL
10
TNF-α
A
-
Tat
Dose-response
Competition
0.01
0.01
0.1
1
anti-TLR4 (µg/ml)
60 min
+
Tat (1-86)
0.1
1
anti-TLR4 (µg/ml)
+
Tat (1-86)
Figure 4
Kinetic
5
10
30
60
Tat (1-86) (min)
+
anti-TLR4 (0.1 µg/ml)
5
10
30
60
Tat (1-86) (min)
+
anti-TLR4 (1 µg/ml)
25
B
anti-TLR4 (µg
(µg/ml))
Wach
Tat (1-86) (10 nM)
IL-10
TNF-α
-
+
0.1
+
Figure 4
0.1
+
+
1
+
1
+
+
26
A
B
anti-TLR4 (1µg/ml)
IL-10
TNF-α
-
-
+
Gst -Tat (1-45)
-
+
Gst -Tat (30-72)
Figure 5
-
+
Gst -Tat (1-101)
27
A
IP: α-Gst
WB anti-TLR4
WB:
ti TLR4
Gst-Tat
Extract
Gst
(30-72)
(1-45)
(1-101)
HEK 293T-TLR4 extracts
HEK 293T extracts
B
IP: α-Gst
WB: anti-TLR4
Gst-Tat
sTLR4
Gst
(1-45)
(1-101)
Gst-Tat (CNBr)
(30-72)
sTLR4/MD2
Figure 6
Gst
(1-45)
(1-101)
(30-72)
28
anti-TLR4
Unstimulated
cells
LPS (10 ng/ml)
Tat (10 nM)
-
-
+
+
p65
Nuclear fraction
TFIIB
Phospho-p38
Total p38
Cytoplasmic fraction
Phospho-ERK1/2
p
Total ERK1/2
Figure 7
170
171
DISCUSSION 172
Figure 57 : Conclusion et perspectives
173
Chez les patients infectés par le VIH-1, on observe dès le stade asymptomatique une
dérégulation du système immunitaire. En effet, au fur et à mesure de l’évolution vers le stade
SIDA, on observe une modification progressive du réseau de cytokines au profit d’une
réponse de type Th2, caractéristique d’une réponse humorale moins efficace dans la lutte
contre le virus. Ainsi, la production de l’IL-10, une cytokine immunosupressive, chez les
patients infectés participerait à l’affaiblissement du système immunitaire et par conséquent, à
la progression vers le stade SIDA. En effet, différents travaux semblent montrer une
association entre le taux d’IL-10 et l’évolution de la maladie. Une étude génétique s’est
interessé à l’effet de l mutation 592A/C au niveau du promoteur de l’IL-10, chez les patients
VIH-1, et la relation de ce polymorphysme avec l’évolution vers de SIDA. Les résultats de
cette étude montrent que les patients homozygotes 592C+/+ semblent évoluer moins
rapidement vers le stade SIDA. Alors que les patients portant l’allèle 592A homo ou
hétérozygotes, développent la maladie relativement plus rapidement (Kumarvelu et al., 2001;
Shin et al., 2000). Ces travaux sont aussi en accord avec ceux montrant une relation directe
entre la progression de la maladie et l’augmentation du taux d’IL-10 dans le sérum des
patients infectés (Stylianou et al., 1999). Cette production est significativement réduite chez
les patients bénéficiant d’une trithérapie, à l’exception des individus qui ne répondent pas au
traitement (Ostrowski et al., 2001; Stylianou et al., 1999).
L’un des candidats viraux responsables de cette dérégulation du réseau des cytokines
et notamment de la production de l’IL-10, est la protéine transactivatrice Tat du VIH-1 (Fig.
57). Les travaux précédents du laboratoire, ont permis de montrer que la protéine Tat du VIH1 via sa région N-terminale 1-45, induit la production de l’IL-10 et du TNF-α par les
monocytes humains, isolés à partir du sang périphérique en agissant au niveau membranaire
(Badou et al., 2000; Bennasser and Bahraoui, 2002).
Depuis sa découverte, la plupart des études réalisées sur la protéine Tat du VIH-1 se
sont focalisées sur sa fonction d’activation du LTR du génome viral. Cependant, à côté de son
rôle de transactivation, Tat exerce d’autres effets sur des gènes viraux et cellulaires. En effet,
la protéine Tat est retrouvée libre dans le sérum des patients infectés à des concentrations de
l’ordre de 1 à 4 nM (Westendorp et al., 1995a; Xiao et al., 2000). Cette concentration et
vraisemblablement sous estimée, si on prend en considération la capacité de Tat à s’adsorber à
de nombreux types de récepteurs cellulaires (héparan sulfates, intégrines, CXCR4, CD26 et
DHP récepteurs). En effet, Tat serait probablement plus abondante à proximité des sites de
réplication active du VIH-1. De plus, il a été démontré que de fortes concentrations de Tat
174
extracellulaire (100 nM-10 µM), ont un effet cytotoxique sur la prolifération des lymphocytes
T (Chirmule et al., 1995; McCloskey et al., 1997). En revanche, de faibles concentrations de
Tat (10 pM-1 nM), favorisent la prolifération de différents types cellulaires, incluant les
PBMC et les cellules Jurkat (Zauli et al., 1995). Dans notre étude, tous nos résultats, incluant
la sécrétion des cytokines et l’activation des différentes voies de signalisation au niveau des
monocytes, ont été obtenus avec 10 nM de Tat 1-86 recombinante. Cette concentration peut
être considéré comme proche des concentrations physiologiques et ne montre aucun effet
cytotoxique pour les cellules in vitro.
La structure tridimensionnelle de la protéine Tat native montre qu’elle ne possède pas
d’hélice α ni de feuillet β, ce qui fait d’elle une protéine très peu structurée. En revanche, elle
semble se structurer lorsqu’elle interagit avec ses ligands (Long and Crothers, 1999). De plus,
Tat ne possède pas de peptide signal pour être secrétée par la voie classique, ce qui a soulevé
plusieurs interrogations quant à son mode de sécrétion : sort-elle directement de la cellule ou
emprunte-t-elle quelques éléments de la voie d’exocets ? En revanche, le processus
d’internalisation de Tat a bien été détaillé (Vendeville et al., 2004). Tat entrerait dans les
lymphocytes T en utilisant essentiellement la voie d’endocytose via les vésicules de clathrine,
et peut être libérée dans le cytosol.
Par ailleurs, en agissant au niveau membranaire, la protéine Tat extracellulaire induit la
sécrétion de nombreuses cytokines, et l’expression de leurs récepteurs (Brigati et al., 2003).
Les travaux du laboratoire avaient montré que la protéine Tat, via sa région N-terminale 1-45
dépourvue du domaine basique essentiel à son internalisation, était capable d’induire la
sécrétion de l’IL-10 et du TNF-α dans le monocyte humain (Badou et al., 2000; Bennasser
and Bahraoui, 2002; Contreras et al., 2005).
L’analyse des voies de signalisation impliquées dans la production de l’IL-10 et du
TNF-α par Tat, avait montré que la protéine Tat induit l’augmentation du calcium
intracellulaire au niveau des monocytes (Bennasser et al., 2001). Ce signal est généré grâce
aux canaux calciques sensibles à la dihydropyridine (DHP récepteurs), en présence de calcium
extracellulaire (Contreras et al., 2005). En effet, en absence de calcium extracellulaire ou en
présence de nimodipine (un inhibiteur de DHP récepteurs), Tat n’est plus capable d’induire ce
signal. Cette mobilisation de calcium semble nécessaire à la production du TNF-α par le
monocyte humain stimulé par Tat mais pas à la production de l’IL-10 (Contreras et al., 2005).
175
Nos travaux ont montré que Tat induit la production de l’IL-10 et du TNF-α, dans le
monocyte humain, avec des cinétiques décalées. De plus, la stimulation des monocytes par du
TNF-α recombinant, induit la production de l’IL-10. Ces résultats suggèrent que suite à la
stimulation des monocytes/macrophages, Tat active tout d’abord la production du TNF-α, qui
à son tour, en se liant à son récepteur à la surface des cellules, permet d’induire la production
de l’IL-10. Nous avons donc cherché à savoir si Tat pourrait induire directement la production
de l’IL-10, indépendamment du TNF-α? Nos résultats montrent que lorsqu’on inhibe TNF-α
par des anticorps anti-TNF-α bloquants, ou en travaillant dans un milieu sans calcium, les
monocytes continuent à produire l’IL-10 suite à la stimulation par Tat (Leghmari et al., 2008).
De plus, la mesure du taux de TNF-α intracellulaire suite à la stimulation des monocytes par
Tat dans un milieu sans calcium, a montré une absence totale du TNF-α (Leghmari et al.,
2008). Ces résultats suggèrent que Tat active simultanément deux voies de signalisation : une
première voie dépendante du calcium extracellulaire qui permet l’induction de l’IL-10 viale
TNF-α, et une deuxième voie, activée en parallèle, qui induit directement la production de
l’IL-10 et de manière indépendante du TNF-α, comme le montre les expériences réalisées en
absence de calcium. Par ailleurs, il a été rapporté que Tat est également capable de mobiliser
le calcium intracellulaire dans le monocyte humain (Gee et al., 2007).
Cependant, nos
travaux ont montré que la préincubation des monocytes avec le BAPTA/AM, un chélateur
intracellulaire de calcium, ou la cyclosporine A, un inhibiteur de la calcineurine, n’a aucun
effet sur la production de l’IL-10 induite par Tat (Bennasser et al., 2001). Donc, bien que Tat
soit capable d’induire une hausse de calcium intracellulaire, ce dernier ne semble pas
impliqué dans la production de l’IL-10.
En tenant compte de la capacité de l’IL-10 à effectuer un rétro-contrôle négatif, inhibant
la production du TNF-α, nos résultats suggèrent un nouveau mécanisme, mis en place par le
VIH-1 via sa protéine Tat, afin de maintenir une production constante de la cytokine immunosuppressive : l’IL-10. Par conséquent, le VIH-1 échappe au contrôle immunitaire en évitant
une réaction inflammatoire (inhibition du TNF-α) et en installant un état immunitaire déprimé
via la production de l’IL-10, par une voie alternative qui est TNF-α-indépendante.
En plus de Tat, le signal calcium est largement activé par les protéines virales gp120 et
Nef, dans un grand nombre de types cellulaires. Ce signal est associé à differents aspects
physiopathologiques observés chez les patients VIH+, mais aussi à la réplication virale en
favorisant l’activation des lymphocytes T et les macrophages. En effets, au niveau du système
176
nerveux central (SNC), les protéines Tat et gp120 provoquent la dérégulation de
l’homéostasie calcique dans les neurones et favoriseraient leur apoptose, provoquant ainsi de
nombreux troubles neurologiques associés au SIDA (Haughey and Mattson, 2002). L’action
de Tat serait notamment médiée par les canaux calciques sensibles au N-méthyl D Aspartate
(NMDA) (Self et al., 2004). D’autres part, les protéines Tat et gp120, peuvent induire
l’augmentation du calcium intracellulaire dans les cellules épithéliales intestinales, qui serait
impliqué dans l’entéropathie observée chez certains patients VIH+ (Canani et al., 2003;
Clayton et al., 2001). Enfin, au niveau des lymphocytes et des macrophages, la gp120
interagit avec les CXCR4 et CCR5 induisant ainsi la mobilisation du calcium et par
conséquent la réplication virale dans ces cellules (Balabanian et al., 2004).
La voie PKC joue également un rôle important dans la cascade de signalisation
aboutissant à la production de l’IL-10 et du TNF-α suite à la stimulation des monocytes par
Tat. En effet, nos travaux avaient montré que parmi les 8 isoformes de PKC identifiées dans
les monocytes humains (Monick et al., 1998), 4 isoformes (PKC-α, -βII, -δ et -ε) sont
activées par Tat mais seules PKC-βII et -δ semblent impliquées dans la production de l’IL-10
(Badou et al., 2000; Bennasser and Bahraoui, 2002). La famille des PKC est divisée en trois
groupes distincts selon leur capacité à être activés par le calcium ou le DAG. La PKC-βII fait
partie du groupe classique, dont l’activation dépend du DAG et du calcium. Alors que la
PKC-δ fait partie du groupe non classique, dont l’activation dépend uniquement du DAG
mais pas du calcium (Ron and Kazanietz, 1999). Nos résultats montrent qu’en absence de
calcium, seule la PKC-δ est activée, néanmoins, Tat continue toujours de produire l’IL-10
dans les monocytes (Leghmari et al., 2008). Ces résultats sont en accord avec ceux de
Bennasser et al., qui montrent que seule l’inhibition simultanée des PKC-βII et -δ à l’aide
d’inhibiteurs chimiques ou d’oligonucléotides antisens, abolit totalement la production de
l’IL-10 (Bennasser and Bahraoui, 2002). Le rôle de l’activation des isoformes de PKC-ε et -α
dans le monocyte reste donc à déterminer. En revanche, bien qu’elles soient les seules
isoformes activées par Tat dans le macrophage, ni PKC-βII ni PKC-δ ne semblent impliquées
dans le contrôle de la production du TNF-α dans le macrophage. Sachant que l’inhibition de
la voie PKC par le RO 31, inhibiteur des PKC totaux, abolit totalement la production du TNFα induite par Tat (Leghmari et al., 2008, article 2), il semblerait que d’autres isoformes non
analysées soient à l’origine de cette production de TNF-α dans le macrophage.
177
Ces résultats doivent être confirmés davantage en utilisant des approches plus
spécifiques, et notamment les siRNA, pour nous permettre d’identifier avec certitude le ou les
isofomes de PKC impliquée(s) dans la production de l’IL-10 et du TNF-α, dans le
monocyte/macrophage humain. En plus de l’intérêt fondamental, la détermination des
isoforms de PKC impliquées dans ce mécanisme infectieux, peut avoir des applications
thérapeutiques ciblées. En effet, bien que les PKC soient très largement distribuées dans les
cellules de l’organisme et jouent un rôle central dans les processus de signalisation cellulaire,
l’inhibition spécifique d’une isoformes donnée, par des oligonucléotides antisens, avait déjà
fait l’objet de certains essais thérapeutiques notamment dans le traitement de cancers (Mani et
al., 2002; Tolcher et al., 2002).
En aval des PKC, Tat active les MAP kinases ERK1/2 et p38, pour induire la
production de l’IL-10 par les monocytes primaires humains (Badou et al., 2000; Bennasser et
al., 2002; Gee et al., 2007; Li and Lau, 2007; Li et al., 2005). En plus de son rôle dans la
production des cytokines, l’activation de la voie MAP kinases par Tat, peut également avoir
des effets directs sur la réplication virale et la déplétion des cellules T CD4+. En effet,
l’inhibition spécifique des MAP kinases p38, diminue significativement la production des
particules virales (Cohen et al., 1997a; Muthumani et al., 2004). Les isoformes p38α, p38γ et
p38δ semblent impliquées dans la réplication virale via le facteur NF-κB qui contribue à
l’activation du LTR (Asin et al., 2001). De plus ces trois isoformes sont responsables de
l’induction de l’apoptose des cellules voisines infectées ou non (Gutierrez-Sanmartin et al.,
2008). La voie p38 MAP kinase active également le facteur de transcription AP-1 pour
stimuler l’expression du FasL et induire l’apoptose des cellules infectées en présence de la
protéine Nef du VIH-1 (Muthumani et al., 2005a). Il serait intéressant de chercher si la
protéine Tat utilise le même mécanisme pour induire l’apoptose des cellules T. De manière
similaire, les MAP kinases ERK1/2 semblent également activer la réplication virale en
induisant la transactivation du LTR, suite à l’activation des CCR5 (Paruch et al., 2007). De
plus l’activation préalable de la voie de signalisation Raf/MEK/ERK s’accompagne d’une
augmentation du pouvoir infectieux du VIH alors que son inhibition conduit à la diminution
du titre viral (Yang, Chen, and Gabuzda, 1999). Ce mécanisme est exploité par d’autres virus
tels que le virus de l’influenza (Pleschka et al., 2001) et le virus neurotropique BDV « borna
disease virus » (Planz, Pleschka, and Ludwig, 2001).
178
Les voies de signalisation PKC et MAP kinases ERK1/2 et p38 convergent toutes vers
l’activation des facteurs de transcription tels que NF-κB. Le promoteur du gène de l’IL-10
contient neuf sites de fixation NF-κB (Eskdale et al., 1997). Cependant, jusqu’à présent, il
n’existait aucune évidence directe qui supporte le rôle de NF-κB dans le contrôle de la
transcription du gène IL-10, bien que son rôle dans la régulation des cytokines proinflammatoires soit largement établi (Ghosh, May, and Kopp, 1998). Les travaux précédents
avaient montré que la stimulation des monocytes humains par Tat, induit l’activation de NFκB en corrélation avec la production de l’IL-10 (Badou et al., 2000). Au cours de cette thèse,
nous avons montré que la protéine Tat du VIH induit l’activation de NF-κB, matérialisée par
la translocation de ses sous unités du cytoplasme vers le noyau, et leur liaison physique au
promoteur du gène de l’IL-10 par la technique du ChIP.
Trois voies distinctes, mettant en jeu différentes kinases, conduisent à l’activation de
NF-κB, dont deux principales. La première voie, dite classique, est activée par des cytokines
pro-inflammatoires telles que le TNF-α. Elle conduit au recrutement du signalosome, complet
constitué essentiellement des kinases IKKα, β et γ et la translocation du dimère p50/p65 dans
le noyau. La seconde voie, dite alternative, est activée par des ligands tels que la
lymphotoxine B, le CD40 ou des virus tels que le HTLV-1 « Human T Cell leukemia virus I »
ou l’EBV « Epstein-Barr virus » (Viatour et al., 2005). Elle est NIK et IKKα dépendante et
aboutit à la translocation de l’hétérodimère p52/RelB dans le noyau (Viatour et al., 2005).
Dans cette étude, nous avons montré que Tat active à la fois, la voie classique et
alternative de NF-κB, en agissant au niveau membranaire. En effet, l’invalidation de la kinase
NIK (voie alternative) ou des kinases IKKα et IKKβ (voie classique) inhibe fortement la
transctivation de NF-κB induite par Tat dans la lignée promonocytaire U937 (Leghmari, et al,
2008, article 3). Cette conclusion est en accord avec les résultats de l’analyse de l’immunoprécipitation de la chromatine qui mettent en évidence la liaison des sous unités p50 et p52,
appartenant respectivement à la voie classique et alternative, au niveau du promoteur du gène
IL-10 suite à la stimulation des monocytes par Tat.
Ces deux voies peuvent être activées simultanément, par deux récepteurs différents et
conduire à des fonctions régulatrices distinctes (Bonizzi and Karin, 2004; Hayden and Ghosh,
2004; Silverman and Maniatis, 2001). Cependant, l’activation de la voie classique et
alternative par le même ligand a déjà été décrite pour le CD70 (Ramakrishnan, Wang, and
Wallach, 2004). Les auteurs avaient proposé un modèle dans lequel, en se liant à son
récepteur CD27, le CD70 recrute la kinase NIK ainsi que le signalosome entier constitué
179
d’IKKα, IKKβ et IKKγ. Cette étape conduit à l’activation du facteur de transcription NF-κB
(p65/p50) et sa translocation vers le noyau. Le complexe NIK /signalosome va ensuite se
dissocier, et seules NIK et IKKα resteront liées pour initier la voie alternative, et induire la
translocation du facteur NF-κB (p52/RelB). Un mécanisme similaire pourrait être activé par
Tat afin d’activer simultanément les voies classique et altérnative, et par conséquent de
prolonger l’activation du promoteur du gène IL-10 NF-κB dépendante.
La kinase IKKα semble jouer un rôle essentiellement cytoplasmique dans l’activation
de NF-κB. En 2003, deux équipes avaient mis en évidence un nouveau mécanisme de
régulation de NF-κB impliquant un rôle nucléaire d’IKKα. En effet, suite au traitement des
fibroblastes embryonnaires de souris (MEF) par les cytokines tel que le TNF-α, IKKα subit
une translocation et une accumulation dans le noyau où elle jouerait un rôle important dans la
régulation de l’expression des gènes NF-κB dépendant, tels que les gènes d’IκBα, d’IL-6 et
d’IL-8 (Anest et al., 2003; Yamamoto et al., 2003c).
Nous nous sommes posé la question si Tat pouvait aussi activer ce même mécanisme
pour la régulation du gène IL-10. Ainsi, nous avons montré que Tat est aussi capable
d’induire la translocation d’IKKα du cytoplasme vers le noyau. Cette translocation, est
complètement bloquée lorsqu’on inhibe la voie PKC, alors que les MAP kinases ERK1/2 et
p38 ne semblent que partiellement impliquées. Des expériences de ChIP réalisées sur le
promoteur du gène IL-10, ont montré le recrutement d’IKKα au promoteur de l’IL-10, la
phosphorylation (Ser10) et l’acétylation (Lys14) des histones H3, en accord avec ce qui a été
décrit par Anest et al. De plus, la formation de ces complexes au niveau du promoteur de l’IL10, dépendrait des voies PKC et MAP kinases activées par Tat. Ces résultats soulignent un
nouveau mécanisme cellulaire, exploité par la protéine Tat du VIH afin d’optimiser la
production de l’IL-10 et maintenir un état immunodéprimé chez l’hôte.
Au vu des différentes voies de signalisation, activées suite à l’interaction membranaire
de Tat, pour induire la sécrétion d’IL-10 et du TNF-α, par les monocytes/macrophages
humains, une question s’impose: quel est le récepteur membranaire utilisé par Tat pour cet
effet ?
L’un des candidats potentiels serait le TLR4. En effet, certains TLR, dont le TLR4, sont
exprimés à la surface des monocytes et sont utilisés par de nombreux agents pathogènes
bactériens et viraux. La reconnaissance de ces ligands par le TLR4 joue un rôle important
180
dans la détection et l’élimination de ces virus par le système immunitaire (Barton, 2007),
mais dans certains cas elle contribue à l’échappement au contrôle immunitaire. Ainsi en
interagissant avec le TLR4, le rétrovirus murin MMTV « Mouse Mammary Tumor Virus »
conduit indirectement à la sécrétion d’IL-10 par les cellules B, diminuant la réponse antivirale
(Boehme and Compton, 2004). Le virus de la rougeole interagit avec le TLR4 pour inhiber la
synthèse d’IL-2, cytokine activatrice de l’immunité cellulaire ou avec le TLR2 pour induire
l’expression de son propre récepteur le CD150 à la surface des monocytes (Barton, 2007).
Enfin, le LCMV « lymphocytic choriomeningitis virus » active les cellules gliales et la
production d’IL-6 et TNF-α par le TLR2 ce qui contribue à la dissémination du virus (Zhou
et al., 2008).
Nos résultats montrent que l’inhibition du récepteur TLR4 par des anticorps bloquants
spécifiques inhibe totalement la sécrétion de l’IL-10 et du TNF-α induite par Tat dans le
monocyte humain. Les expériences d’immunoprécipitation ont montré une interaction entre la
région N-terminale (1-45) de Tat et le TLR4. Cependant, ces expériences ont été réalisées à
l’aide d’une protéine TLR4 soluble associée à la protéine adaptatrice MD2. Il serait
intéressant de savoir si Tat interagit directement avec le TLR4 ou si le MD2 servirait de
molécules chaperonne permettant son rapprochement et sa reconnaissance par le TLR4. En
plus du MD2 une autre molécule adaptatrice, CD14, exprimée préférentiellement à la surface
des macrophages et certaines sous populations de cellules dendritiques, et qui joue un rôle
important dans la signalisation LPS (da Silva Correia et al., 2001; Jiang et al., 2000) sera aussi
évaluée pour son éventuelle implication dans l’interaction Tat-TLR4.
Dans la suite de ce travail, les voies de signalisation recrutées suite à l’interaction TatTLR4 seront étudiées au niveau moléculaire et cellulaire afin de comprendre si l’activation
par Tat est MyD88 dépendante ou indépendante ? Quel est le rôle de la voie PKC ? Et
quelles sont les autres cytokines activées suite à l’interaction Tat-TLR4 ?
L’ensemble de nos résultats suggère que la protéine Tat du VIH-1 utiliserait le
récepteur TLR4 à la surface des monocytes humains, et induirait toute une cascade de
signalisation, commençant par l’activation de la voie calcique, les PKC-βII et -δ, les MAP
kinases ERK1/2 et p38 aboutissant à l’activation des voies NF-κB classique et alternative. En
parallèle, Tat agirait également sur le remodelage de la chromatine, en stimulant la
translocation nucléaire d’IKKα, ce qui permettrait de faciliter la fixation des facteurs de
transcription au niveau du promoteur du gène de l’IL-10.
181
En plus de son rôle essentiel dans la transactivation, Tat agit aussi comme un facteur
de pathogénicité virale, essentiellement en affaiblissant le système immunitaire et en le
détournant à son profit. Privilégier Tat comme cible thérapeutique, est une piste prometteuse,
quand on sait qu’une réponse anticorps et/ou cellulaire anti-Tat est associée au contrôle de la
réplication virale comme cela semble être le cas chez les patients non progresseurs.
Cependant, le développement de compositions vaccinales contenant Tat, doivent tenir compte
de sa pathogénicité afin d’arriver à développer des immunogènes de Tat non toxiques.
182
BIBLIOGRAPHIE 183
Abernethy, D. R., and Soldatov, N. M. (2002). Structure-functional diversity of human L-type
Ca2+ channel: perspectives for new pharmacological targets. J Pharmacol Exp Ther
300(3), 724-8.
Adachi, O., Kawai, T., Takeda, K., Matsumoto, M., Tsutsui, H., Sakagami, M., Nakanishi, K.,
and Akira, S. (1998). Targeted disruption of the MyD88 gene results in loss of IL-1and IL-18-mediated function. Immunity 9(1), 143-50.
Addo, M. M., Altfeld, M., Rosenberg, E. S., Eldridge, R. L., Philips, M. N., Habeeb, K.,
Khatri, A., Brander, C., Robbins, G. K., Mazzara, G. P., Goulder, P. J., and Walker, B.
D. (2001). The HIV-1 regulatory proteins Tat and Rev are frequently targeted by
cytotoxic T lymphocytes derived from HIV-1-infected individuals. Proc Natl Acad Sci
U S A 98(4), 1781-6.
Adle-Biassette, H., Chretien, F., Wingertsmann, L., Hery, C., Ereau, T., Scaravilli, F.,
Tardieu, M., and Gray, F. (1999). Neuronal apoptosis does not correlate with dementia
in HIV infection but is related to microglial activation and axonal damage.
Neuropathol Appl Neurobiol 25(2), 123-33.
Agbottah, E., Deng, L., Dannenberg, L. O., Pumfery, A., and Kashanchi, F. (2006). Effect of
SWI/SNF chromatin remodeling complex on HIV-1 Tat activated transcription.
Retrovirology 3, 48.
Aggarwal, B. B. (1991). Structure of tumor necrosis factor and its receptor. Biotherapy 3(2),
113-20.
Ahmad-Nejad, P., Hacker, H., Rutz, M., Bauer, S., Vabulas, R. M., and Wagner, H. (2002).
Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct
cellular compartments. Eur J Immunol 32(7), 1958-68.
Ahmad, R., Sindhu, S. T., Toma, E., Morisset, R., and Ahmad, A. (2003). Studies on the
production of IL-15 in HIV-infected/AIDS patients. J Clin Immunol 23(2), 81-90.
Akashi, S., Nagai, Y., Ogata, H., Oikawa, M., Fukase, K., Kusumoto, S., Kawasaki, K.,
Nishijima, M., Hayashi, S., Kimoto, M., and Miyake, K. (2001). Human MD-2
confers on mouse Toll-like receptor 4 species-specific lipopolysaccharide recognition.
Int Immunol 13(12), 1595-9.
Akashi, S., Shimazu, R., Ogata, H., Nagai, Y., Takeda, K., Kimoto, M., and Miyake, K.
(2000). Cutting edge: cell surface expression and lipopolysaccharide signaling via the
toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages. J Immunol
164(7), 3471-5.
Akira, S., Takeda, K., and Kaisho, T. (2001). Toll-like receptors: critical proteins linking
innate and acquired immunity. Nat Immunol 2(8), 675-80.
Akridge, R. E., Oyafuso, L. K., and Reed, S. G. (1994). IL-10 is induced during HIV-1
infection and is capable of decreasing viral replication in human macrophages. J
Immunol 153(12), 5782-9.
Alber, G., Al-Robaiy, S., Kleinschek, M., Knauer, J., Krumbholz, P., Richter, J.,
Schoeneberger, S., Schuetze, N., Schulz, S., Toepfer, K., Voigtlaender, R., Lehmann,
J., and Mueller, U. (2006). Induction of immunity and inflammation by interleukin-12
family members. Ernst Schering Res Found Workshop(56), 107-27.
Albini, A., Barillari, G., Benelli, R., Gallo, R. C., and Ensoli, B. (1995). Angiogenic
properties of human immunodeficiency virus type 1 Tat protein. Proc Natl Acad Sci U
S A 92(11), 4838-42.
Albini, A., Ferrini, S., Benelli, R., Sforzini, S., Giunciuglio, D., Aluigi, M. G., Proudfoot, A.
E., Alouani, S., Wells, T. N., Mariani, G., Rabin, R. L., Farber, J. M., and Noonan, D.
M. (1998). HIV-1 Tat protein mimicry of chemokines. Proc Natl Acad Sci U S A
95(22), 13153-8.
184
Albini, A., Marchisone, C., Del Grosso, F., Benelli, R., Masiello, L., Tacchetti, C., Bono, M.,
Ferrantini, M., Rozera, C., Truini, M., Belardelli, F., Santi, L., and Noonan, D. M.
(2000). Inhibition of angiogenesis and vascular tumor growth by interferon-producing
cells: A gene therapy approach. Am J Pathol 156(4), 1381-93.
Albini, A., Soldi, R., Giunciuglio, D., Giraudo, E., Benelli, R., Primo, L., Noonan, D., Salio,
M., Camussi, G., Rockl, W., and Bussolino, F. (1996). The angiogenesis induced by
HIV-1 tat protein is mediated by the Flk-1/KDR receptor on vascular endothelial cells.
Nat Med 2(12), 1371-5.
Alexopoulou, L., Holt, A. C., Medzhitov, R., and Flavell, R. A. (2001). Recognition of
double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature
413(6857), 732-8.
Alfadhli, A., Dhenub, T. C., Still, A., and Barklis, E. (2005). Analysis of human
immunodeficiency virus type 1 Gag dimerization-induced assembly. J Virol 79(23),
14498-506.
Alfano, M., and Poli, G. (2002). The cytokine network in HIV infection. Curr Mol Med 2(8),
677-89.
Allen, T. M., Mortara, L., Mothe, B. R., Liebl, M., Jing, P., Calore, B., Piekarczyk, M.,
Ruddersdorf, R., O'Connor, D. H., Wang, X., Wang, C., Allison, D. B., Altman, J. D.,
Sette, A., Desrosiers, R. C., Sutter, G., and Watkins, D. I. (2002). Tat-vaccinated
macaques do not control simian immunodeficiency virus SIVmac239 replication. J
Virol 76(8), 4108-12.
Allen, T. M., O'Connor, D. H., Jing, P., Dzuris, J. L., Mothe, B. R., Vogel, T. U., Dunphy, E.,
Liebl, M. E., Emerson, C., Wilson, N., Kunstman, K. J., Wang, X., Allison, D. B.,
Hughes, A. L., Desrosiers, R. C., Altman, J. D., Wolinsky, S. M., Sette, A., and
Watkins, D. I. (2000). Tat-specific cytotoxic T lymphocytes select for SIV escape
variants during resolution of primary viraemia. Nature 407(6802), 386-90.
Amir, R. E., Haecker, H., Karin, M., and Ciechanover, A. (2004). Mechanism of processing
of the NF-kappa B2 p100 precursor: identification of the specific polyubiquitin chainanchoring lysine residue and analysis of the role of NEDD8-modification on the
SCF(beta-TrCP) ubiquitin ligase. Oncogene 23(14), 2540-7.
Ammosova, T., Berro, R., Kashanchi, F., and Nekhai, S. (2005). RNA interference directed to
CDK2 inhibits HIV-1 transcription. Virology 341(2), 171-8.
Ancuta, P., Bakri, Y., Chomont, N., Hocini, H., Gabuzda, D., and Haeffner-Cavaillon, N.
(2001). Opposite effects of IL-10 on the ability of dendritic cells and macrophages to
replicate primary CXCR4-dependent HIV-1 strains. J Immunol 166(6), 4244-53.
Andrejeva, J., Childs, K. S., Young, D. F., Carlos, T. S., Stock, N., Goodbourn, S., and
Randall, R. E. (2004). The V proteins of paramyxoviruses bind the IFN-inducible
RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proc Natl
Acad Sci U S A 101(49), 17264-9.
Aneiros, E., Philipp, S., Lis, A., Freichel, M., and Cavalie, A. (2005). Modulation of Ca2+
signaling by Na+/Ca2+ exchangers in mast cells. J Immunol 174(1), 119-30.
Anest, V., Hanson, J. L., Cogswell, P. C., Steinbrecher, K. A., Strahl, B. D., and Baldwin, A.
S. (2003). A nucleosomal function for IkappaB kinase-alpha in NF-kappaB-dependent
gene expression. Nature 423(6940), 659-63.
Argyris, E. G., Acheampong, E., Nunnari, G., Mukhtar, M., Williams, K. J., and Pomerantz,
R. J. (2003). Human immunodeficiency virus type 1 enters primary human brain
microvascular endothelial cells by a mechanism involving cell surface proteoglycans
independent of lipid rafts. J Virol 77(22), 12140-51.
Argyris, E. G., Kulkosky, J., Meyer, M. E., Xu, Y., Mukhtar, M., Pomerantz, R. J., and
Williams, K. J. (2004). The perlecan heparan sulfate proteoglycan mediates cellular
185
uptake of HIV-1 Tat through a pathway responsible for biological activity. Virology
330(2), 481-6.
Arhel, N., Munier, S., Souque, P., Mollier, K., and Charneau, P. (2006). Nuclear import
defect of human immunodeficiency virus type 1 DNA flap mutants is not dependent
on the viral strain or target cell type. J Virol 80(20), 10262-9.
Arhel, N. J., Souquere-Besse, S., Munier, S., Souque, P., Guadagnini, S., Rutherford, S.,
Prevost, M. C., Allen, T. D., and Charneau, P. (2007). HIV-1 DNA Flap formation
promotes uncoating of the pre-integration complex at the nuclear pore. Embo J 26(12),
3025-37.
Asadullah, K., Sterry, W., and Volk, H. D. (2003). Interleukin-10 therapy--review of a new
approach. Pharmacol Rev 55(2), 241-69.
Ashkenazi, A., and Dixit, V. M. (1998). Death receptors: signaling and modulation. Science
281(5381), 1305-8.
Ashkenazi, A., and Dixit, V. M. (1999). Apoptosis control by death and decoy receptors. Curr
Opin Cell Biol 11(2), 255-60.
Asin, S., Bren, G. D., Carmona, E. M., Solan, N. J., and Paya, C. V. (2001). NF-kappaB cisacting motifs of the human immunodeficiency virus (HIV) long terminal repeat
regulate HIV transcription in human macrophages. J Virol 75(23), 11408-16.
Baba, M., Okamoto, M., Kawamura, M., Makino, M., Higashida, T., Takashi, T., Kimura, Y.,
Ikeuchi, T., Tetsuka, T., and Okamoto, T. (1998). Inhibition of human
immunodeficiency virus type 1 replication and cytokine production by fluoroquinoline
derivatives. Mol Pharmacol 53(6), 1097-103.
Bacher, N., Zisman, Y., Berent, E., and Livneh, E. (1991). Isolation and characterization of
PKC-L, a new member of the protein kinase C-related gene family specifically
expressed in lung, skin, and heart. Mol Cell Biol 11(1), 126-33.
Badley, A. D., Dockrell, D., Simpson, M., Schut, R., Lynch, D. H., Leibson, P., and Paya, C.
V. (1997). Macrophage-dependent apoptosis of CD4+ T lymphocytes from HIVinfected individuals is mediated by FasL and tumor necrosis factor. J Exp Med 185(1),
55-64.
Badley, A. D., McElhinny, J. A., Leibson, P. J., Lynch, D. H., Alderson, M. R., and Paya, C.
V. (1996). Upregulation of Fas ligand expression by human immunodeficiency virus
in human macrophages mediates apoptosis of uninfected T lymphocytes. J Virol
70(1), 199-206.
Badou, A., Bennasser, Y., Moreau, M., Leclerc, C., Benkirane, M., and Bahraoui, E. (2000).
Tat protein of human immunodeficiency virus type 1 induces interleukin-10 in human
peripheral blood monocytes: implication of protein kinase C-dependent pathway. J
Virol 74(22), 10551-62.
Baeuerle, P. A., and Baltimore, D. (1996). NF-kappa B: ten years after. Cell 87(1), 13-20.
Baggiolini, M., Dewald, B., and Moser, B. (1994). Interleukin-8 and related chemotactic
cytokines--CXC and CC chemokines. Adv Immunol 55, 97-179.
Bagrodia, S., Derijard, B., Davis, R. J., and Cerione, R. A. (1995). Cdc42 and PAK-mediated
signaling leads to Jun kinase and p38 mitogen-activated protein kinase activation. J
Biol Chem 270(47), 27995-8.
Balabanian, K., Harriague, J., Decrion, C., Lagane, B., Shorte, S., Baleux, F., Virelizier, J. L.,
Arenzana-Seisdedos, F., and Chakrabarti, L. A. (2004). CXCR4-tropic HIV-1
envelope glycoprotein functions as a viral chemokine in unstimulated primary CD4+
T lymphocytes. J Immunol 173(12), 7150-60.
Baldwin, R. L., Stolowitz, M. L., Hood, L., and Wisnieski, B. J. (1996). Structural changes of
tumor necrosis factor alpha associated with membrane insertion and channel
formation. Proc Natl Acad Sci U S A 93(3), 1021-6.
186
Baltimore, D. (1970). RNA-dependent DNA polymerase in virions of RNA tumour viruses.
Nature 226(5252), 1209-11.
Banci, L., Cavallaro, G., Kheifets, V., and Mochly-Rosen, D. (2002). Molecular dynamics
characterization of the C2 domain of protein kinase Cbeta. J Biol Chem 277(15),
12988-97.
Bannwarth, S., and Gatignol, A. (2005). HIV-1 TAR RNA: the target of molecular
interactions between the virus and its host. Curr HIV Res 3(1), 61-71.
Barcova, M., Kacani, L., Speth, C., and Dierich, M. P. (1998). gp41 envelope protein of
human immunodeficiency virus induces interleukin (IL)-10 in monocytes, but not in
B, T, or NK cells, leading to reduced IL-2 and interferon-gamma production. J Infect
Dis 177(4), 905-13.
Bardy, M., Gay, B., Pebernard, S., Chazal, N., Courcoul, M., Vigne, R., Decroly, E., and
Boulanger, P. (2001). Interaction of human immunodeficiency virus type 1 Vif with
Gag and Gag-Pol precursors: co-encapsidation and interference with viral proteasemediated Gag processing. J Gen Virol 82(Pt 11), 2719-33.
Barillari, G., and Ensoli, B. (2002). Angiogenic effects of extracellular human
immunodeficiency virus type 1 Tat protein and its role in the pathogenesis of AIDSassociated Kaposi's sarcoma. Clin Microbiol Rev 15(2), 310-26.
Barillari, G., Sgadari, C., Fiorelli, V., Samaniego, F., Colombini, S., Manzari, V., Modesti,
A., Nair, B. C., Cafaro, A., Sturzl, M., and Ensoli, B. (1999a). The Tat protein of
human immunodeficiency virus type-1 promotes vascular cell growth and locomotion
by engaging the alpha5beta1 and alphavbeta3 integrins and by mobilizing sequestered
basic fibroblast growth factor. Blood 94(2), 663-72.
Barillari, G., Sgadari, C., Palladino, C., Gendelman, R., Caputo, A., Morris, C. B., Nair, B. C.,
Markham, P., Nel, A., Sturzl, M., and Ensoli, B. (1999b). Inflammatory cytokines
synergize with the HIV-1 Tat protein to promote angiogenesis and Kaposi's sarcoma
via induction of basic fibroblast growth factor and the alpha v beta 3 integrin. J
Immunol 163(4), 1929-35.
Barratt, M. J., Hazzalin, C. A., Cano, E., and Mahadevan, L. C. (1994). Mitogen-stimulated
phosphorylation of histone H3 is targeted to a small hyperacetylation-sensitive
fraction. Proc Natl Acad Sci U S A 91(11), 4781-5.
Barre-Sinoussi, F., Chermann, J. C., Rey, F., Nugeyre, M. T., Chamaret, S., Gruest, J.,
Dauguet, C., Axler-Blin, C., Vezinet-Brun, F., Rouzioux, C., Rozenbaum, W., and
Montagnier, L. (1983). Isolation of a T-lymphotropic retrovirus from a patient at risk
for acquired immune deficiency syndrome (AIDS). Science 220(4599), 868-71.
Bartel, D. P., Zapp, M. L., Green, M. R., and Szostak, J. W. (1991). HIV-1 Rev regulation
involves recognition of non-Watson-Crick base pairs in viral RNA. Cell 67(3), 52936.
Barton, G. M. (2007). Viral recognition by Toll-like receptors. Semin Immunol 19(1), 33-40.
Barton, G. M., Kagan, J. C., and Medzhitov, R. (2006). Intracellular localization of Toll-like
receptor 9 prevents recognition of self DNA but facilitates access to viral DNA. Nat
Immunol 7(1), 49-56.
Battula, N., and Loeb, L. A. (1976). On the fidelity of DNA replication. Lack of
exodeoxyribonuclease activity and error-correcting function in avian myeloblastosis
virus DNA polymerase. J Biol Chem 251(4), 982-6.
Bayer, P., Kraft, M., Ejchart, A., Westendorp, M., Frank, R., and Rosch, P. (1995). Structural
studies of HIV-1 Tat protein. J Mol Biol 247(4), 529-35.
Bedford, M. T., and Richard, S. (2005). Arginine methylation an emerging regulator of
protein function. Mol Cell 18(3), 263-72.
187
Belardelli, F., Ferrantini, M., Proietti, E., and Kirkwood, J. M. (2002). Interferon-alpha in
tumor immunity and immunotherapy. Cytokine Growth Factor Rev 13(2), 119-34.
Belardelli, F., and Gresser, I. (1996). The neglected role of type I interferon in the T-cell
response: implications for its clinical use. Immunol Today 17(8), 369-72.
Ben-Neriah, Y. (2002). Regulatory functions of ubiquitination in the immune system. Nat
Immunol 3(1), 20-6.
Benkirane, M., Chun, R. F., Xiao, H., Ogryzko, V. V., Howard, B. H., Nakatani, Y., and
Jeang, K. T. (1998). Activation of integrated provirus requires histone
acetyltransferase. p300 and P/CAF are coactivators for HIV-1 Tat. J Biol Chem
273(38), 24898-905.
Bennasser, Y., Badou, A., Tkaczuk, J., and Bahraoui, E. (2002). Signaling pathways triggered
by HIV-1 Tat in human monocytes to induce TNF-alpha. Virology 303(1), 174-80.
Bennasser, Y., and Bahraoui, E. (2002). HIV-1 Tat protein induces interleukin-10 in human
peripheral blood monocytes: involvement of protein kinase C-betaII and -delta. Faseb
J 16(6), 546-54.
Bennasser, Y., Contreras, X., Moreau, M., Le Clerc, C., Badou, A., and Bahraoui, E. (2001).
[HIV-1 Tat protein induces IL-10 production by human monocytes: implications of
the PKC and calcium pathway]. J Soc Biol 195(3), 319-26.
Bennasser, Y., and Jeang, K. T. (2006). HIV-1 Tat interaction with Dicer: requirement for
RNA. Retrovirology 3, 95.
Bennasser, Y., Le, S. Y., Yeung, M. L., and Jeang, K. T. (2006). MicroRNAs in human
immunodeficiency virus-1 infection. Methods Mol Biol 342, 241-53.
Beutler, B., and Bazzoni, F. (1998). TNF, apoptosis and autoimmunity: a common thread?
Blood Cells Mol Dis 24(2), 216-30.
Beutler, B., Hoebe, K., Georgel, P., Tabeta, K., and Du, X. (2005). Genetic analysis of innate
immunity: identification and function of the TIR adapter proteins. Adv Exp Med Biol
560, 29-39.
Beutler, B. A. (1999). The role of tumor necrosis factor in health and disease. J Rheumatol
Suppl 57, 16-21.
Beyaert, R., and Fiers, W. (1994). Molecular mechanisms of tumor necrosis factor-induced
cytotoxicity. What we do understand and what we do not. FEBS Lett 340(1-2), 9-16.
Birbach, A., Gold, P., Binder, B. R., Hofer, E., de Martin, R., and Schmid, J. A. (2002).
Signaling molecules of the NF-kappa B pathway shuttle constitutively between
cytoplasm and nucleus. J Biol Chem 277(13), 10842-51.
Birdsall, H. H., Porter, W. J., Green, D. M., Rubio, J., Trial, J., and Rossen, R. D. (2004).
Impact of fibronectin fragments on the transendothelial migration of HIV-infected
leukocytes and the development of subendothelial foci of infectious leukocytes. J
Immunol 173(4), 2746-54.
Biswas, P., Poli, G., Kinter, A. L., Justement, J. S., Stanley, S. K., Maury, W. J., Bressler, P.,
Orenstein, J. M., and Fauci, A. S. (1992). Interferon gamma induces the expression of
human immunodeficiency virus in persistently infected promonocytic cells (U1) and
redirects the production of virions to intracytoplasmic vacuoles in phorbol myristate
acetate-differentiated U1 cells. J Exp Med 176(3), 739-50.
Blanchette, J., Jaramillo, M., and Olivier, M. (2003). Signalling events involved in interferongamma-inducible macrophage nitric oxide generation. Immunology 108(4), 513-22.
Blanco, J., Bosch, B., Fernandez-Figueras, M. T., Barretina, J., Clotet, B., and Este, J. A.
(2004). High level of coreceptor-independent HIV transfer induced by contacts
between primary CD4 T cells. J Biol Chem 279(49), 51305-14.
188
Blancou, P., Vartanian, J. P., Christopherson, C., Chenciner, N., Basilico, C., Kwok, S., and
Wain-Hobson, S. (2001). Polio vaccine samples not linked to AIDS. Nature
410(6832), 1045-6.
Blankson, J. N., Persaud, D., and Siliciano, R. F. (2002). The challenge of viral reservoirs in
HIV-1 infection. Annu Rev Med 53, 557-93.
Blumberg, H., Conklin, D., Xu, W. F., Grossmann, A., Brender, T., Carollo, S., Eagan, M.,
Foster, D., Haldeman, B. A., Hammond, A., Haugen, H., Jelinek, L., Kelly, J. D.,
Madden, K., Maurer, M. F., Parrish-Novak, J., Prunkard, D., Sexson, S., Sprecher, C.,
Waggie, K., West, J., Whitmore, T. E., Yao, L., Kuechle, M. K., Dale, B. A., and
Chandrasekher, Y. A. (2001). Interleukin 20: discovery, receptor identification, and
role in epidermal function. Cell 104(1), 9-19.
Boden, D., Pusch, O., Lee, F., Tucker, L., and Ramratnam, B. (2003). Human
immunodeficiency virus type 1 escape from RNA interference. J Virol 77(21), 115315.
Boehme, K. W., and Compton, T. (2004). Innate sensing of viruses by toll-like receptors. J
Virol 78(15), 7867-73.
Bonizzi, G., and Karin, M. (2004). The two NF-kappaB activation pathways and their role in
innate and adaptive immunity. Trends Immunol 25(6), 280-8.
Bonnard, M., Mirtsos, C., Suzuki, S., Graham, K., Huang, J., Ng, M., Itie, A., Wakeham, A.,
Shahinian, A., Henzel, W. J., Elia, A. J., Shillinglaw, W., Mak, T. W., Cao, Z., and
Yeh, W. C. (2000). Deficiency of T2K leads to apoptotic liver degeneration and
impaired NF-kappaB-dependent gene transcription. Embo J 19(18), 4976-85.
Bootman, M. D., Collins, T. J., Peppiatt, C. M., Prothero, L. S., MacKenzie, L., De Smet, P.,
Travers, M., Tovey, S. C., Seo, J. T., Berridge, M. J., Ciccolini, F., and Lipp, P.
(2001). Calcium signalling--an overview. Semin Cell Dev Biol 12(1), 3-10.
Borghi, P., Fantuzzi, L., Varano, B., Gessani, S., Puddu, P., Conti, L., Capobianchi, M. R.,
Ameglio, F., and Belardelli, F. (1995). Induction of interleukin-10 by human
immunodeficiency virus type 1 and its gp120 protein in human
monocytes/macrophages. J Virol 69(2), 1284-7.
Boulanger, M. C., Liang, C., Russell, R. S., Lin, R., Bedford, M. T., Wainberg, M. A., and
Richard, S. (2005). Methylation of Tat by PRMT6 regulates human immunodeficiency
virus type 1 gene expression. J Virol 79(1), 124-31.
Bovolenta, C., Lorini, A. L., Mantelli, B., Camorali, L., Novelli, F., Biswas, P., and Poli, G.
(1999). A selective defect of IFN-gamma- but not of IFN-alpha-induced JAK/STAT
pathway in a subset of U937 clones prevents the antiretroviral effect of IFN-gamma
against HIV-1. J Immunol 162(1), 323-30.
Bowerman, B., Brown, P. O., Bishop, J. M., and Varmus, H. E. (1989). A nucleoprotein
complex mediates the integration of retroviral DNA. Genes Dev 3(4), 469-78.
Bradbury, E. M. (1992). Reversible histone modifications and the chromosome cell cycle.
Bioessays 14(1), 9-16.
Brady, H. J., Abraham, D. J., Pennington, D. J., Miles, C. G., Jenkins, S., and Dzierzak, E. A.
(1995). Altered cytokine expression in T lymphocytes from human immunodeficiency
virus Tat transgenic mice. J Virol 69(12), 7622-9.
Brand, S. R., Kobayashi, R., and Mathews, M. B. (1997). The Tat protein of human
immunodeficiency virus type 1 is a substrate and inhibitor of the interferon-induced,
virally activated protein kinase, PKR. J Biol Chem 272(13), 8388-95.
Bres, V., Kiernan, R. E., Linares, L. K., Chable-Bessia, C., Plechakova, O., Treand, C.,
Emiliani, S., Peloponese, J. M., Jeang, K. T., Coux, O., Scheffner, M., and Benkirane,
M. (2003). A non-proteolytic role for ubiquitin in Tat-mediated transactivation of the
HIV-1 promoter. Nat Cell Biol 5(8), 754-61.
189
Bres, V., Tagami, H., Peloponese, J. M., Loret, E., Jeang, K. T., Nakatani, Y., Emiliani, S.,
Benkirane, M., and Kiernan, R. E. (2002). Differential acetylation of Tat coordinates
its interaction with the co-activators cyclin T1 and PCAF. Embo J 21(24), 6811-9.
Brigati, C., Giacca, M., Noonan, D. M., and Albini, A. (2003). HIV Tat, its TARgets and the
control of viral gene expression. FEMS Microbiol Lett 220(1), 57-65.
Brigino, E., Haraguchi, S., Koutsonikolis, A., Cianciolo, G. J., Owens, U., Good, R. A., and
Day, N. K. (1997). Interleukin 10 is induced by recombinant HIV-1 Nef protein
involving the calcium/calmodulin-dependent phosphodiesterase signal transduction
pathway. Proc Natl Acad Sci U S A 94(7), 3178-82.
Brinchmann, J. E. (2000). Differential responses of T cell subsets: possible role in the
immunopathogenesis of AIDS. Aids 14(12), 1689-700.
Brooks, P. C., Stromblad, S., Sanders, L. C., von Schalscha, T. L., Aimes, R. T., StetlerStevenson, W. G., Quigley, J. P., and Cheresh, D. A. (1996). Localization of matrix
metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin
alpha v beta 3. Cell 85(5), 683-93.
Brown, C. E., Lechner, T., Howe, L., and Workman, J. L. (2000). The many HATs of
transcription coactivators. Trends Biochem Sci 25(1), 15-9.
Brown, K., Gerstberger, S., Carlson, L., Franzoso, G., and Siebenlist, U. (1995). Control of I
kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science
267(5203), 1485-8.
Bulut, Y., Faure, E., Thomas, L., Karahashi, H., Michelsen, K. S., Equils, O., Morrison, S. G.,
Morrison, R. P., and Arditi, M. (2002). Chlamydial heat shock protein 60 activates
macrophages and endothelial cells through Toll-like receptor 4 and MD2 in a MyD88dependent pathway. J Immunol 168(3), 1435-40.
Burke, W. M., Dhopesh, V., and Lainfester, C. (1996). A brief survey of the current sexual
practices of a population admitted for inpatient treatment of drug dependence. J Sex
Marital Ther 22(3), 203-8.
Burnette, B., Yu, G., and Felsted, R. L. (1993). Phosphorylation of HIV-1 gag proteins by
protein kinase C. J Biol Chem 268(12), 8698-703.
Burns, K., Janssens, S., Brissoni, B., Olivos, N., Beyaert, R., and Tschopp, J. (2003).
Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the
alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J
Exp Med 197(2), 263-8.
Burton, G. F., Keele, B. F., Estes, J. D., Thacker, T. C., and Gartner, S. (2002). Follicular
dendritic cell contributions to HIV pathogenesis. Semin Immunol 14(4), 275-84.
Bushman, F. (1995). Targeting retroviral integration. Science 267(5203), 1443-4.
Cafaro, A., Caputo, A., Fracasso, C., Maggiorella, M., Goletti, D., Baroncelli, S., Pace, M.,
Sernicola, L., Koanga-Mogtomo, M., Betti, M., Borsetti, A., Belli, R., Akerblom, L.,
Corrias, F., Butto, S., Heeney, J., Verani, P., Titti, F., and Ensoli, B. (1999a). Control
of SHIV-89.6P-infection of cynomolgus monkeys by HIV-1 Tat protein vaccine. Nat
Med 5, 643-650.
Cafaro, A., Caputo, A., Fracasso, C., Maggiorella, M. T., Goletti, D., Baroncelli, S., Pace, M.,
Sernicola, L., Koanga-Mogtomo, M. L., Betti, M., Borsetti, A., Belli, R., Akerblom,
L., Corrias, F., Butto, S., Heeney, J., Verani, P., Titti, F., and Ensoli, B. (1999b).
Control of SHIV-89.6P-infection of cynomolgus monkeys by HIV-1 Tat protein
vaccine. Nat Med 5(6), 643-50.
Cafaro, A., Caputo, A., Maggiorella, M. T., Baroncelli, S., Fracasso, C., Pace, M., Borsetti,
A., Sernicola, L., Negri, D. R., Ten Haaft, P., Betti, M., Michelini, Z., Macchia, I.,
Fanales-Belasio, E., Belli, R., Corrias, F., Butto, S., Verani, P., Titti, F., and Ensoli, B.
(2000). SHIV89.6P pathogenicity in cynomolgus monkeys and control of viral
190
replication and disease onset by human immunodeficiency virus type 1 Tat vaccine. J
Med Primatol 29(3-4), 193-208.
Cafaro, A., Titti, F., Fracasso, C., Maggiorella, M. T., Baroncelli, S., Caputo, A., Goletti, D.,
Borsetti, A., Pace, M., Fanales-Belasio, E., Ridolfi, B., Negri, D. R., Sernicola, L.,
Belli, R., Corrias, F., Macchia, I., Leone, P., Michelini, Z., ten Haaft, P., Butto, S.,
Verani, P., and Ensoli, B. (2001). Vaccination with DNA containing tat coding
sequences and unmethylated CpG motifs protects cynomolgus monkeys upon
infection with simian/human immunodeficiency virus (SHIV89.6P). Vaccine 19(2022), 2862-77.
Cai, R., Carpick, B., Chun, R. F., Jeang, K. T., and Williams, B. R. (2000). HIV-I TAT
inhibits PKR activity by both RNA-dependent and RNA-independent mechanisms.
Arch Biochem Biophys 373(2), 361-7.
Campos, M. A., Almeida, I. C., Takeuchi, O., Akira, S., Valente, E. P., Procopio, D. O.,
Travassos, L. R., Smith, J. A., Golenbock, D. T., and Gazzinelli, R. T. (2001).
Activation of Toll-like receptor-2 by glycosylphosphatidylinositol anchors from a
protozoan parasite. J Immunol 167(1), 416-23.
Canani, R. B., Cirillo, P., Mallardo, G., Buccigrossi, V., Secondo, A., Annunziato, L.,
Bruzzese, E., Albano, F., Selvaggi, F., and Guarino, A. (2003). Effects of HIV-1 Tat
protein on ion secretion and on cell proliferation in human intestinal epithelial cells.
Gastroenterology 124(2), 368-76.
Canki, M., Potash, M. J., Bentsman, G., Chao, W., Flynn, T., Heinemann, M., Gelbard, H.,
and Volsky, D. J. (1997). Isolation and long-term culture of primary ocular human
immunodeficiency virus type 1 isolates in primary astrocytes. J Neurovirol 3(1), 10-5.
Cannon, P. M., Matthews, S., Clark, N., Byles, E. D., Iourin, O., Hockley, D. J., Kingsman, S.
M., and Kingsman, A. J. (1997). Structure-function studies of the human
immunodeficiency virus type 1 matrix protein, p17. J Virol 71(5), 3474-83.
Cao, Y., Bonizzi, G., Seagroves, T. N., Greten, F. R., Johnson, R., Schmidt, E. V., and Karin,
M. (2001). IKKalpha provides an essential link between RANK signaling and cyclin
D1 expression during mammary gland development. Cell 107(6), 763-75.
Carl, S., Iafrate, A. J., Lang, S. M., Stahl-Hennig, C., Kuhn, E. M., Fuchs, D., Matz-Rensing,
K., ten Haaft, P., Heeney, J. L., Skowronski, J., and Kirchhoff, F. (1999). The acidic
region and conserved putative protein kinase C phosphorylation site in Nef are
important for SIV replication in rhesus macaques. Virology 257(1), 138-55.
Carrion, A. M., Link, W. A., Ledo, F., Mellstrom, B., and Naranjo, J. R. (1999). DREAM is a
Ca2+-regulated transcriptional repressor. Nature 398(6722), 80-4.
Carter, R. S., Geyer, B. C., Xie, M., Acevedo-Suarez, C. A., and Ballard, D. W. (2001).
Persistent activation of NF-kappa B by the tax transforming protein involves chronic
phosphorylation of IkappaB kinase subunits IKKbeta and IKKgamma. J Biol Chem
276(27), 24445-8.
Catterall, W. A. (2000). Structure and regulation of voltage-gated Ca2+ channels. Annu Rev
Cell Dev Biol 16, 521-55.
Cavaillon, J. M. (2001). Pro- versus anti-inflammatory cytokines: myth or reality. Cell Mol
Biol (Noisy-le-grand) 47(4), 695-702.
Chackerian, B., Long, E. M., Luciw, P. A., and Overbaugh, J. (1997). Human
immunodeficiency virus type 1 coreceptors participate in postentry stages in the virus
replication cycle and function in simian immunodeficiency virus infection. J Virol
71(5), 3932-9.
Chaipan, C., Soilleux, E. J., Simpson, P., Hofmann, H., Gramberg, T., Marzi, A., Geier, M.,
Stewart, E. A., Eisemann, J., Steinkasserer, A., Suzuki-Inoue, K., Fuller, G. L., Pearce,
A. C., Watson, S. P., Hoxie, J. A., Baribaud, F., and Pohlmann, S. (2006). DC-SIGN
191
and CLEC-2 mediate human immunodeficiency virus type 1 capture by platelets. J
Virol 80(18), 8951-60.
Chan, D. C., Fass, D., Berger, J. M., and Kim, P. S. (1997). Core structure of gp41 from the
HIV envelope glycoprotein. Cell 89(2), 263-73.
Chang, L., and Karin, M. (2001). Mammalian MAP kinase signalling cascades. Nature
410(6824), 37-40.
Chang, Z. L., and Beezhold, D. H. (1993). Protein kinase C activation in human monocytes:
regulation of PKC isoforms. Immunology 80(3), 360-6.
Charneau, P., Alizon, M., and Clavel, F. (1992). A second origin of DNA plus-strand
synthesis is required for optimal human immunodeficiency virus replication. J Virol
66(5), 2814-20.
Charneau, P., Mirambeau, G., Roux, P., Paulous, S., Buc, H., and Clavel, F. (1994). HIV-1
reverse transcription. A termination step at the center of the genome. J Mol Biol
241(5), 651-62.
Chau, V., Tobias, J. W., Bachmair, A., Marriott, D., Ecker, D. J., Gonda, D. K., and
Varshavsky, A. (1989). A multiubiquitin chain is confined to specific lysine in a
targeted short-lived protein. Science 243(4898), 1576-83.
Che, X., Hokita, S., Natsugoe, S., Tanabe, G., Baba, M., Takao, S., and Aikou, T. (1998).
Tumor angiogenesis related to growth pattern and lymph node metastasis in early
gastric cancer. Chin Med J (Engl) 111(12), 1090-3.
Chen, G., Cao, P., and Goeddel, D. V. (2002). TNF-induced recruitment and activation of the
IKK complex require Cdc37 and Hsp90. Mol Cell 9(2), 401-10.
Chen, G., and Goeddel, D. V. (2002). TNF-R1 signaling: a beautiful pathway. Science
296(5573), 1634-5.
Chen, Y., Balakrishnan, M., Roques, B. P., Fay, P. J., and Bambara, R. A. (2003). Mechanism
of minus strand strong stop transfer in HIV-1 reverse transcription. J Biol Chem
278(10), 8006-17.
Chen, Z., Gibson, T. B., Robinson, F., Silvestro, L., Pearson, G., Xu, B., Wright, A.,
Vanderbilt, C., and Cobb, M. H. (2001). MAP kinases. Chem Rev 101(8), 2449-76.
Chen, Z., Hagler, J., Palombella, V. J., Melandri, F., Scherer, D., Ballard, D., and Maniatis, T.
(1995). Signal-induced site-specific phosphorylation targets I kappa B alpha to the
ubiquitin-proteasome pathway. Genes Dev 9(13), 1586-97.
Chen, Z. J. (2005). Ubiquitin signalling in the NF-kappaB pathway. Nat Cell Biol 7(8), 75865.
Chen, Z. J., Parent, L., and Maniatis, T. (1996). Site-specific phosphorylation of
IkappaBalpha by a novel ubiquitination-dependent protein kinase activity. Cell 84(6),
853-62.
Cheung, W. L., Briggs, S. D., and Allis, C. D. (2000). Acetylation and chromosomal
functions. Curr Opin Cell Biol 12(3), 326-33.
Chin, J. E., Dickens, M., Tavare, J. M., and Roth, R. A. (1993). Overexpression of protein
kinase C isoenzymes alpha, beta I, gamma, and epsilon in cells overexpressing the
insulin receptor. Effects on receptor phosphorylation and signaling. J Biol Chem
268(9), 6338-47.
Chirmule, N., Than, S., Khan, S. A., and Pahwa, S. (1995). Human immunodeficiency virus
Tat induces functional unresponsiveness in T cells. J Virol 69(1), 492-8.
Chowers, M. Y., Spina, C. A., Kwoh, T. J., Fitch, N. J., Richman, D. D., and Guatelli, J. C.
(1994). Optimal infectivity in vitro of human immunodeficiency virus type 1 requires
an intact nef gene. J Virol 68(5), 2906-14.
192
Chu, W. M., Ostertag, D., Li, Z. W., Chang, L., Chen, Y., Hu, Y., Williams, B., Perrault, J.,
and Karin, M. (1999). JNK2 and IKKbeta are required for activating the innate
response to viral infection. Immunity 11(6), 721-31.
Chuang, T. H., and Ulevitch, R. J. (2000). Cloning and characterization of a sub-family of
human toll-like receptors: hTLR7, hTLR8 and hTLR9. Eur Cytokine Netw 11(3), 3728.
Cimarelli, A., and Luban, J. (2000). Human immunodeficiency virus type 1 virion density is
not determined by nucleocapsid basic residues. J Virol 74(15), 6734-40.
Clapham, P. R., and McKnight, A. (2002). Cell surface receptors, virus entry and tropism of
primate lentiviruses. J Gen Virol 83(Pt 8), 1809-29.
Clavel, F., Guetard, D., Brun-Vezinet, F., Chamaret, S., Rey, M. A., Santos-Ferreira, M. O.,
Laurent, A. G., Dauguet, C., Katlama, C., Rouzioux, C., and et al. (1986). Isolation of
a new human retrovirus from West African patients with AIDS. Science 233(4761),
343-6.
Clayton, A. L., Rose, S., Barratt, M. J., and Mahadevan, L. C. (2000). Phosphoacetylation of
histone H3 on c-fos- and c-jun-associated nucleosomes upon gene activation. Embo J
19(14), 3714-26.
Clayton, F., Kotler, D. P., Kuwada, S. K., Morgan, T., Stepan, C., Kuang, J., Le, J., and
Fantini, J. (2001). Gp120-induced Bob/GPR15 activation: a possible cause of human
immunodeficiency virus enteropathy. Am J Pathol 159(5), 1933-9.
Clerici, M., Hakim, F. T., Venzon, D. J., Blatt, S., Hendrix, C. W., Wynn, T. A., and Shearer,
G. M. (1993). Changes in interleukin-2 and interleukin-4 production in asymptomatic,
human immunodeficiency virus-seropositive individuals. J Clin Invest 91(3), 759-65.
Clerici, M., and Shearer, G. M. (1993). A TH1-->TH2 switch is a critical step in the etiology
of HIV infection. Immunol Today 14(3), 107-11.
Clerici, M., Stocks, N. I., Zajac, R. A., Boswell, R. N., Lucey, D. R., Via, C. S., and Shearer,
G. M. (1989). Detection of three distinct patterns of T helper cell dysfunction in
asymptomatic, human immunodeficiency virus-seropositive patients. Independence of
CD4+ cell numbers and clinical staging. J Clin Invest 84(6), 1892-9.
Clerici, M., Wynn, T. A., Berzofsky, J. A., Blatt, S. P., Hendrix, C. W., Sher, A., Coffman, R.
L., and Shearer, G. M. (1994). Role of interleukin-10 in T helper cell dysfunction in
asymptomatic individuals infected with the human immunodeficiency virus. J Clin
Invest 93(2), 768-75.
Clever, J. L., Miranda, D., Jr., and Parslow, T. G. (2002). RNA structure and packaging
signals in the 5' leader region of the human immunodeficiency virus type 1 genome. J
Virol 76(23), 12381-7.
Coban, C., Ishii, K. J., Kawai, T., Hemmi, H., Sato, S., Uematsu, S., Yamamoto, M.,
Takeuchi, O., Itagaki, S., Kumar, N., Horii, T., and Akira, S. (2005). Toll-like receptor
9 mediates innate immune activation by the malaria pigment hemozoin. J Exp Med
201(1), 19-25.
Coburn, G. A., and Cullen, B. R. (2002). Potent and specific inhibition of human
immunodeficiency virus type 1 replication by RNA interference. J Virol 76(18), 922531.
Cohen, E. A., Terwilliger, E. F., Jalinoos, Y., Proulx, J., Sodroski, J. G., and Haseltine, W. A.
(1990). Identification of HIV-1 vpr product and function. J Acquir Immune Defic
Syndr 3(1), 11-8.
Cohen, M. S. (2004). HIV and sexually transmitted diseases: lethal synergy. Top HIV Med
12(4), 104-7.
193
Cohen, P. S., Schmidtmayerova, H., Dennis, J., Dubrovsky, L., Sherry, B., Wang, H.,
Bukrinsky, M., and Tracey, K. J. (1997a). The critical role of p38 MAP kinase in T
cell HIV-1 replication. Mol Med 3(5), 339-46.
Cohen, S. B., Crawley, J. B., Kahan, M. C., Feldmann, M., and Foxwell, B. M. (1997b).
Interleukin-10 rescues T cells from apoptotic cell death: association with an
upregulation of Bcl-2. Immunology 92(1), 1-5.
Col, E., Caron, C., Seigneurin-Berny, D., Gracia, J., Favier, A., and Khochbin, S. (2001). The
histone acetyltransferase, hGCN5, interacts with and acetylates the HIV transactivator,
Tat. J Biol Chem 276(30), 28179-84.
Collins, K. L., Chen, B. K., Kalams, S. A., Walker, B. D., and Baltimore, D. (1998). HIV-1
Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes.
Nature 391(6665), 397-401.
Constantinescu, S. N., Cernescu, C. D., and Popescu, L. M. (1991). Effects of protein kinase
C inhibitors on viral entry and infectivity. FEBS Lett 292(1-2), 31-3.
Conticello, S. G., Harris, R. S., and Neuberger, M. S. (2003). The Vif protein of HIV triggers
degradation of the human antiretroviral DNA deaminase APOBEC3G. Curr Biol
13(22), 2009-13.
Contreras, X., Bennasser, Y., Chazal, N., Moreau, M., Leclerc, C., Tkaczuk, J., and Bahraoui,
E. (2005). Human immunodeficiency virus type 1 Tat protein induces an intracellular
calcium increase in human monocytes that requires DHP receptors: involvement in
TNF-alpha production. Virology 332(1), 316-28.
Cooper, D. A., Gold, J., Maclean, P., Donovan, B., Finlayson, R., Barnes, T. G., Michelmore,
H. M., Brooke, P., and Penny, R. (1985). Acute AIDS retrovirus infection. Definition
of a clinical illness associated with seroconversion. Lancet 1(8428), 537-40.
Cooper, D. A., Tindall, B., Wilson, E. J., Imrie, A. A., and Penny, R. (1988). Characterization
of T lymphocyte responses during primary infection with human immunodeficiency
virus. J Infect Dis 157(5), 889-96.
Corti, A. (2004). Strategies for improving the anti-neoplastic activity of TNF by tumor
targeting. Methods Mol Med 98, 247-64.
Covert, M. W., Leung, T. H., Gaston, J. E., and Baltimore, D. (2005). Achieving stability of
lipopolysaccharide-induced NF-kappaB activation. Science 309(5742), 1854-7.
Covey, S. N. (1986). Amino acid sequence homology in gag region of reverse transcribing
elements and the coat protein gene of cauliflower mosaic virus. Nucleic Acids Res
14(2), 623-33.
Crabtree, G. R. (2001). Calcium, calcineurin, and the control of transcription. J Biol Chem
276(4), 2313-6.
Creery, D., Angel, J. B., Aucoin, S., Weiss, W., Cameron, W. D., Diaz-Mitoma, F., and
Kumar, A. (2002). Nef protein of human immunodeficiency virus and
lipopolysaccharide induce expression of CD14 on human monocytes through
differential utilization of interleukin-10. Clin Diagn Lab Immunol 9(6), 1212-21.
Crowe, S., Zhu, T., and Muller, W. A. (2003). The contribution of monocyte infection and
trafficking to viral persistence, and maintenance of the viral reservoir in HIV
infection. J Leukoc Biol 74(5), 635-41.
Csukai, M., Chen, C. H., De Matteis, M. A., and Mochly-Rosen, D. (1997). The coatomer
protein beta'-COP, a selective binding protein (RACK) for protein kinase Cepsilon. J
Biol Chem 272(46), 29200-6.
Cullen, B. R. (1992). Mechanism of action of regulatory proteins encoded by complex
retroviruses. Microbiol Rev 56(3), 375-94.
Cunningham, A. L., Naif, H., Saksena, N., Lynch, G., Chang, J., Li, S., Jozwiak, R., Alali,
M., Wang, B., Fear, W., Sloane, A., Pemberton, L., and Brew, B. (1997). HIV
194
infection of macrophages and pathogenesis of AIDS dementia complex: interaction of
the host cell and viral genotype. J Leukoc Biol 62(1), 117-25.
Curtis, B. M., Scharnowske, S., and Watson, A. J. (1992). Sequence and expression of a
membrane-associated C-type lectin that exhibits CD4-independent binding of human
immunodeficiency virus envelope glycoprotein gp120. Proc Natl Acad Sci U S A
89(17), 8356-60.
da Silva Correia, J., Soldau, K., Christen, U., Tobias, P. S., and Ulevitch, R. J. (2001).
Lipopolysaccharide is in close proximity to each of the proteins in its membrane
receptor complex. transfer from CD14 to TLR4 and MD-2. J Biol Chem 276(24),
21129-35.
Daar, E. S., Li, X. L., Moudgil, T., and Ho, D. D. (1990). High concentrations of recombinant
soluble CD4 are required to neutralize primary human immunodeficiency virus type 1
isolates. Proc Natl Acad Sci U S A 87(17), 6574-8.
Daar, E. S., Moudgil, T., Meyer, R. D., and Ho, D. D. (1991). Transient high levels of viremia
in patients with primary human immunodeficiency virus type 1 infection. N Engl J
Med 324(14), 961-4.
Daelemans, D., Schols, D., Witvrouw, M., Pannecouque, C., Hatse, S., van Dooren, S., Hamy,
F., Klimkait, T., de Clercq, E., and VanDamme, A. M. (2000). A second target for the
peptoid Tat/transactivation response element inhibitor CGP64222: inhibition of human
immunodeficiency virus replication by blocking CXC-chemokine receptor 4-mediated
virus entry. Mol Pharmacol 57(1), 116-24.
Daftarian, M. P., Diaz-Mitoma, F., Creery, W. D., Cameron, W., and Kumar, A. (1995).
Dysregulated production of interleukin-10 (IL-10) and IL-12 by peripheral blood
lymphocytes from human immunodeficiency virus-infected individuals is associated
with altered proliferative responses to recall antigens. Clin Diagn Lab Immunol 2(6),
712-8.
Dai, W. J., Kohler, G., and Brombacher, F. (1997). Both innate and acquired immunity to
Listeria monocytogenes infection are increased in IL-10-deficient mice. J Immunol
158(5), 2259-67.
Dandekar, D. H., Ganesh, K. N., and Mitra, D. (2004). HIV-1 Tat directly binds to NFkappaB
enhancer sequence: role in viral and cellular gene expression. Nucleic Acids Res 32(4),
1270-8.
De Clercq, E. (2002). New developments in anti-HIV chemotherapy. Biochim Biophys Acta
1587(2-3), 258-75.
de Veer, M. J., Holko, M., Frevel, M., Walker, E., Der, S., Paranjape, J. M., Silverman, R. H.,
and Williams, B. R. (2001). Functional classification of interferon-stimulated genes
identified using microarrays. J Leukoc Biol 69(6), 912-20.
Dekker, L. V., and Parker, P. J. (1994). Protein kinase C--a question of specificity. Trends
Biochem Sci 19(2), 73-7.
Demirov, D. G., and Freed, E. O. (2004). Retrovirus budding. Virus Res 106(2), 87-102.
Dempsey, P. W., Doyle, S. E., He, J. Q., and Cheng, G. (2003). The signaling adaptors and
pathways activated by TNF superfamily. Cytokine Growth Factor Rev 14(3-4), 193209.
Deng, L., Ammosova, T., Pumfery, A., Kashanchi, F., and Nekhai, S. (2002). HIV-1 Tat
interaction with RNA polymerase II C-terminal domain (CTD) and a dynamic
association with CDK2 induce CTD phosphorylation and transcription from HIV-1
promoter. J Biol Chem 277(37), 33922-9.
Deng, L., de la Fuente, C., Fu, P., Wang, L., Donnelly, R., Wade, J. D., Lambert, P., Li, H.,
Lee, C. G., and Kashanchi, F. (2000). Acetylation of HIV-1 Tat by CBP/P300
195
increases transcription of integrated HIV-1 genome and enhances binding to core
histones. Virology 277(2), 278-95.
Deniaud, A., Brenner, C., and Kroemer, G. (2004). Mitochondrial membrane
permeabilization by HIV-1 Vpr. Mitochondrion 4(2-3), 223-33.
Dhawan, S., Heredia, A., Wahl, L. M., Epstein, J. S., Meltzer, M. S., and Hewlett, I. K.
(1995). Interferon-gamma-induced downregulation of CD4 inhibits the entry of human
immunodeficiency virus type-1 in primary monocytes. Pathobiology 63(2), 93-9.
Diaz-Meco, M. T., Municio, M. M., Sanchez, P., Lozano, J., and Moscat, J. (1996). Lambdainteracting protein, a novel protein that specifically interacts with the zinc finger
domain of the atypical protein kinase C isotype lambda/iota and stimulates its kinase
activity in vitro and in vivo. Mol Cell Biol 16(1), 105-14.
DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E., and Karin, M. (1997). A
cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB.
Nature 388(6642), 548-54.
Dinarello, C. A. (1997). Interleukin-1. Cytokine Growth Factor Rev 8(4), 253-65.
Dinarello, C. A. (2002). The IL-1 family and inflammatory diseases. Clin Exp Rheumatol
20(5 Suppl 27), S1-13.
Ding, L., and Shevach, E. M. (1992). IL-10 inhibits mitogen-induced T cell proliferation by
selectively inhibiting macrophage costimulatory function. J Immunol 148(10), 3133-9.
Doffinger, R., Smahi, A., Bessia, C., Geissmann, F., Feinberg, J., Durandy, A., Bodemer, C.,
Kenwrick, S., Dupuis-Girod, S., Blanche, S., Wood, P., Rabia, S. H., Headon, D. J.,
Overbeek, P. A., Le Deist, F., Holland, S. M., Belani, K., Kumararatne, D. S., Fischer,
A., Shapiro, R., Conley, M. E., Reimund, E., Kalhoff, H., Abinun, M., Munnich, A.,
Israel, A., Courtois, G., and Casanova, J. L. (2001). X-linked anhidrotic ectodermal
dysplasia with immunodeficiency is caused by impaired NF-kappaB signaling. Nat
Genet 27(3), 277-85.
Dong, C., Davis, R. J., and Flavell, R. A. (2002). MAP kinases in the immune response. Annu
Rev Immunol 20, 55-72.
Dorr, A., Kiermer, V., Pedal, A., Rackwitz, H. R., Henklein, P., Schubert, U., Zhou, M. M.,
Verdin, E., and Ott, M. (2002). Transcriptional synergy between Tat and PCAF is
dependent on the binding of acetylated Tat to the PCAF bromodomain. Embo J
21(11), 2715-23.
Druker, B. J., Neumann, M., Okuda, K., Franza, B. R., Jr., and Griffin, J. D. (1994). rel Is
rapidly tyrosine-phosphorylated following granulocyte-colony stimulating factor
treatment of human neutrophils. J Biol Chem 269(7), 5387-90.
Du, X., Poltorak, A., Wei, Y., and Beutler, B. (2000). Three novel mammalian toll-like
receptors: gene structure, expression, and evolution. Eur Cytokine Netw 11(3), 362-71.
Duh, E. J., Maury, W. J., Folks, T. M., Fauci, A. S., and Rabson, A. B. (1989). Tumor
necrosis factor alpha activates human immunodeficiency virus type 1 through
induction of nuclear factor binding to the NF-kappa B sites in the long terminal repeat.
Proc Natl Acad Sci U S A 86(15), 5974-8.
Dumitru, C. D., Ceci, J. D., Tsatsanis, C., Kontoyiannis, D., Stamatakis, K., Lin, J. H.,
Patriotis, C., Jenkins, N. A., Copeland, N. G., Kollias, G., and Tsichlis, P. N. (2000).
TNF-alpha induction by LPS is regulated posttranscriptionally via a Tpl2/ERKdependent pathway. Cell 103(7), 1071-83.
Dumoutier, L., and Renauld, J. C. (2002). Viral and cellular interleukin-10 (IL-10)-related
cytokines: from structures to functions. Eur Cytokine Netw 13(1), 5-15.
Dumoutier, L., Van Roost, E., Colau, D., and Renauld, J. C. (2000). Human interleukin-10related T cell-derived inducible factor: molecular cloning and functional
196
characterization as an hepatocyte-stimulating factor. Proc Natl Acad Sci U S A 97(18),
10144-9.
Duran, A., Diaz-Meco, M. T., and Moscat, J. (2003). Essential role of RelA Ser311
phosphorylation by zetaPKC in NF-kappaB transcriptional activation. Embo J 22(15),
3910-8.
Dutil, E. M., and Newton, A. C. (2000). Dual role of pseudosubstrate in the coordinated
regulation of protein kinase C by phosphorylation and diacylglycerol. J Biol Chem
275(14), 10697-701.
Emilie, D., Fior, R., Crevon, M. C., Maillot, M. C., Boue, F., and Galanaud, P. (1994a).
Cytokines from lymphoid organs of HIV-infected patients: production and role in the
immune disequilibrium of the disease. Res Immunol 145(8-9), 595-600; discussion
600-2.
Emilie, D., Fior, R., Jarrousse, B., Marfaing-Koka, A., Merrien, D., Devergne, O., Crevon, M.
C., Maillot, M. C., and Galanaud, P. (1994b). Cytokines in HIV infection. Int J
Immunopharmacol 16(5-6), 391-6.
Emini, E. A., and Koff, W. C. (2004). AIDS/HIV. Developing an AIDS vaccine: need,
uncertainty, hope. Science 304(5679), 1913-4.
Endo-Munoz, L., Warby, T., Harrich, D., and McMillan, N. A. (2005). Phosphorylation of
HIV Tat by PKR increases interaction with TAR RNA and enhances transcription.
Virol J 2, 17.
Ensoli, B., Buonaguro, L., Barillari, G., Fiorelli, V., Gendelman, R., Morgan, R. A.,
Wingfield, P., and Gallo, R. C. (1993). Release, uptake, and effects of extracellular
human immunodeficiency virus type 1 Tat protein on cell growth and viral
transactivation. J Virol 67(1), 277-87.
Ensoli, B., and Cafaro, A. (2002). HIV-1 Tat vaccines. Virus Res 82(1-2), 91-101.
Ensoli, B., Gendelman, R., Markham, P., Fiorelli, V., Colombini, S., Raffeld, M., Cafaro, A.,
Chang, H. K., Brady, J. N., and Gallo, R. C. (1994). Synergy between basic fibroblast
growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma. Nature
371(6499), 674-80.
Ensoli, B., and Sirianni, M. C. (1998). Kaposi's sarcoma pathogenesis: a link between
immunology and tumor biology. Crit Rev Oncog 9(2), 107-24.
Erikstrup, C., Kallestrup, P., Zinyama-Gutsire, R. B., Gomo, E., Butterworth, A. E., Pedersen,
B. K., Ostrowski, S. R., Gerstoft, J., and Ullum, H. (2007). Reduced mortality and
CD4 cell loss among carriers of the interleukin-10 -1082G allele in a Zimbabwean
cohort of HIV-1-infected adults. Aids 21(17), 2283-91.
Eskdale, J., Kube, D., Tesch, H., and Gallagher, G. (1997). Mapping of the human IL10 gene
and further characterization of the 5' flanking sequence. Immunogenetics 46(2), 120-8.
Esparza, J., and Bhamarapravati, N. (2000). Accelerating the development and future
availability of HIV-1 vaccines: why, when, where, and how? Lancet 355(9220), 20616.
Essex, M., Soto-Ramirez, L. E., Renjifo, E., Wang, W. K., and Lee, T. H. (1997). Genetic
variation within human immunodeficiency viruses generates rapid changes in tropism,
virulence, and transmission. Leukemia 11 Suppl 3, 93-4.
Ezhevsky, S. A., Nagahara, H., Vocero-Akbani, A. M., Gius, D. R., Wei, M. C., and Dowdy,
S. F. (1997). Hypo-phosphorylation of the retinoblastoma protein (pRb) by cyclin
D:Cdk4/6 complexes results in active pRb. Proc Natl Acad Sci U S A 94(20), 10699704.
Fauci, A. S. (1993). Immunopathogenesis of HIV infection. J Acquir Immune Defic Syndr
6(6), 655-62.
197
Fauci, A. S. (1996). Host factors and the pathogenesis of HIV-induced disease. Nature
384(6609), 529-34.
Faux, M. C., and Scott, J. D. (1997). Regulation of the AKAP79-protein kinase C interaction
by Ca2+/Calmodulin. J Biol Chem 272(27), 17038-44.
Fawell, S., Seery, J., Daikh, Y., Moore, C., Chen, L. L., Pepinsky, B., and Barsoum, J. (1994).
Tat-mediated delivery of heterologous proteins into cells. Proc Natl Acad Sci U S A
91(2), 664-8.
Fenwick, C., Na, S. Y., Voll, R. E., Zhong, H., Im, S. Y., Lee, J. W., and Ghosh, S. (2000). A
subclass of Ras proteins that regulate the degradation of IkappaB. Science 287(5454),
869-73.
Finnegan, A., Roebuck, K. A., Nakai, B. E., Gu, D. S., Rabbi, M. F., Song, S., and Landay, A.
L. (1996). IL-10 cooperates with TNF-alpha to activate HIV-1 from latently and
acutely infected cells of monocyte/macrophage lineage. J Immunol 156(2), 841-51.
Fittipaldi, A., Ferrari, A., Zoppe, M., Arcangeli, C., Pellegrini, V., Beltram, F., and Giacca,
M. (2003). Cell membrane lipid rafts mediate caveolar endocytosis of HIV-1 Tat
fusion proteins. J Biol Chem 278(36), 34141-9.
Flores, S. C., Marecki, J. C., Harper, K. P., Bose, S. K., Nelson, S. K., and McCord, J. M.
(1993). Tat protein of human immunodeficiency virus type 1 represses expression of
manganese superoxide dismutase in HeLa cells. Proc Natl Acad Sci U S A 90(16),
7632-6.
Florese, R. H., Wiseman, R. W., Venzon, D., Karl, J. A., Demberg, T., Larsen, K., Flanary,
L., Kalyanaraman, V. S., Pal, R., Titti, F., Patterson, L. J., Heath, M. J., O'Connor, D.
H., Cafaro, A., Ensoli, B., and Robert-Guroff, M. (2008). Comparative study of Tat
vaccine regimens in Mauritian cynomolgus and Indian rhesus macaques: Influence of
Mauritian MHC haplotypes on susceptibility/resistance to SHIV(89.6P) infection.
Vaccine 26(26), 3312-21.
Flugel, R. M., Rethwilm, A., Maurer, B., and Darai, G. (1987). Nucleotide sequence analysis
of the env gene and its flanking regions of the human spumaretrovirus reveals two
novel genes. Embo J 6(7), 2077-84.
Fong, A., and Sun, S. C. (2002). Genetic evidence for the essential role of beta-transducin
repeat-containing protein in the inducible processing of NF-kappa B2/p100. J Biol
Chem 277(25), 22111-4.
Fornerod, M., van Deursen, J., van Baal, S., Reynolds, A., Davis, D., Murti, K. G., Fransen,
J., and Grosveld, G. (1997). The human homologue of yeast CRM1 is in a dynamic
subcomplex with CAN/Nup214 and a novel nuclear pore component Nup88. Embo J
16(4), 807-16.
Fortin, J. F., Barbeau, B., Hedman, H., Lundgren, E., and Tremblay, M. J. (1999). Role of the
leukocyte function antigen-1 conformational state in the process of human
immunodeficiency virus type 1-mediated syncytium formation and virus infection.
Virology 257(1), 228-38.
Fouchier, R. A., Meyer, B. E., Simon, J. H., Fischer, U., Albright, A. V., Gonzalez-Scarano,
F., and Malim, M. H. (1998). Interaction of the human immunodeficiency virus type 1
Vpr protein with the nuclear pore complex. J Virol 72(7), 6004-13.
Fra, A. M., Williamson, E., Simons, K., and Parton, R. G. (1994). Detergent-insoluble
glycolipid microdomains in lymphocytes in the absence of caveolae. J Biol Chem
269(49), 30745-8.
Franchi, L., Amer, A., Body-Malapel, M., Kanneganti, T. D., Ozoren, N., Jagirdar, R.,
Inohara, N., Vandenabeele, P., Bertin, J., Coyle, A., Grant, E. P., and Nunez, G.
(2006). Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin
1beta in salmonella-infected macrophages. Nat Immunol 7(6), 576-82.
198
Franke, E. K., Yuan, H. E., and Luban, J. (1994). Specific incorporation of cyclophilin A into
HIV-1 virions. Nature 372(6504), 359-62.
Frankel, A. D., and Pabo, C. O. (1988). Cellular uptake of the tat protein from human
immunodeficiency virus. Cell 55(6), 1189-93.
Frantz, B., Nordby, E. C., Bren, G., Steffan, N., Paya, C. V., Kincaid, R. L., Tocci, M. J.,
O'Keefe, S. J., and O'Neill, E. A. (1994). Calcineurin acts in synergy with PMA to
inactivate I kappa B/MAD3, an inhibitor of NF-kappa B. Embo J 13(4), 861-70.
Fraser, J. D., Straus, D., and Weiss, A. (1993). Signal transduction events leading to T-cell
lymphokine gene expression. Immunol Today 14(7), 357-62.
Gallagher, G., Dickensheets, H., Eskdale, J., Izotova, L. S., Mirochnitchenko, O. V., Peat, J.
D., Vazquez, N., Pestka, S., Donnelly, R. P., and Kotenko, S. V. (2000). Cloning,
expression and initial characterization of interleukin-19 (IL-19), a novel homologue of
human interleukin-10 (IL-10). Genes Immun 1(7), 442-50.
Galli, G., Annunziato, F., Mavilia, C., Romagnani, P., Cosmi, L., Manetti, R., Pupilli, C.,
Maggi, E., and Romagnani, S. (1998). Enhanced HIV expression during Th2-oriented
responses explained by the opposite regulatory effect of IL-4 and IFN-gamma of
fusin/CXCR4. Eur J Immunol 28(10), 3280-90.
Galvin, S. R., and Cohen, M. S. (2004). The role of sexually transmitted diseases in HIV
transmission. Nat Rev Microbiol 2(1), 33-42.
Gao, F., Bailes, E., Robertson, D. L., Chen, Y., Rodenburg, C. M., Michael, S. F., Cummins,
L. B., Arthur, L. O., Peeters, M., Shaw, G. M., Sharp, P. M., and Hahn, B. H. (1999).
Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397(6718),
436-41.
Garber, M. E., Mayall, T. P., Suess, E. M., Meisenhelder, J., Thompson, N. E., and Jones, K.
A. (2000). CDK9 autophosphorylation regulates high-affinity binding of the human
immunodeficiency virus type 1 tat-P-TEFb complex to TAR RNA. Mol Cell Biol
20(18), 6958-69.
Garbuglia, A. R., Zaccarelli, M., Calcaterra, S., Cappiello, G., Marini, R., and Benedetto, A.
(2001). Dynamics of viral load in plasma and HIV DNA in lymphocytes during highly
active antiretroviral therapy (HAART): high viral burden in macrophages after 1 year
of treatment. J Chemother 13(2), 188-94.
Garnier, L., Parent, L. J., Rovinski, B., Cao, S. X., and Wills, J. W. (1999). Identification of
retroviral late domains as determinants of particle size. J Virol 73(3), 2309-20.
Garrus, J. E., von Schwedler, U. K., Pornillos, O. W., Morham, S. G., Zavitz, K. H., Wang, H.
E., Wettstein, D. A., Stray, K. M., Cote, M., Rich, R. L., Myszka, D. G., and
Sundquist, W. I. (2001). Tsg101 and the vacuolar protein sorting pathway are essential
for HIV-1 budding. Cell 107(1), 55-65.
Gately, M. K., Renzetti, L. M., Magram, J., Stern, A. S., Adorini, L., Gubler, U., and Presky,
D. H. (1998). The interleukin-12/interleukin-12-receptor system: role in normal and
pathologic immune responses. Annu Rev Immunol 16, 495-521.
Gee, K., Angel, J. B., Mishra, S., Blahoianu, M. A., and Kumar, A. (2007). IL-10 regulation
by HIV-Tat in primary human monocytic cells: involvement of
calmodulin/calmodulin-dependent protein kinase-activated p38 MAPK and Sp-1 and
CREB-1 transcription factors. J Immunol 178(2), 798-807.
Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., van
Kooyk, Y., and Figdor, C. G. (2000). Identification of DC-SIGN, a novel dendritic
cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100(5),
575-85.
199
Geleziunas, R., Xu, W., Takeda, K., Ichijo, H., and Greene, W. C. (2001). HIV-1 Nef inhibits
ASK1-dependent death signalling providing a potential mechanism for protecting the
infected host cell. Nature 410(6830), 834-8.
Geyer, M., Fackler, O. T., and Peterlin, B. M. (2001). Structure--function relationships in
HIV-1 Nef. EMBO Rep 2(7), 580-5.
Ghosh, S., May, M. J., and Kopp, E. B. (1998). NF-kappa B and Rel proteins: evolutionarily
conserved mediators of immune responses. Annu Rev Immunol 16, 225-60.
Goh, K. C., Haque, S. J., and Williams, B. R. (1999). p38 MAP kinase is required for STAT1
serine phosphorylation and transcriptional activation induced by interferons. Embo J
18(20), 5601-8.
Goldstein, G. (1996). HIV-1 Tat protein as a potential AIDS vaccine. Nat Med 2(9), 960-4.
Goldstein, G., Manson, K., Tribbick, G., and Smith, R. (2000). Minimization of chronic
plasma viremia in rhesus macaques immunized with synthetic HIV-1 tat peptides and
infected with a chimeric simian/human immunodeficiency virus (SHIV(33)). Vaccine
18(25), 2789-95.
Gonzalez-Scarano, F., and Martin-Garcia, J. (2005). The neuropathogenesis of AIDS. Nat Rev
Immunol 5(1), 69-81.
Gopalakrishnan, V., Peliska, J. A., and Benkovic, S. J. (1992). Human immunodeficiency
virus type 1 reverse transcriptase: spatial and temporal relationship between the
polymerase and RNase H activities. Proc Natl Acad Sci U S A 89(22), 10763-7.
Gorelick, R. J., Nigida, S. M., Jr., Bess, J. W., Jr., Arthur, L. O., Henderson, L. E., and Rein,
A. (1990). Noninfectious human immunodeficiency virus type 1 mutants deficient in
genomic RNA. J Virol 64(7), 3207-11.
Granowitz, E. V., Saget, B. M., Wang, M. Z., Dinarello, C. A., and Skolnik, P. R. (1995).
Interleukin 1 induces HIV-1 expression in chronically infected U1 cells: blockade by
interleukin 1 receptor antagonist and tumor necrosis factor binding protein type 1. Mol
Med 1(6), 667-77.
Granucci, F., Vizzardelli, C., Pavelka, N., Feau, S., Persico, M., Virzi, E., Rescigno, M.,
Moro, G., and Ricciardi-Castagnoli, P. (2001). Inducible IL-2 production by dendritic
cells revealed by global gene expression analysis. Nat Immunol 2(9), 882-8.
Granucci, F., Zanoni, I., Feau, S., and Ricciardi-Castagnoli, P. (2003). Dendritic cell
regulation of immune responses: a new role for interleukin 2 at the intersection of
innate and adaptive immunity. Embo J 22(11), 2546-51.
Graziosi, C., Pantaleo, G., and Fauci, A. S. (1994). Comparative analysis of constitutive
cytokine expression in peripheral blood and lymph nodes of HIV-infected individuals.
Res Immunol 145(8-9), 602-5; discussion 605-7.
Graziosi, C., Pantaleo, G., Gantt, K. R., Fortin, J. P., Demarest, J. F., Cohen, O. J., Sekaly, R.
P., and Fauci, A. S. (1994). Lack of evidence for the dichotomy of TH1 and TH2
predominance in HIV-infected individuals. Science 265(5169), 248-52.
Green, M., and Loewenstein, P. M. (1988). Autonomous functional domains of chemically
synthesized human immunodeficiency virus tat trans-activator protein. Cell 55(6),
1179-88.
Griffin, D. E. (1997). Cytokines in the brain during viral infection: clues to HIV-associated
dementia. J Clin Invest 100(12), 2948-51.
Gruss, H. J., and Dower, S. K. (1995). Tumor necrosis factor ligand superfamily: involvement
in the pathology of malignant lymphomas. Blood 85(12), 3378-404.
Guo, Q., Ho, H. T., Dicker, I., Fan, L., Zhou, N., Friborg, J., Wang, T., McAuliffe, B. V.,
Wang, H. G., Rose, R. E., Fang, H., Scarnati, H. T., Langley, D. R., Meanwell, N. A.,
Abraham, R., Colonno, R. J., and Lin, P. F. (2003). Biochemical and genetic
200
characterizations of a novel human immunodeficiency virus type 1 inhibitor that
blocks gp120-CD4 interactions. J Virol 77(19), 10528-36.
Gutheil, W. G., Subramanyam, M., Flentke, G. R., Sanford, D. G., Munoz, E., Huber, B. T.,
and Bachovchin, W. W. (1994). Human immunodeficiency virus 1 Tat binds to
dipeptidyl aminopeptidase IV (CD26): a possible mechanism for Tat's
immunosuppressive activity. Proc Natl Acad Sci U S A 91(14), 6594-8.
Gutierrez-Sanmartin, D., Varela-Ledo, E., Aguilera, A., Romero-Yuste, S., Romero-Jung, P.,
Gomez-Tato, A., and Regueiro, B. J. (2008). Implication of p38 mitogen-activated
protein kinase isoforms ({alpha}, {beta}, {gamma} and {delta}) in CD4+ T-cell
infection with human immunodeficiency virus type I. J Gen Virol 89(Pt 7), 1661-71.
Guy, B., Riviere, Y., Dott, K., Regnault, A., and Kieny, M. P. (1990). Mutational analysis of
the HIV nef protein. Virology 176(2), 413-25.
Hahn, B. H., Shaw, G. M., De Cock, K. M., and Sharp, P. M. (2000). AIDS as a zoonosis:
scientific and public health implications. Science 287(5453), 607-14.
Hamy, F., Felder, E. R., Heizmann, G., Lazdins, J., Aboul-ela, F., Varani, G., Karn, J., and
Klimkait, T. (1997). An inhibitor of the Tat/TAR RNA interaction that effectively
suppresses HIV-1 replication. Proc Natl Acad Sci U S A 94(8), 3548-53.
Han, J., Lee, J. D., Jiang, Y., Li, Z., Feng, L., and Ulevitch, R. J. (1996). Characterization of
the structure and function of a novel MAP kinase kinase (MKK6). J Biol Chem
271(6), 2886-91.
Hannun, Y. A., and Bell, R. M. (1989). Functions of sphingolipids and sphingolipid
breakdown products in cellular regulation. Science 243(4890), 500-7.
Hariharan, D., Douglas, S. D., Lee, B., Lai, J. P., Campbell, D. E., and Ho, W. Z. (1999).
Interferon-gamma upregulates CCR5 expression in cord and adult blood mononuclear
phagocytes. Blood 93(4), 1137-44.
Harouse, J. M., Bhat, S., Spitalnik, S. L., Laughlin, M., Stefano, K., Silberberg, D. H., and
Gonzalez-Scarano, F. (1991). Inhibition of entry of HIV-1 in neural cell lines by
antibodies against galactosyl ceramide. Science 253(5017), 320-3.
Harris, R. S., Bishop, K. N., Sheehy, A. M., Craig, H. M., Petersen-Mahrt, S. K., Watt, I. N.,
Neuberger, M. S., and Malim, M. H. (2003). DNA deamination mediates innate
immunity to retroviral infection. Cell 113(6), 803-9.
Hassaine, G., Courcoul, M., Bessou, G., Barthalay, Y., Picard, C., Olive, D., Collette, Y.,
Vigne, R., and Decroly, E. (2001). The tyrosine kinase Hck is an inhibitor of HIV-1
replication counteracted by the viral vif protein. J Biol Chem 276(20), 16885-93.
Hauber, J., Bouvier, M., Malim, M. H., and Cullen, B. R. (1988). Phosphorylation of the rev
gene product of human immunodeficiency virus type 1. J Virol 62(12), 4801-4.
Haughey, N. J., and Mattson, M. P. (2002). Calcium dysregulation and neuronal apoptosis by
the HIV-1 proteins Tat and gp120. J Acquir Immune Defic Syndr 31 Suppl 2, S55-61.
Hayashi, F., Smith, K. D., Ozinsky, A., Hawn, T. R., Yi, E. C., Goodlett, D. R., Eng, J. K.,
Akira, S., Underhill, D. M., and Aderem, A. (2001). The innate immune response to
bacterial flagellin is mediated by Toll-like receptor 5. Nature 410(6832), 1099-103.
Hayashi, T., Sekine, T., and Okamoto, T. (1993). Identification of a new serine kinase that
activates NF kappa B by direct phosphorylation. J Biol Chem 268(35), 26790-5.
Hayden, M. S., and Ghosh, S. (2004). Signaling to NF-kappaB. Genes Dev 18(18), 2195-224.
Haynes, L. M., Moore, D. D., Kurt-Jones, E. A., Finberg, R. W., Anderson, L. J., and Tripp,
R. A. (2001). Involvement of toll-like receptor 4 in innate immunity to respiratory
syncytial virus. J Virol 75(22), 10730-7.
Healey, L. M., Hahn, B. K., Rehm, C. A., Adelsberger, J., Qin, J., Follmann, D. A., Tavel, J.,
Kovacs, J. A., Sereti, I., and Davey Jr, R. T. (2008). The Effect of Continuous Versus
Pericycle Antiretroviral Therapy on IL-2 Responsiveness. J Interferon Cytokine Res.
201
Hegde, R., Borkow, G., Berchanski, A., and Lapidot, A. (2007). Structure-function
relationship of novel X4 HIV-1 entry inhibitors - L- and D-arginine peptideaminoglycoside conjugates. Febs J 274(24), 6523-36.
Heil, F., Ahmad-Nejad, P., Hemmi, H., Hochrein, H., Ampenberger, F., Gellert, T., Dietrich,
H., Lipford, G., Takeda, K., Akira, S., Wagner, H., and Bauer, S. (2003). The Toll-like
receptor 7 (TLR7)-specific stimulus loxoribine uncovers a strong relationship within
the TLR7, 8 and 9 subfamily. Eur J Immunol 33(11), 2987-97.
Heiner, I., Eisfeld, J., Halaszovich, C. R., Wehage, E., Jungling, E., Zitt, C., and Luckhoff, A.
(2003). Expression profile of the transient receptor potential (TRP) family in
neutrophil granulocytes: evidence for currents through long TRP channel 2 induced by
ADP-ribose and NAD. Biochem J 371(Pt 3), 1045-53.
Heiner, I., Eisfeld, J., and Luckhoff, A. (2003). Role and regulation of TRP channels in
neutrophil granulocytes. Cell Calcium 33(5-6), 533-40.
Hel, Z., Tsai, W. P., Tryniszewska, E., Nacsa, J., Markham, P. D., Lewis, M. G., Pavlakis, G.
N., Felber, B. K., Tartaglia, J., and Franchini, G. (2006). Improved vaccine protection
from simian AIDS by the addition of nonstructural simian immunodeficiency virus
genes. J Immunol 176(1), 85-96.
Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino, K., Horiuchi, T.,
Tomizawa, H., Takeda, K., and Akira, S. (2002). Small anti-viral compounds activate
immune cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol 3(2),
196-200.
Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M.,
Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000). A Toll-like receptor
recognizes bacterial DNA. Nature 408(6813), 740-5.
Herbein, G., Montaner, L. J., and Gordon, S. (1996). Tumor necrosis factor alpha inhibits
entry of human immunodeficiency virus type 1 into primary human macrophages: a
selective role for the 75-kilodalton receptor. J Virol 70(11), 7388-97.
Herbein, G., Van Lint, C., Lovett, J. L., and Verdin, E. (1998). Distinct mechanisms trigger
apoptosis in human immunodeficiency virus type 1-infected and in uninfected
bystander T lymphocytes. J Virol 72(1), 660-70.
Herrmann, C. H., Carroll, R. G., Wei, P., Jones, K. A., and Rice, A. P. (1998). Tat-associated
kinase, TAK, activity is regulated by distinct mechanisms in peripheral blood
lymphocytes and promonocytic cell lines. J Virol 72(12), 9881-8.
Herrmann, C. H., and Rice, A. P. (1993). Specific interaction of the human immunodeficiency
virus Tat proteins with a cellular protein kinase. Virology 197(2), 601-8.
Hessol, N. A., Koblin, B. A., van Griensven, G. J., Bacchetti, P., Liu, J. Y., Stevens, C. E.,
Coutinho, R. A., Buchbinder, S. P., and Katz, M. H. (1994). Progression of human
immunodeficiency virus type 1 (HIV-1) infection among homosexual men in hepatitis
B vaccine trial cohorts in Amsterdam, New York City, and San Francisco, 1978-1991.
Am J Epidemiol 139(11), 1077-87.
Hetzer, C., Dormeyer, W., Schnolzer, M., and Ott, M. (2005). Decoding Tat: the biology of
HIV Tat posttranslational modifications. Microbes Infect 7(13), 1364-9.
Hill, C. P., Worthylake, D., Bancroft, D. P., Christensen, A. M., and Sundquist, W. I. (1996).
Crystal structures of the trimeric human immunodeficiency virus type 1 matrix
protein: implications for membrane association and assembly. Proc Natl Acad Sci U S
A 93(7), 3099-104.
Hirschfeld, M., Weis, J. J., Toshchakov, V., Salkowski, C. A., Cody, M. J., Ward, D. C.,
Qureshi, N., Michalek, S. M., and Vogel, S. N. (2001). Signaling by toll-like receptor
2 and 4 agonists results in differential gene expression in murine macrophages. Infect
Immun 69(3), 1477-82.
202
Ho, A. S., and Moore, K. W. (1994). Interleukin-10 and its receptor. Ther Immunol 1(3), 17385.
Ho, D. D., and Huang, Y. (2002). The HIV-1 vaccine race. Cell 110(2), 135-8.
Hocevar, B. A., Burns, D. J., and Fields, A. P. (1993). Identification of protein kinase C
(PKC) phosphorylation sites on human lamin B. Potential role of PKC in nuclear
lamina structural dynamics. J Biol Chem 268(10), 7545-52.
Hoebe, K., Du, X., Georgel, P., Janssen, E., Tabeta, K., Kim, S. O., Goode, J., Lin, P., Mann,
N., Mudd, S., Crozat, K., Sovath, S., Han, J., and Beutler, B. (2003). Identification of
Lps2 as a key transducer of MyD88-independent TIR signalling. Nature 424(6950),
743-8.
Hofmann, T., Schaefer, M., Schultz, G., and Gudermann, T. (2002). Subunit composition of
mammalian transient receptor potential channels in living cells. Proc Natl Acad Sci U
S A 99(11), 7461-6.
Honda, K., Sakaguchi, S., Nakajima, C., Watanabe, A., Yanai, H., Matsumoto, M., Ohteki, T.,
Kaisho, T., Takaoka, A., Akira, S., Seya, T., and Taniguchi, T. (2003). Selective
contribution of IFN-alpha/beta signaling to the maturation of dendritic cells induced
by double-stranded RNA or viral infection. Proc Natl Acad Sci U S A 100(19), 108727.
Honda, M., Kitamura, K., Matsuda, K., Yokota, Y., Yamamoto, N., Mitsuyasu, R.,
Chermann, J. C., and Tokunaga, T. (1989). Soluble IL-2 receptor in AIDS. Correlation
of its serum level with the classification of HIV-induced diseases and its
characterization. J Immunol 142(12), 4248-55.
Hoover, D. M., Schalk-Hihi, C., Chou, C. C., Menon, S., Wlodawer, A., and Zdanov, A.
(1999). Purification of receptor complexes of interleukin-10 stoichiometry and the
importance of deglycosylation in their crystallization. Eur J Biochem 262(1), 134-41.
Horng, T., Barton, G. M., and Medzhitov, R. (2001). TIRAP: an adapter molecule in the Toll
signaling pathway. Nat Immunol 2(9), 835-41.
Hornung, F., Scala, G., and Lenardo, M. J. (2000). TNF-alpha-induced secretion of C-C
chemokines modulates C-C chemokine receptor 5 expression on peripheral blood
lymphocytes. J Immunol 164(12), 6180-7.
Hostetler, K. Y., Richman, D. D., Forssen, E. A., Selk, L., Basava, R., Gardner, M. F., Parker,
S., and Basava, C. (1994). Phospholipid prodrug inhibitors of the HIV protease.
Antiviral activity and pharmacokinetics in rats. Biochem Pharmacol 48(7), 1399-404.
Hottiger, M. O., and Nabel, G. J. (1998). Interaction of human immunodeficiency virus type 1
Tat with the transcriptional coactivators p300 and CREB binding protein. J Virol
72(10), 8252-6.
House, C., and Kemp, B. E. (1987). Protein kinase C contains a pseudosubstrate prototope in
its regulatory domain. Science 238(4834), 1726-8.
Howcroft, T. K., Strebel, K., Martin, M. A., and Singer, D. S. (1993). Repression of MHC
class I gene promoter activity by two-exon Tat of HIV. Science 260(5112), 1320-2.
Huang, M. B., Hunter, M., and Bond, V. C. (1999). Effect of extracellular human
immunodeficiency virus type 1 glycoprotein 120 on primary human vascular
endothelial cell cultures. AIDS Res Hum Retroviruses 15(14), 1265-77.
Hug, H., and Sarre, T. F. (1993). Protein kinase C isoenzymes: divergence in signal
transduction? Biochem J 291 ( Pt 2), 329-43.
Huxford, T., Huang, D. B., Malek, S., and Ghosh, G. (1998). The crystal structure of the
IkappaBalpha/NF-kappaB complex reveals mechanisms of NF-kappaB inactivation.
Cell 95(6), 759-70.
Idriss, H. T., and Naismith, J. H. (2000). TNF alpha and the TNF receptor superfamily:
structure-function relationship(s). Microsc Res Tech 50(3), 184-95.
203
Imami, N., Pires, A., Hardy, G., Wilson, J., Gazzard, B., and Gotch, F. (2002). A balanced
type 1/type 2 response is associated with long-term nonprogressive human
immunodeficiency virus type 1 infection. J Virol 76(18), 9011-23.
Inohara, N., Koseki, T., Lin, J., del Peso, L., Lucas, P. C., Chen, F. F., Ogura, Y., and Nunez,
G. (2000). An induced proximity model for NF-kappa B activation in the Nod1/RICK
and RIP signaling pathways. J Biol Chem 275(36), 27823-31.
Ip, Y. T., and Davis, R. J. (1998). Signal transduction by the c-Jun N-terminal kinase (JNK)-from inflammation to development. Curr Opin Cell Biol 10(2), 205-19.
Ito, K., Barnes, P. J., and Adcock, I. M. (2000). Glucocorticoid receptor recruitment of
histone deacetylase 2 inhibits interleukin-1beta-induced histone H4 acetylation on
lysines 8 and 12. Mol Cell Biol 20(18), 6891-903.
Ito, K., Jazrawi, E., Cosio, B., Barnes, P. J., and Adcock, I. M. (2001). p65-activated histone
acetyltransferase activity is repressed by glucocorticoids: mifepristone fails to recruit
HDAC2 to the p65-HAT complex. J Biol Chem 276(32), 30208-15.
Ito, M., Ishida, T., He, L., Tanabe, F., Rongge, Y., Miyakawa, Y., and Terunuma, H. (1998).
HIV type 1 Tat protein inhibits interleukin 12 production by human peripheral blood
mononuclear cells. AIDS Res Hum Retroviruses 14(10), 845-9.
Jacobson, M. A., Spritzler, J., Landay, A., Chan, E., Katzenstein, D., Schock, B., Fox, L.,
Roe, J., Kundu, S., and Pollard, R. (2002). A Phase I, placebo-controlled trial of multidose recombinant human interleukin-12 in patients with HIV infection. Aids 16(8),
1147-54.
Janknecht, R., Ernst, W. H., Pingoud, V., and Nordheim, A. (1993). Activation of ternary
complex factor Elk-1 by MAP kinases. Embo J 12(13), 5097-104.
Jayaraman, T., Ondriasova, E., Ondrias, K., Harnick, D. J., and Marks, A. R. (1995). The
inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor signaling. Proc
Natl Acad Sci U S A 92(13), 6007-11.
Jeang, K. T., and Gatignol, A. (1994). Comparison of regulatory features among primate
lentiviruses. Curr Top Microbiol Immunol 188, 123-44.
Jiang, H., Su, Z. Z., Lin, J. J., Goldstein, N. I., Young, C. S., and Fisher, P. B. (1996). The
melanoma differentiation associated gene mda-7 suppresses cancer cell growth. Proc
Natl Acad Sci U S A 93(17), 9160-5.
Jiang, J., and Struhl, G. (1998). Regulation of the Hedgehog and Wingless signalling
pathways by the F-box/WD40-repeat protein Slimb. Nature 391(6666), 493-6.
Jiang, Q., Akashi, S., Miyake, K., and Petty, H. R. (2000). Lipopolysaccharide induces
physical proximity between CD14 and toll-like receptor 4 (TLR4) prior to nuclear
translocation of NF-kappa B. J Immunol 165(7), 3541-4.
Jiang, X., Takahashi, N., Matsui, N., Tetsuka, T., and Okamoto, T. (2003). The NF-kappa B
activation in lymphotoxin beta receptor signaling depends on the phosphorylation of
p65 at serine 536. J Biol Chem 278(2), 919-26.
Johnson, L. N., Noble, M. E., and Owen, D. J. (1996). Active and inactive protein kinases:
structural basis for regulation. Cell 85(2), 149-58.
Johnston, J. B., and McFadden, G. (2003). Poxvirus immunomodulatory strategies: current
perspectives. J Virol 77(11), 6093-100.
Jones, K. A., and Peterlin, B. M. (1994). Control of RNA initiation and elongation at the HIV1 promoter. Annu Rev Biochem 63, 717-43.
Jones, M. V., Bell, J. E., and Nath, A. (2000). Immunolocalization of HIV envelope gp120 in
HIV encephalitis with dementia. Aids 14(17), 2709-13.
Jones, R. J., and Bischofberger, N. (1995). Minireview: nucleotide prodrugs. Antiviral Res
27(1-2), 1-17.
204
Jordan, A., Defechereux, P., and Verdin, E. (2001). The site of HIV-1 integration in the
human genome determines basal transcriptional activity and response to Tat
transactivation. Embo J 20(7), 1726-38.
Juan, L. J., Shia, W. J., Chen, M. H., Yang, W. M., Seto, E., Lin, Y. S., and Wu, C. W.
(2000). Histone deacetylases specifically down-regulate p53-dependent gene
activation. J Biol Chem 275(27), 20436-43.
Kaech, S. M., Wherry, E. J., and Ahmed, R. (2002). Effector and memory T-cell
differentiation: implications for vaccine development. Nat Rev Immunol 2(4), 251-62.
Kaehlcke, K., Dorr, A., Hetzer-Egger, C., Kiermer, V., Henklein, P., Schnoelzer, M., Loret,
E., Cole, P. A., Verdin, E., and Ott, M. (2003). Acetylation of Tat defines a cyclinT1independent step in HIV transactivation. Mol Cell 12(1), 167-76.
Kagan, B. L., Baldwin, R. L., Munoz, D., and Wisnieski, B. J. (1992). Formation of ionpermeable channels by tumor necrosis factor-alpha. Science 255(5050), 1427-30.
Kalkhoven, E. (2004). CBP and p300: HATs for different occasions. Biochem Pharmacol
68(6), 1145-55.
Kamine, J., Elangovan, B., Subramanian, T., Coleman, D., and Chinnadurai, G. (1996).
Identification of a cellular protein that specifically interacts with the essential cysteine
region of the HIV-1 Tat transactivator. Virology 216(2), 357-66.
Kanmogne, G. D., Kennedy, R. C., and Grammas, P. (2001). Analysis of human lung
endothelial cells for susceptibility to HIV type 1 infection, coreceptor expression, and
cytotoxicity of gp120 protein. AIDS Res Hum Retroviruses 17(1), 45-53.
Kanmogne, G. D., Kennedy, R. C., and Grammas, P. (2002). HIV-1 gp120 proteins and
gp160 peptides are toxic to brain endothelial cells and neurons: possible pathway for
HIV entry into the brain and HIV-associated dementia. J Neuropathol Exp Neurol
61(11), 992-1000.
Kanmogne, G. D., Primeaux, C., and Grammas, P. (2005). HIV-1 gp120 proteins alter tight
junction protein expression and brain endothelial cell permeability: implications for
the pathogenesis of HIV-associated dementia. J Neuropathol Exp Neurol 64(6), 498505.
Kao, S., Akari, H., Khan, M. A., Dettenhofer, M., Yu, X. F., and Strebel, K. (2003). Human
immunodeficiency virus type 1 Vif is efficiently packaged into virions during
productive but not chronic infection. J Virol 77(2), 1131-40.
Kao, S. Y., Calman, A. F., Luciw, P. A., and Peterlin, B. M. (1987). Anti-termination of
transcription within the long terminal repeat of HIV-1 by tat gene product. Nature
330(6147), 489-93.
Kariko, K., Buckstein, M., Ni, H., and Weissman, D. (2005). Suppression of RNA recognition
by Toll-like receptors: the impact of nucleoside modification and the evolutionary
origin of RNA. Immunity 23(2), 165-75.
Karin, M., and Ben-Neriah, Y. (2000). Phosphorylation meets ubiquitination: the control of
NF-[kappa]B activity. Annu Rev Immunol 18, 621-63.
Karin, M., and Delhase, M. (2000). The I kappa B kinase (IKK) and NF-kappa B: key
elements of proinflammatory signalling. Semin Immunol 12(1), 85-98.
Kashanchi, F., Piras, G., Radonovich, M. F., Duvall, J. F., Fattaey, A., Chiang, C. M., Roeder,
R. G., and Brady, J. N. (1994). Direct interaction of human TFIID with the HIV-1
transactivator tat. Nature 367(6460), 295-9.
Kashanchi, F., Sadaie, M. R., and Brady, J. N. (1997). Inhibition of HIV-1 transcription and
virus replication using soluble Tat peptide analogs. Virology 227(2), 431-8.
Kataoka, K., Muta, T., Yamazaki, S., and Takeshige, K. (2002). Activation of macrophages
by linear (1right-arrow3)-beta-D-glucans. Impliations for the recognition of fungi by
innate immunity. J Biol Chem 277(39), 36825-31.
205
Kato, H., Sato, S., Yoneyama, M., Yamamoto, M., Uematsu, S., Matsui, K., Tsujimura, T.,
Takeda, K., Fujita, T., Takeuchi, O., and Akira, S. (2005). Cell type-specific
involvement of RIG-I in antiviral response. Immunity 23(1), 19-28.
Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S.,
Jung, A., Kawai, T., Ishii, K. J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C. S.,
Reis e Sousa, C., Matsuura, Y., Fujita, T., and Akira, S. (2006). Differential roles of
MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441(7089),
101-5.
Katoh, I., Ikawa, Y., and Yoshinaka, Y. (1989). Retrovirus protease characterized as a dimeric
aspartic proteinase. J Virol 63(5), 2226-32.
Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999). Unresponsiveness of
MyD88-deficient mice to endotoxin. Immunity 11(1), 115-22.
Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K. J., Takeuchi, O.,
and Akira, S. (2005). IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I
interferon induction. Nat Immunol 6(10), 981-8.
Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and
Akira, S. (2001). Lipopolysaccharide stimulates the MyD88-independent pathway and
results in activation of IFN-regulatory factor 3 and the expression of a subset of
lipopolysaccharide-inducible genes. J Immunol 167(10), 5887-94.
Kawamura, T., Gulden, F. O., Sugaya, M., McNamara, D. T., Borris, D. L., Lederman, M.
M., Orenstein, J. M., Zimmerman, P. A., and Blauvelt, A. (2003). R5 HIV
productively infects Langerhans cells, and infection levels are regulated by compound
CCR5 polymorphisms. Proc Natl Acad Sci U S A 100(14), 8401-6.
Kawasaki, K., Gomi, K., and Nishijima, M. (2001). Cutting edge: Gln22 of mouse MD-2 is
essential for species-specific lipopolysaccharide mimetic action of taxol. J Immunol
166(1), 11-4.
Kedzierska, K., and Crowe, S. M. (2001). Cytokines and HIV-1: interactions and clinical
implications. Antivir Chem Chemother 12(3), 133-50.
Kedzierska, K., Crowe, S. M., Turville, S., and Cunningham, A. L. (2003). The influence of
cytokines, chemokines and their receptors on HIV-1 replication in monocytes and
macrophages. Rev Med Virol 13(1), 39-56.
Kelliher, M. A., Grimm, S., Ishida, Y., Kuo, F., Stanger, B. Z., and Leder, P. (1998). The
death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity
8(3), 297-303.
Kelly, J. P., and Bancroft, G. J. (1996). Administration of interleukin-10 abolishes innate
resistance to Listeria monocytogenes. Eur J Immunol 26(2), 356-64.
Kemp, B. E., and Pearson, R. B. (1990). Protein kinase recognition sequence motifs. Trends
Biochem Sci 15(9), 342-6.
Kestler, H. W., 3rd, Ringler, D. J., Mori, K., Panicali, D. L., Sehgal, P. K., Daniel, M. D., and
Desrosiers, R. C. (1991). Importance of the nef gene for maintenance of high virus
loads and for development of AIDS. Cell 65(4), 651-62.
Khorasanizadeh, S. (2004). The nucleosome: from genomic organization to genomic
regulation. Cell 116(2), 259-72.
Kiernan, R. E., Vanhulle, C., Schiltz, L., Adam, E., Xiao, H., Maudoux, F., Calomme, C.,
Burny, A., Nakatani, Y., Jeang, K. T., Benkirane, M., and Van Lint, C. (1999). HIV-1
tat transcriptional activity is regulated by acetylation. Embo J 18(21), 6106-18.
Kim, C. H., and Broxmeyer, H. E. (1999). Chemokines: signal lamps for trafficking of T and
B cells for development and effector function. J Leukoc Biol 65(1), 6-15.
206
Kim, T. A., Avraham, H. K., Koh, Y. H., Jiang, S., Park, I. W., and Avraham, S. (2003). HIV1 Tat-mediated apoptosis in human brain microvascular endothelial cells. J Immunol
170(5), 2629-37.
Kino, T., Gragerov, A., Kopp, J. B., Stauber, R. H., Pavlakis, G. N., and Chrousos, G. P.
(1999). The HIV-1 virion-associated protein vpr is a coactivator of the human
glucocorticoid receptor. J Exp Med 189(1), 51-62.
Kino, T., Gragerov, A., Slobodskaya, O., Tsopanomichalou, M., Chrousos, G. P., and
Pavlakis, G. N. (2002). Human immunodeficiency virus type 1 (HIV-1) accessory
protein Vpr induces transcription of the HIV-1 and glucocorticoid-responsive
promoters by binding directly to p300/CBP coactivators. J Virol 76(19), 9724-34.
Kishore, N., Huynh, Q. K., Mathialagan, S., Hall, T., Rouw, S., Creely, D., Lange, G., Caroll,
J., Reitz, B., Donnelly, A., Boddupalli, H., Combs, R. G., Kretzmer, K., and Tripp, C.
S. (2002). IKK-i and TBK-1 are enzymatically distinct from the homologous enzyme
IKK-2: comparative analysis of recombinant human IKK-i, TBK-1, and IKK-2. J Biol
Chem 277(16), 13840-7.
Klein, S. A., Dobmeyer, J. M., Dobmeyer, T. S., Pape, M., Ottmann, O. G., Helm, E. B.,
Hoelzer, D., and Rossol, R. (1997). Demonstration of the Th1 to Th2 cytokine shift
during the course of HIV-1 infection using cytoplasmic cytokine detection on single
cell level by flow cytometry. Aids 11(9), 1111-8.
Knappe, A., Hor, S., Wittmann, S., and Fickenscher, H. (2000). Induction of a novel cellular
homolog of interleukin-10, AK155, by transformation of T lymphocytes with
herpesvirus saimiri. J Virol 74(8), 3881-7.
Kolson, D. L., and Gonzalez-Scarano, F. (2000). HIV and HIV dementia. J Clin Invest
106(1), 11-3.
Korber, B., Muldoon, M., Theiler, J., Gao, F., Gupta, R., Lapedes, A., Hahn, B. H., Wolinsky,
S., and Bhattacharya, T. (2000). Timing the ancestor of the HIV-1 pandemic strains.
Science 288(5472), 1789-96.
Korber, B. T., Allen, E. E., Farmer, A. D., and Myers, G. L. (1995). Heterogeneity of HIV-1
and HIV-2. Aids 9 Suppl A, S5-18.
Kotenko, S. V. (2002). The family of IL-10-related cytokines and their receptors: related, but
to what extent? Cytokine Growth Factor Rev 13(3), 223-40.
Kotenko, S. V., Krause, C. D., Izotova, L. S., Pollack, B. P., Wu, W., and Pestka, S. (1997).
Identification and functional characterization of a second chain of the interleukin-10
receptor complex. Embo J 16(19), 5894-903.
Kotenko, S. V., Saccani, S., Izotova, L. S., Mirochnitchenko, O. V., and Pestka, S. (2000).
Human cytomegalovirus harbors its own unique IL-10 homolog (cmvIL-10). Proc
Natl Acad Sci U S A 97(4), 1695-700.
Kotov, A., Zhou, J., Flicker, P., and Aiken, C. (1999). Association of Nef with the human
immunodeficiency virus type 1 core. J Virol 73(10), 8824-30.
Koul, D., Yao, Y., Abbruzzese, J. L., Yung, W. K., and Reddy, S. A. (2001). Tumor
suppressor MMAC/PTEN inhibits cytokine-induced NFkappaB activation without
interfering with the IkappaB degradation pathway. J Biol Chem 276(14), 11402-8.
Koup, R. A., Safrit, J. T., Cao, Y., Andrews, C. A., McLeod, G., Borkowsky, W., Farthing,
C., and Ho, D. D. (1994). Temporal association of cellular immune responses with the
initial control of viremia in primary human immunodeficiency virus type 1 syndrome.
J Virol 68(7), 4650-5.
Kouzarides, T. (2002). Histone methylation in transcriptional control. Curr Opin Genet Dev
12(2), 198-209.
207
Kozak, S. L., Heard, J. M., and Kabat, D. (2002). Segregation of CD4 and CXCR4 into
distinct lipid microdomains in T lymphocytes suggests a mechanism for membrane
destabilization by human immunodeficiency virus. J Virol 76(4), 1802-15.
Krown, S. E., Lee, J. Y., Lin, L., Fischl, M. A., Ambinder, R., and Von Roenn, J. H. (2006).
Interferon-alpha2b with protease inhibitor-based antiretroviral therapy in patients with
AIDS-associated Kaposi sarcoma: an AIDS malignancy consortium phase I trial. J
Acquir Immune Defic Syndr 41(2), 149-53.
Kumar, A., Angel, J. B., Aucoin, S., Creery, W. D., Daftarian, M. P., Cameron, D. W., Filion,
L., and Diaz-Mitoma, F. (1999). Dysregulation of B7.2 (CD86) expression on
monocytes of HIV-infected individuals is associated with altered production of IL-2.
Clin Exp Immunol 117(1), 84-91.
Kumar, A., Angel, J. B., Daftarian, M. P., Parato, K., Cameron, W. D., Filion, L., and DiazMitoma, F. (1998). Differential production of IL-10 by T cells and monocytes of HIVinfected individuals: association of IL-10 production with CD28-mediated immune
responsiveness. Clin Exp Immunol 114(1), 78-86.
Kumarvelu, J., Shanmugasundaram, G. K., Unwalla, H., Ramamoorti, N., and Banerjea, A. C.
(2001). Genetic analyses of the promoter region of interleukin-10 gene in different
species of monkeys: implications for HIV/AIDS progression. Genes Immun 2(7), 4047.
Kuritzkes, D. R., Jacobson, J., Powderly, W. G., Godofsky, E., DeJesus, E., Haas, F.,
Reimann, K. A., Larson, J. L., Yarbough, P. O., Curt, V., and Shanahan, W. R., Jr.
(2004). Antiretroviral activity of the anti-CD4 monoclonal antibody TNX-355 in
patients infected with HIV type 1. J Infect Dis 189(2), 286-91.
Kurt-Jones, E. A., Popova, L., Kwinn, L., Haynes, L. M., Jones, L. P., Tripp, R. A., Walsh, E.
E., Freeman, M. W., Golenbock, D. T., Anderson, L. J., and Finberg, R. W. (2000).
Pattern recognition receptors TLR4 and CD14 mediate response to respiratory
syncytial virus. Nat Immunol 1(5), 398-401.
Kwong, P. D., Wyatt, R., Robinson, J., Sweet, R. W., Sodroski, J., and Hendrickson, W. A.
(1998). Structure of an HIV gp120 envelope glycoprotein in complex with the CD4
receptor and a neutralizing human antibody. Nature 393(6686), 648-59.
Kyriakis, J. M., and Avruch, J. (2001). Mammalian mitogen-activated protein kinase signal
transduction pathways activated by stress and inflammation. Physiol Rev 81(2), 80769.
Lafon, M. E., Gendrault, J. L., Royer, C., Jaeck, D., Kirn, A., and Steffan, A. M. (1993).
Human endothelial cells isolated from the hepatic sinusoids and the umbilical vein
display a different permissiveness for HIV1. Res Virol 144(1), 99-104.
Lalezari, J. P., Henry, K., O'Hearn, M., Montaner, J. S., Piliero, P. J., Trottier, B., Walmsley,
S., Cohen, C., Kuritzkes, D. R., Eron, J. J., Jr., Chung, J., DeMasi, R., Donatacci, L.,
Drobnes, C., Delehanty, J., and Salgo, M. (2003). Enfuvirtide, an HIV-1 fusion
inhibitor, for drug-resistant HIV infection in North and South America. N Engl J Med
348(22), 2175-85.
Lamaze, C., Dujeancourt, A., Baba, T., Lo, C. G., Benmerah, A., and Dautry-Varsat, A.
(2001). Interleukin 2 receptors and detergent-resistant membrane domains define a
clathrin-independent endocytic pathway. Mol Cell 7(3), 661-71.
Lapenta, C., Santini, S. M., Proietti, E., Rizza, P., Logozzi, M., Spada, M., Parlato, S., Fais,
S., Pitha, P. M., and Belardelli, F. (1999). Type I interferon is a powerful inhibitor of
in vivo HIV-1 infection and preserves human CD4(+) T cells from virus-induced
depletion in SCID mice transplanted with human cells. Virology 263(1), 78-88.
Larkin, M., Childs, R. A., Matthews, T. J., Thiel, S., Mizuochi, T., Lawson, A. M., Savill, J.
S., Haslett, C., Diaz, R., and Feizi, T. (1989). Oligosaccharide-mediated interactions
208
of the envelope glycoprotein gp120 of HIV-1 that are independent of CD4
recognition. Aids 3(12), 793-8.
Larrick, J. W., and Wright, S. C. (1990). Cytotoxic mechanism of tumor necrosis factor-alpha.
Faseb J 4(14), 3215-23.
Lawler, S., Fleming, Y., Goedert, M., and Cohen, P. (1998). Synergistic activation of
SAPK1/JNK1 by two MAP kinase kinases in vitro. Curr Biol 8(25), 1387-90.
Lawrence, D. M., and Major, E. O. (2002). HIV-1 and the brain: connections between HIV-1associated dementia, neuropathology and neuroimmunology. Microbes Infect 4(3),
301-8.
Le Good, J. A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., and Parker, P. J.
(1998). Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the
protein kinase PDK1. Science 281(5385), 2042-5.
Le Page, C., Genin, P., Baines, M. G., and Hiscott, J. (2000). Interferon activation and innate
immunity. Rev Immunogenet 2(3), 374-86.
Lecoq, A., Moine, G., Bellanger, L., Drevet, P., Thai, R., Lajeunesse, E., Menez, A., and
Leonetti, M. (2008). Increasing the humoral immunogenic properties of the HIV-1 Tat
protein using a ligand-stabilizing strategy. Vaccine 26(21), 2615-26.
Lecossier, D., Bouchonnet, F., Clavel, F., and Hance, A. J. (2003). Hypermutation of HIV-1
DNA in the absence of the Vif protein. Science 300(5622), 1112.
Lee, C., Liu, Q. H., Tomkowicz, B., Yi, Y., Freedman, B. D., and Collman, R. G. (2003a).
Macrophage activation through CCR5- and CXCR4-mediated gp120-elicited signaling
pathways. J Leukoc Biol 74(5), 676-82.
Lee, N., Hogg, R. S., Yip, B., Harrigan, P. R., Harris, M., O'Shaughnessy, M. V., and
Montaner, J. S. (2003b). Rates of disease progression among human
immunodeficiency virus-infected persons initiating multiple-drug rescue therapy. J
Infect Dis 188(1), 137-41.
Lee, S. H., and Hannink, M. (2002). Characterization of the nuclear import and export
functions of Ikappa B(epsilon). J Biol Chem 277(26), 23358-66.
Leghmari, K., Bennasser, Y., Tkaczuk, J., and Bahraoui, E. (2008). HIV-1 Tat protein induces
IL-10 production by an alternative TNF-alpha-independent pathway in monocytes:
Role of PKC-delta and p38 MAP kinase. Cell Immunol.
Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J. M., and Hoffmann, J. A. (1996). The
dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal
response in Drosophila adults. Cell 86(6), 973-83.
Lemey, P., Pybus, O. G., Wang, B., Saksena, N. K., Salemi, M., and Vandamme, A. M.
(2003). Tracing the origin and history of the HIV-2 epidemic. Proc Natl Acad Sci U S
A 100(11), 6588-92.
Lemp, G. F., Payne, S. F., Neal, D., Temelso, T., and Rutherford, G. W. (1990). Survival
trends for patients with AIDS. Jama 263(3), 402-6.
Levy, J. A. (1993). Pathogenesis of human immunodeficiency virus infection. Microbiol Rev
57(1), 183-289.
Levy, Y., Durier, C., Krzysiek, R., Rabian, C., Capitant, C., Lascaux, A. S., Michon, C.,
Oksenhendler, E., Weiss, L., Gastaut, J. A., Goujard, C., Rouzioux, C., Maral, J.,
Delfraissy, J. F., Emilie, D., and Aboulker, J. P. (2003). Effects of interleukin-2
therapy combined with highly active antiretroviral therapy on immune restoration in
HIV-1 infection: a randomized controlled trial. Aids 17(3), 343-51.
Li, F., Goila-Gaur, R., Salzwedel, K., Kilgore, N. R., Reddick, M., Matallana, C., Castillo, A.,
Zoumplis, D., Martin, D. E., Orenstein, J. M., Allaway, G. P., Freed, E. O., and Wild,
C. T. (2003). PA-457: a potent HIV inhibitor that disrupts core condensation by
targeting a late step in Gag processing. Proc Natl Acad Sci U S A 100(23), 13555-60.
209
Li, J. C., and Lau, A. S. (2007). A role for mitogen-activated protein kinase and Ets-1 in the
induction of interleukin-10 transcription by human immunodeficiency virus-1 Tat.
Immunology 121(3), 337-48.
Li, J. C., Lee, D. C., Cheung, B. K., and Lau, A. S. (2005). Mechanisms for HIV Tat
upregulation of IL-10 and other cytokine expression: kinase signaling and PKRmediated immune response. FEBS Lett 579(14), 3055-62.
Li, L., Olvera, J. M., Yoder, K. E., Mitchell, R. S., Butler, S. L., Lieber, M., Martin, S. L., and
Bushman, F. D. (2001). Role of the non-homologous DNA end joining pathway in the
early steps of retroviral infection. Embo J 20(12), 3272-81.
Li, Q., Lu, Q., Hwang, J. Y., Buscher, D., Lee, K. F., Izpisua-Belmonte, J. C., and Verma, I.
M. (1999). IKK1-deficient mice exhibit abnormal development of skin and skeleton.
Genes Dev 13(10), 1322-8.
Li, S. W., Westwick, J., and Poll, C. T. (2002). Receptor-operated Ca2+ influx channels in
leukocytes: a therapeutic target? Trends Pharmacol Sci 23(2), 63-70.
Liao, Z., Graham, D. R., and Hildreth, J. E. (2003). Lipid rafts and HIV pathogenesis: virionassociated cholesterol is required for fusion and infection of susceptible cells. AIDS
Res Hum Retroviruses 19(8), 675-87.
Lien, E., Means, T. K., Heine, H., Yoshimura, A., Kusumoto, S., Fukase, K., Fenton, M. J.,
Oikawa, M., Qureshi, N., Monks, B., Finberg, R. W., Ingalls, R. R., and Golenbock,
D. T. (2000). Toll-like receptor 4 imparts ligand-specific recognition of bacterial
lipopolysaccharide. J Clin Invest 105(4), 497-504.
Lin, L., and Ghosh, S. (1996). A glycine-rich region in NF-kappaB p105 functions as a
processing signal for the generation of the p50 subunit. Mol Cell Biol 16(5), 2248-54.
Lin, P. F., Blair, W., Wang, T., Spicer, T., Guo, Q., Zhou, N., Gong, Y. F., Wang, H. G.,
Rose, R., Yamanaka, G., Robinson, B., Li, C. B., Fridell, R., Deminie, C., Demers, G.,
Yang, Z., Zadjura, L., Meanwell, N., and Colonno, R. (2003). A small molecule HIV1 inhibitor that targets the HIV-1 envelope and inhibits CD4 receptor binding. Proc
Natl Acad Sci U S A 100(19), 11013-8.
Ling, L., Cao, Z., and Goeddel, D. V. (1998). NF-kappaB-inducing kinase activates IKKalpha by phosphorylation of Ser-176. Proc Natl Acad Sci U S A 95(7), 3792-7.
Liu, W. S., and Heckman, C. A. (1998). The sevenfold way of PKC regulation. Cell Signal
10(8), 529-42.
Liu, X., Zhang, X. F., Zheng, Z. W., Lu, H., Wu, X., Huang, C., Wang, C., and Guang, G.
(2004). The effect of chemotherapy combined with recombination mutant human
tumor necrosis factor on advanced cancer. J Transl Med 2(1), 33.
Liu, Y., Jones, M., Hingtgen, C. M., Bu, G., Laribee, N., Tanzi, R. E., Moir, R. D., Nath, A.,
and He, J. J. (2000). Uptake of HIV-1 tat protein mediated by low-density lipoprotein
receptor-related protein disrupts the neuronal metabolic balance of the receptor
ligands. Nat Med 6(12), 1380-7.
Liu, Y., Wei, S. H., Ho, A. S., de Waal Malefyt, R., and Moore, K. W. (1994). Expression
cloning and characterization of a human IL-10 receptor. J Immunol 152(4), 1821-9.
Livingstone, W. J., Moore, M., Innes, D., Bell, J. E., and Simmonds, P. (1996). Frequent
infection of peripheral blood CD8-positive T-lymphocytes with HIV-1. Edinburgh
Heterosexual Transmission Study Group. Lancet 348(9028), 649-54.
Lockridge, K. M., Zhou, S. S., Kravitz, R. H., Johnson, J. L., Sawai, E. T., Blewett, E. L., and
Barry, P. A. (2000). Primate cytomegaloviruses encode and express an IL-10-like
protein. Virology 268(2), 272-80.
Loeb, D. D., Hutchison, C. A., 3rd, Edgell, M. H., Farmerie, W. G., and Swanstrom, R.
(1989). Mutational analysis of human immunodeficiency virus type 1 protease
suggests functional homology with aspartic proteinases. J Virol 63(1), 111-21.
210
Loetscher, H., Gentz, R., Zulauf, M., Lustig, A., Tabuchi, H., Schlaeger, E. J., Brockhaus, M.,
Gallati, H., Manneberg, M., and Lesslauer, W. (1991). Recombinant 55-kDa tumor
necrosis factor (TNF) receptor. Stoichiometry of binding to TNF alpha and TNF beta
and inhibition of TNF activity. J Biol Chem 266(27), 18324-9.
Long, K. S., and Crothers, D. M. (1999). Characterization of the solution conformations of
unbound and Tat peptide-bound forms of HIV-1 TAR RNA. Biochemistry 38(31),
10059-69.
Loret, E. P., Georgel, P., Johnson, W. C., Jr., and Ho, P. S. (1992). Circular dichroism and
molecular modeling yield a structure for the complex of human immunodeficiency
virus type 1 trans-activation response RNA and the binding region of Tat, the transacting transcriptional activator. Proc Natl Acad Sci U S A 89(20), 9734-8.
Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (1997).
Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature
389(6648), 251-60.
Maddon, P. J., Dalgleish, A. G., McDougal, J. S., Clapham, P. R., Weiss, R. A., and Axel, R.
(1986). The T4 gene encodes the AIDS virus receptor and is expressed in the immune
system and the brain. Cell 47(3), 333-48.
Maggi, E., Mazzetti, M., Ravina, A., Annunziato, F., de Carli, M., Piccinni, M. P., Manetti,
R., Carbonari, M., Pesce, A. M., del Prete, G., and et al. (1994). Ability of HIV to
promote a TH1 to TH0 shift and to replicate preferentially in TH2 and TH0 cells.
Science 265(5169), 244-8.
Maggiorella, M. T., Baroncelli, S., Michelini, Z., Fanales-Belasio, E., Moretti, S., Sernicola,
L., Cara, A., Negri, D. R., Butto, S., Fiorelli, V., Tripiciano, A., Scoglio, A., Caputo,
A., Borsetti, A., Ridolfi, B., Bona, R., ten Haaft, P., Macchia, I., Leone, P., PavoneCossut, M. R., Nappi, F., Ciccozzi, M., Heeney, J., Titti, F., Cafaro, A., and Ensoli, B.
(2004). Long-term protection against SHIV89.6P replication in HIV-1 Tat vaccinated
cynomolgus monkeys. Vaccine 22(25-26), 3258-69.
Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997). A small ubiquitinrelated polypeptide involved in targeting RanGAP1 to nuclear pore complex protein
RanBP2. Cell 88(1), 97-107.
Mahlknecht, U., and Herbein, G. (2001). Macrophages and T-cell apoptosis in HIV infection:
a leading role for accessory cells? Trends Immunol 22(5), 256-60.
Maier, H. J., Marienfeld, R., Wirth, T., and Baumann, B. (2003). Critical role of RelB serine
368 for dimerization and p100 stabilization. J Biol Chem 278(40), 39242-50.
Malek, S., Chen, Y., Huxford, T., and Ghosh, G. (2001). IkappaBbeta, but not IkappaBalpha,
functions as a classical cytoplasmic inhibitor of NF-kappaB dimers by masking both
NF-kappaB nuclear localization sequences in resting cells. J Biol Chem 276(48),
45225-35.
Malim, M. H., McCarn, D. F., Tiley, L. S., and Cullen, B. R. (1991). Mutational definition of
the human immunodeficiency virus type 1 Rev activation domain. J Virol 65(8), 424854.
Malinin, N. L., Boldin, M. P., Kovalenko, A. V., and Wallach, D. (1997). MAP3K-related
kinase involved in NF-kappaB induction by TNF, CD95 and IL-1. Nature 385(6616),
540-4.
Mangeat, B., Turelli, P., Caron, G., Friedli, M., Perrin, L., and Trono, D. (2003). Broad
antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse
transcripts. Nature 424(6944), 99-103.
Mani, S., Rudin, C. M., Kunkel, K., Holmlund, J. T., Geary, R. S., Kindler, H. L., Dorr, F. A.,
and Ratain, M. J. (2002). Phase I clinical and pharmacokinetic study of protein kinase
C-alpha antisense oligonucleotide ISIS 3521 administered in combination with 5-
211
fluorouracil and leucovorin in patients with advanced cancer. Clin Cancer Res 8(4),
1042-8.
Mann, D. A., and Frankel, A. D. (1991). Endocytosis and targeting of exogenous HIV-1 Tat
protein. Embo J 10(7), 1733-9.
Mansell, A., Brint, E., Gould, J. A., O'Neill, L. A., and Hertzog, P. J. (2004). Mal interacts
with tumor necrosis factor receptor-associated factor (TRAF)-6 to mediate NF-kappaB
activation by toll-like receptor (TLR)-2 and TLR4. J Biol Chem 279(36), 37227-30.
Marchisone, C., Benelli, R., Albini, A., Santi, L., and Noonan, D. M. (1999). Inhibition of
angiogenesis by type I interferons in models of Kaposi's sarcoma. Int J Biol Markers
14(4), 257-62.
Marechal, V., Clavel, F., Heard, J. M., and Schwartz, O. (1998). Cytosolic Gag p24 as an
index of productive entry of human immunodeficiency virus type 1. J Virol 72(3),
2208-12.
Margottin, F., Bour, S. P., Durand, H., Selig, L., Benichou, S., Richard, V., Thomas, D.,
Strebel, K., and Benarous, R. (1998). A novel human WD protein, h-beta TrCp, that
interacts with HIV-1 Vpu connects CD4 to the ER degradation pathway through an Fbox motif. Mol Cell 1(4), 565-74.
Marienfeld, R., Berberich-Siebelt, F., Berberich, I., Denk, A., Serfling, E., and Neumann, M.
(2001). Signal-specific and phosphorylation-dependent RelB degradation: a potential
mechanism of NF-kappaB control. Oncogene 20(56), 8142-7.
Marshall, J. D., Chehimi, J., Gri, G., Kostman, J. R., Montaner, L. J., and Trinchieri, G.
(1999). The interleukin-12-mediated pathway of immune events is dysfunctional in
human immunodeficiency virus-infected individuals. Blood 94(3), 1003-11.
Martin, A. G., and Fresno, M. (2000). Tumor necrosis factor-alpha activation of NF-kappa B
requires the phosphorylation of Ser-471 in the transactivation domain of c-Rel. J Biol
Chem 275(32), 24383-91.
Marzio, G., Tyagi, M., Gutierrez, M. I., and Giacca, M. (1998). HIV-1 tat transactivator
recruits p300 and CREB-binding protein histone acetyltransferases to the viral
promoter. Proc Natl Acad Sci U S A 95(23), 13519-24.
Masood, R., Lunardi-Iskandar, Y., Moudgil, T., Zhang, Y., Law, R. E., Huang, C. L., Puri, R.
K., Levine, A. M., and Gill, P. S. (1994). IL-10 inhibits HIV-1 replication and is
induced by tat. Biochem Biophys Res Commun 202(1), 374-83.
Massari, P., Henneke, P., Ho, Y., Latz, E., Golenbock, D. T., and Wetzler, L. M. (2002).
Cutting edge: Immune stimulation by neisserial porins is toll-like receptor 2 and
MyD88 dependent. J Immunol 168(4), 1533-7.
Massiah, M. A., Starich, M. R., Paschall, C., Summers, M. F., Christensen, A. M., and
Sundquist, W. I. (1994). Three-dimensional structure of the human immunodeficiency
virus type 1 matrix protein. J Mol Biol 244(2), 198-223.
May, M. J., and Ghosh, S. (1997). Rel/NF-kappa B and I kappa B proteins: an overview.
Semin Cancer Biol 8(2), 63-73.
Mayne, M., Holden, C. P., Nath, A., and Geiger, J. D. (2000). Release of calcium from
inositol 1,4,5-trisphosphate receptor-regulated stores by HIV-1 Tat regulates TNFalpha production in human macrophages. J Immunol 164(12), 6538-42.
McBride, A. E., Cook, J. T., Stemmler, E. A., Rutledge, K. L., McGrath, K. A., and Rubens,
J. A. (2005). Arginine methylation of yeast mRNA-binding protein Npl3 directly
affects its function, nuclear export, and intranuclear protein interactions. J Biol Chem
280(35), 30888-98.
McCloskey, T. W., Ott, M., Tribble, E., Khan, S. A., Teichberg, S., Paul, M. O., Pahwa, S.,
Verdin, E., and Chirmule, N. (1997). Dual role of HIV Tat in regulation of apoptosis
in T cells. J Immunol 158(2), 1014-9.
212
McCubrey, J. A., May, W. S., Duronio, V., and Mufson, A. (2000). Serine/threonine
phosphorylation in cytokine signal transduction. Leukemia 14(1), 9-21.
McCune, J. M., Rabin, L. B., Feinberg, M. B., Lieberman, M., Kosek, J. C., Reyes, G. R., and
Weissman, I. L. (1988). Endoproteolytic cleavage of gp160 is required for the
activation of human immunodeficiency virus. Cell 53(1), 55-67.
McDonald, D., Vodicka, M. A., Lucero, G., Svitkina, T. M., Borisy, G. G., Emerman, M., and
Hope, T. J. (2002). Visualization of the intracellular behavior of HIV in living cells. J
Cell Biol 159(3), 441-52.
McMichael, A. J., and Hanke, T. (2003). HIV vaccines 1983-2003. Nat Med 9(7), 874-80.
McMillan, N. A., Chun, R. F., Siderovski, D. P., Galabru, J., Toone, W. M., Samuel, C. E.,
Mak, T. W., Hovanessian, A. G., Jeang, K. T., and Williams, B. R. (1995). HIV-1 Tat
directly interacts with the interferon-induced, double-stranded RNA-dependent kinase,
PKR. Virology 213(2), 413-24.
Medzhitov, R., and Janeway, C. A., Jr. (1997). Innate immunity: the virtues of a nonclonal
system of recognition. Cell 91(3), 295-8.
Medzhitov, R., Preston-Hurlburt, P., and Janeway, C. A., Jr. (1997). A human homologue of
the Drosophila Toll protein signals activation of adaptive immunity. Nature
388(6640), 394-7.
Mehle, A., Strack, B., Ancuta, P., Zhang, C., McPike, M., and Gabuzda, D. (2004). Vif
overcomes the innate antiviral activity of APOBEC3G by promoting its degradation in
the ubiquitin-proteasome pathway. J Biol Chem 279(9), 7792-8.
Meller, N., Liu, Y. C., Collins, T. L., Bonnefoy-Berard, N., Baier, G., Isakov, N., and Altman,
A. (1996). Direct interaction between protein kinase C theta (PKC theta) and 14-3-3
tau in T cells: 14-3-3 overexpression results in inhibition of PKC theta translocation
and function. Mol Cell Biol 16(10), 5782-91.
Mellstrom, B., and Naranjo, J. R. (2001). Ca2+-dependent transcriptional repression and
derepression: DREAM, a direct effector. Semin Cell Dev Biol 12(1), 59-63.
Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J., Young, D. B.,
Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997). IKK-1 and IKK-2:
cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science
278(5339), 860-6.
Mergia, A., Shaw, K. E., Pratt-Lowe, E., Barry, P. A., and Luciw, P. A. (1991). Identification
of the simian foamy virus transcriptional transactivator gene (taf). J Virol 65(6), 29039.
Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., and
Tschopp, J. (2005). Cardif is an adaptor protein in the RIG-I antiviral pathway and is
targeted by hepatitis C virus. Nature 437(7062), 1167-72.
Miao, E. A., Alpuche-Aranda, C. M., Dors, M., Clark, A. E., Bader, M. W., Miller, S. I., and
Aderem, A. (2006). Cytoplasmic flagellin activates caspase-1 and secretion of
interleukin 1beta via Ipaf. Nat Immunol 7(6), 569-75.
Micheau, O., and Tschopp, J. (2003). Induction of TNF receptor I-mediated apoptosis via two
sequential signaling complexes. Cell 114(2), 181-90.
Mineo, C., Ying, Y. S., Chapline, C., Jaken, S., and Anderson, R. G. (1998). Targeting of
protein kinase Calpha to caveolae. J Cell Biol 141(3), 601-10.
Miyake, K., Yamashita, Y., Ogata, M., Sudo, T., and Kimoto, M. (1995). RP105, a novel B
cell surface molecule implicated in B cell activation, is a member of the leucine-rich
repeat protein family. J Immunol 154(7), 3333-40.
Mizel, S. B., West, A. P., and Hantgan, R. R. (2003). Identification of a sequence in human
toll-like receptor 5 required for the binding of Gram-negative flagellin. J Biol Chem
278(26), 23624-9.
213
Mocellin, S., Panelli, M. C., Wang, E., Nagorsen, D., and Marincola, F. M. (2003). The dual
role of IL-10. Trends Immunol 24(1), 36-43.
Mondor, I., Ugolini, S., and Sattentau, Q. J. (1998). Human immunodeficiency virus type 1
attachment to HeLa CD4 cells is CD4 independent and gp120 dependent and requires
cell surface heparans. J Virol 72(5), 3623-34.
Monick, M. M., Carter, A. B., Gudmundsson, G., Geist, L. J., and Hunninghake, G. W.
(1998). Changes in PKC isoforms in human alveolar macrophages compared with
blood monocytes. Am J Physiol 275(2 Pt 1), L389-97.
Montano, M. A., Novitsky, V. A., Blackard, J. T., Cho, N. L., Katzenstein, D. A., and Essex,
M. (1997). Divergent transcriptional regulation among expanding human
immunodeficiency virus type 1 subtypes. J Virol 71(11), 8657-65.
Moore, K. W., de Waal Malefyt, R., Coffman, R. L., and O'Garra, A. (2001). Interleukin-10
and the interleukin-10 receptor. Annu Rev Immunol 19, 683-765.
Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T.
R. (1990). Homology of cytokine synthesis inhibitory factor (IL-10) to the EpsteinBarr virus gene BCRFI. Science 248(4960), 1230-4.
Morellet, N., Jullian, N., De Rocquigny, H., Maigret, B., Darlix, J. L., and Roques, B. P.
(1992). Determination of the structure of the nucleocapsid protein NCp7 from the
human immunodeficiency virus type 1 by 1H NMR. Embo J 11(8), 3059-65.
Mori, Y., Wakamori, M., Miyakawa, T., Hermosura, M., Hara, Y., Nishida, M., Hirose, K.,
Mizushima, A., Kurosaki, M., Mori, E., Gotoh, K., Okada, T., Fleig, A., Penner, R.,
Iino, M., and Kurosaki, T. (2002). Transient receptor potential 1 regulates capacitative
Ca(2+) entry and Ca(2+) release from endoplasmic reticulum in B lymphocytes. J Exp
Med 195(6), 673-81.
Morini, M., Benelli, R., Giunciuglio, D., Carlone, S., Arena, G., Noonan, D. M., and Albini,
A. (2000). Kaposi's sarcoma cells of different etiologic origins respond to HIV-Tat
through the Flk-1/KDR (VEGFR-2): relevance in AIDS-KS pathology. Biochem
Biophys Res Commun 273(1), 267-71.
Morita, E., and Sundquist, W. I. (2004). Retrovirus budding. Annu Rev Cell Dev Biol 20, 395425.
Mujtaba, S., He, Y., Zeng, L., Farooq, A., Carlson, J. E., Ott, M., Verdin, E., and Zhou, M. M.
(2002). Structural basis of lysine-acetylated HIV-1 Tat recognition by PCAF
bromodomain. Mol Cell 9(3), 575-86.
Muller, F., Aukrust, P., Lien, E., Haug, C. J., and Froland, S. S. (1998a). Enhanced
interleukin-10 production in response to Mycobacterium avium products in
mononuclear cells from patients with human immunodeficiency virus infection. J
Infect Dis 177(3), 586-94.
Muller, F., Aukrust, P., Nordoy, I., and Froland, S. S. (1998b). Possible role of interleukin-10
(IL-10) and CD40 ligand expression in the pathogenesis of hypergammaglobulinemia
in human immunodeficiency virus infection: modulation of IL-10 and Ig production
after intravenous Ig infusion. Blood 92(10), 3721-9.
Muriaux, D., Mirro, J., Harvin, D., and Rein, A. (2001). RNA is a structural element in
retrovirus particles. Proc Natl Acad Sci U S A 98(9), 5246-51.
Muthumani, K., Choo, A. Y., Hwang, D. S., Premkumar, A., Dayes, N. S., Harris, C., Green,
D. R., Wadsworth, S. A., Siekierka, J. J., and Weiner, D. B. (2005a). HIV-1 Nefinduced FasL induction and bystander killing requires p38 MAPK activation. Blood
106(6), 2059-68.
Muthumani, K., Choo, A. Y., Premkumar, A., Hwang, D. S., Thieu, K. P., Desai, B. M., and
Weiner, D. B. (2005b). Human immunodeficiency virus type 1 (HIV-1) Vpr-regulated
cell death: insights into mechanism. Cell Death Differ 12 Suppl 1, 962-70.
214
Muthumani, K., Wadsworth, S. A., Dayes, N. S., Hwang, D. S., Choo, A. Y., Abeysinghe, H.
R., Siekierka, J. J., and Weiner, D. B. (2004). Suppression of HIV-1 viral replication
and cellular pathogenesis by a novel p38/JNK kinase inhibitor. Aids 18(5), 739-48.
Muzio, M., Bosisio, D., Polentarutti, N., D'Amico, G., Stoppacciaro, A., Mancinelli, R., van't
Veer, C., Penton-Rol, G., Ruco, L. P., Allavena, P., and Mantovani, A. (2000).
Differential expression and regulation of toll-like receptors (TLR) in human
leukocytes: selective expression of TLR3 in dendritic cells. J Immunol 164(11), 59986004.
Muzio, M., Ni, J., Feng, P., and Dixit, V. M. (1997). IRAK (Pelle) family member IRAK-2
and MyD88 as proximal mediators of IL-1 signaling. Science 278(5343), 1612-5.
Nagai, Y., Akashi, S., Nagafuku, M., Ogata, M., Iwakura, Y., Akira, S., Kitamura, T., Kosugi,
A., Kimoto, M., and Miyake, K. (2002). Essential role of MD-2 in LPS responsiveness
and TLR4 distribution. Nat Immunol 3(7), 667-72.
Nagata, K., Puls, A., Futter, C., Aspenstrom, P., Schaefer, E., Nakata, T., Hirokawa, N., and
Hall, A. (1998). The MAP kinase kinase kinase MLK2 co-localizes with activated
JNK along microtubules and associates with kinesin superfamily motor KIF3. Embo J
17(1), 149-58.
Nairn, A. C., and Picciotto, M. R. (1994). Calcium/calmodulin-dependent protein kinases.
Semin Cancer Biol 5(4), 295-303.
Nakano, M. Y., Boucke, K., Suomalainen, M., Stidwill, R. P., and Greber, U. F. (2000). The
first step of adenovirus type 2 disassembly occurs at the cell surface, independently of
endocytosis and escape to the cytosol. J Virol 74(15), 7085-95.
Napolitano, L. A. (2003). Approaches to immune reconstitution in HIV infection. Top HIV
Med 11(5), 160-3.
Nath, A., Conant, K., Chen, P., Scott, C., and Major, E. O. (1999). Transient exposure to
HIV-1 Tat protein results in cytokine production in macrophages and astrocytes. A hit
and run phenomenon. J Biol Chem 274(24), 17098-102.
Neilson, J. R., John, G. C., Carr, J. K., Lewis, P., Kreiss, J. K., Jackson, S., Nduati, R. W.,
Mbori-Ngacha, D., Panteleeff, D. D., Bodrug, S., Giachetti, C., Bott, M. A.,
Richardson, B. A., Bwayo, J., Ndinya-Achola, J., and Overbaugh, J. (1999). Subtypes
of human immunodeficiency virus type 1 and disease stage among women in Nairobi,
Kenya. J Virol 73(5), 4393-403.
Newton, A. C. (1997). Regulation of protein kinase C. Curr Opin Cell Biol 9(2), 161-7.
Nguyen, D. G., and Hildreth, J. E. (2003). Involvement of macrophage mannose receptor in
the binding and transmission of HIV by macrophages. Eur J Immunol 33(2), 483-93.
Nguyen, D. H., and Hildreth, J. E. (2000). Evidence for budding of human immunodeficiency
virus type 1 selectively from glycolipid-enriched membrane lipid rafts. J Virol 74(7),
3264-72.
Nishikawa, K., Toker, A., Johannes, F. J., Songyang, Z., and Cantley, L. C. (1997).
Determination of the specific substrate sequence motifs of protein kinase C isozymes.
J Biol Chem 272(2), 952-60.
Nishizuka, Y. (1988). The heterogeneity and differential expression of multiple species of the
protein kinase C family. Biofactors 1(1), 17-20.
Nishizuka, Y. (1992). Intracellular signaling by hydrolysis of phospholipids and activation of
protein kinase C. Science 258(5082), 607-14.
Noonan, D., and Albini, A. (2000). From the outside in: extracellular activities of HIV Tat.
Adv Pharmacol 48, 229-50.
Novina, C. D., Murray, M. F., Dykxhoorn, D. M., Beresford, P. J., Riess, J., Lee, S. K.,
Collman, R. G., Lieberman, J., Shankar, P., and Sharp, P. A. (2002). siRNA-directed
inhibition of HIV-1 infection. Nat Med 8(7), 681-6.
215
Nowak, L., Bregestovski, P., Ascher, P., Herbet, A., and Prochiantz, A. (1984). Magnesium
gates glutamate-activated channels in mouse central neurones. Nature 307(5950), 4625.
O'Mahony, A. M., Montano, M., Van Beneden, K., Chen, L. F., and Greene, W. C. (2004).
Human T-cell lymphotropic virus type 1 tax induction of biologically Active NFkappaB requires IkappaB kinase-1-mediated phosphorylation of RelA/p65. J Biol
Chem 279(18), 18137-45.
O'Rourke, L., and Shepherd, P. R. (2002). Biphasic regulation of extracellular-signalregulated protein kinase by leptin in macrophages: role in regulating STAT3 Ser727
phosphorylation and DNA binding. Biochem J 364(Pt 3), 875-9.
Ogata, H., Su, I., Miyake, K., Nagai, Y., Akashi, S., Mecklenbrauker, I., Rajewsky, K.,
Kimoto, M., and Tarakhovsky, A. (2000). The toll-like receptor protein RP105
regulates lipopolysaccharide signaling in B cells. J Exp Med 192(1), 23-9.
Ogawa, Y., Kurebayashi, N., and Murayama, T. (2000). Putative roles of type 3 ryanodine
receptor isoforms (RyR3). Trends Cardiovasc Med 10(2), 65-70.
Oh, S. K., Cruikshank, W. W., Raina, J., Blanchard, G. C., Adler, W. H., Walker, J., and
Kornfeld, H. (1992). Identification of HIV-1 envelope glycoprotein in the serum of
AIDS and ARC patients. J Acquir Immune Defic Syndr 5(3), 251-6.
Ohagen, A., and Gabuzda, D. (2000). Role of Vif in stability of the human immunodeficiency
virus type 1 core. J Virol 74(23), 11055-66.
Oka, N., Yamamoto, M., Schwencke, C., Kawabe, J., Ebina, T., Ohno, S., Couet, J., Lisanti,
M. P., and Ishikawa, Y. (1997). Caveolin interaction with protein kinase C.
Isoenzyme-dependent regulation of kinase activity by the caveolin scaffolding domain
peptide. J Biol Chem 272(52), 33416-21.
Oldstone, M. B. (1998). Viral persistence: mechanisms and consequences. Curr Opin
Microbiol 1(4), 436-41.
Ono, A., and Freed, E. O. (2005). Role of lipid rafts in virus replication. Adv Virus Res 64,
311-58.
Ono, K., and Han, J. (2000). The p38 signal transduction pathway: activation and function.
Cell Signal 12(1), 1-13.
Orenstein, J. M., Fox, C., and Wahl, S. M. (1997). Macrophages as a source of HIV during
opportunistic infections. Science 276(5320), 1857-61.
Osada, S., Mizuno, K., Saido, T. C., Suzuki, K., Kuroki, T., and Ohno, S. (1992). A new
member of the protein kinase C family, nPKC theta, predominantly expressed in
skeletal muscle. Mol Cell Biol 12(9), 3930-8.
Osborn, L., Kunkel, S., and Nabel, G. J. (1989). Tumor necrosis factor alpha and interleukin 1
stimulate the human immunodeficiency virus enhancer by activation of the nuclear
factor kappa B. Proc Natl Acad Sci U S A 86(7), 2336-40.
Oshiumi, H., Matsumoto, M., Funami, K., Akazawa, T., and Seya, T. (2003a). TICAM-1, an
adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta
induction. Nat Immunol 4(2), 161-7.
Oshiumi, H., Sasai, M., Shida, K., Fujita, T., Matsumoto, M., and Seya, T. (2003b). TIRcontaining adapter molecule (TICAM)-2, a bridging adapter recruiting to toll-like
receptor 4 TICAM-1 that induces interferon-beta. J Biol Chem 278(50), 49751-62.
Osterhaus, A. D., van Baalen, C. A., Gruters, R. A., Schutten, M., Siebelink, C. H., Hulskotte,
E. G., Tijhaar, E. J., Randall, R. E., van Amerongen, G., Fleuchaus, A., Erfle, V., and
Sutter, G. (1999). Vaccination with Rev and Tat against AIDS. Vaccine 17(20-21),
2713-4.
Ostrowski, M. A., Gu, J. X., Kovacs, C., Freedman, J., Luscher, M. A., and MacDonald, K. S.
(2001). Quantitative and qualitative assessment of human immunodeficiency virus
216
type 1 (HIV-1)-specific CD4+ T cell immunity to gag in HIV-1-infected individuals
with differential disease progression: reciprocal interferon-gamma and interleukin-10
responses. J Infect Dis 184(10), 1268-78.
Ozinsky, A., Underhill, D. M., Fontenot, J. D., Hajjar, A. M., Smith, K. D., Wilson, C. B.,
Schroeder, L., and Aderem, A. (2000). The repertoire for pattern recognition of
pathogens by the innate immune system is defined by cooperation between toll-like
receptors. Proc Natl Acad Sci U S A 97(25), 13766-71.
Pace, P., and Rowley, M. (2008). Integrase inhibitors for the treatment of HIV infection. Curr
Opin Drug Discov Devel 11(4), 471-9.
Pagans, S., Pedal, A., North, B. J., Kaehlcke, K., Marshall, B. L., Dorr, A., Hetzer-Egger, C.,
Henklein, P., Frye, R., McBurney, M. W., Hruby, H., Jung, M., Verdin, E., and Ott,
M. (2005). SIRT1 regulates HIV transcription via Tat deacetylation. PLoS Biol 3(2),
e41.
Panganiban, A. T., and Temin, H. M. (1984). The retrovirus pol gene encodes a product
required for DNA integration: identification of a retrovirus int locus. Proc Natl Acad
Sci U S A 81(24), 7885-9.
Pantaleo, G., Graziosi, C., Demarest, J. F., Butini, L., Montroni, M., Fox, C. H., Orenstein, J.
M., Kotler, D. P., and Fauci, A. S. (1993). HIV infection is active and progressive in
lymphoid tissue during the clinically latent stage of disease. Nature 362(6418), 355-8.
Paquette, J. S., Fortin, J. F., Blanchard, L., and Tremblay, M. J. (1998). Level of ICAM-1
surface expression on virus producer cells influences both the amount of virion-bound
host ICAM-1 and human immunodeficiency virus type 1 infectivity. J Virol 72(11),
9329-36.
Parekh, B. S., and Maniatis, T. (1999). Virus infection leads to localized hyperacetylation of
histones H3 and H4 at the IFN-beta promoter. Mol Cell 3(1), 125-9.
Parekh, D. B., Ziegler, W., and Parker, P. J. (2000). Multiple pathways control protein kinase
C phosphorylation. Embo J 19(4), 496-503.
Park, I. W., Myrick, K., and Sodroski, J. (1994). Effects of vif mutations on cell-free
infectivity and replication of simian immunodeficiency virus. J Acquir Immune Defic
Syndr 7(12), 1228-36.
Parker, A. K., Gergely, F. V., and Taylor, C. W. (2004). Targeting of inositol 1,4,5trisphosphate receptors to the endoplasmic reticulum by multiple signals within their
transmembrane domains. J Biol Chem 279(22), 23797-805.
Paruch, S., Heinis, M., Lemay, J., Hoeffel, G., Maranon, C., Hosmalin, A., and Perianin, A.
(2007). CCR5 signaling through phospholipase D involves p44/42 MAP-kinases and
promotes HIV-1 LTR-directed gene expression. Faseb J 21(14), 4038-46.
Patterson, B. K., Czerniewski, M., Andersson, J., Sullivan, Y., Su, F., Jiyamapa, D., Burki, Z.,
and Landay, A. (1999). Regulation of CCR5 and CXCR4 expression by type 1 and
type 2 cytokines: CCR5 expression is downregulated by IL-10 in CD4-positive
lymphocytes. Clin Immunol 91(3), 254-62.
Patterson, S., Rae, A., Hockey, N., Gilmour, J., and Gotch, F. (2001). Plasmacytoid dendritic
cells are highly susceptible to human immunodeficiency virus type 1 infection and
release infectious virus. J Virol 75(14), 6710-3.
Paul, W. E. (1997). Interleukin 4: signalling mechanisms and control of T cell differentiation.
Ciba Found Symp 204, 208-16; discussion 216-9.
Pauza, C. D., Trivedi, P., Wallace, M., Ruckwardt, T. J., Le Buanec, H., Lu, W., Bizzini, B.,
Burny, A., Zagury, D., and Gallo, R. C. (2000). Vaccination with tat toxoid attenuates
disease in simian/HIV-challenged macaques. Proc Natl Acad Sci U S A 97(7), 3515-9.
217
Peng, J., Schwartz, D., Elias, J. E., Thoreen, C. C., Cheng, D., Marsischky, G., Roelofs, J.,
Finley, D., and Gygi, S. P. (2003). A proteomics approach to understanding protein
ubiquitination. Nat Biotechnol 21(8), 921-6.
Perez-Reyes, E. (2003). Molecular physiology of low-voltage-activated t-type calcium
channels. Physiol Rev 83(1), 117-61.
Persaud, D., Zhou, Y., Siliciano, J. M., and Siliciano, R. F. (2003). Latency in human
immunodeficiency virus type 1 infection: no easy answers. J Virol 77(3), 1659-65.
Peters, A. H., Mermoud, J. E., O'Carroll, D., Pagani, M., Schweizer, D., Brockdorff, N., and
Jenuwein, T. (2002). Histone H3 lysine 9 methylation is an epigenetic imprint of
facultative heterochromatin. Nat Genet 30(1), 77-80.
Petito, C. K., and Cash, K. S. (1992). Blood-brain barrier abnormalities in the acquired
immunodeficiency syndrome: immunohistochemical localization of serum proteins in
postmortem brain. Ann Neurol 32(5), 658-66.
Pettit, S. C., Everitt, L. E., Choudhury, S., Dunn, B. M., and Kaplan, A. H. (2004). Initial
cleavage of the human immunodeficiency virus type 1 GagPol precursor by its
activated protease occurs by an intramolecular mechanism. J Virol 78(16), 8477-85.
Pickart, C. M. (2004). Back to the future with ubiquitin. Cell 116(2), 181-90.
Piguet, V., Schwartz, O., Le Gall, S., and Trono, D. (1999). The downregulation of CD4 and
MHC-I by primate lentiviruses: a paradigm for the modulation of cell surface
receptors. Immunol Rev 168, 51-63.
Planz, O., Pleschka, S., and Ludwig, S. (2001). MEK-specific inhibitor U0126 blocks spread
of Borna disease virus in cultured cells. J Virol 75(10), 4871-7.
Pleschka, S., Wolff, T., Ehrhardt, C., Hobom, G., Planz, O., Rapp, U. R., and Ludwig, S.
(2001). Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK
signalling cascade. Nat Cell Biol 3(3), 301-5.
Ploegh, H. L. (1998). Viral strategies of immune evasion. Science 280(5361), 248-53.
Poaty-Mavoungou, V., Toure, F. S., Tevi-Benissan, C., and Mavoungou, E. (2002).
Enhancement of natural killer cell activation and antibody-dependent cellular
cytotoxicity by interferon-alpha and interleukin-12 in vaginal mucosae Sivmac251infected Macaca fascicularis. Viral Immunol 15(1), 197-212.
Poggi, A., Rubartelli, A., and Zocchi, M. R. (1998). Involvement of dihydropyridine-sensitive
calcium channels in human dendritic cell function. Competition by HIV-1 Tat. J Biol
Chem 273(13), 7205-9.
Pohlmann, S., Soilleux, E. J., Baribaud, F., Leslie, G. J., Morris, L. S., Trowsdale, J., Lee, B.,
Coleman, N., and Doms, R. W. (2001). DC-SIGNR, a DC-SIGN homologue
expressed in endothelial cells, binds to human and simian immunodeficiency viruses
and activates infection in trans. Proc Natl Acad Sci U S A 98(5), 2670-5.
Poli, G., Bressler, P., Kinter, A., Duh, E., Timmer, W. C., Rabson, A., Justement, J. S.,
Stanley, S., and Fauci, A. S. (1990a). Interleukin 6 induces human immunodeficiency
virus expression in infected monocytic cells alone and in synergy with tumor necrosis
factor alpha by transcriptional and post-transcriptional mechanisms. J Exp Med
172(1), 151-8.
Poli, G., and Fauci, A. S. (1992). The effect of cytokines and pharmacologic agents on
chronic HIV infection. AIDS Res Hum Retroviruses 8(2), 191-7.
Poli, G., Kinter, A., Justement, J. S., Kehrl, J. H., Bressler, P., Stanley, S., and Fauci, A. S.
(1990b). Tumor necrosis factor alpha functions in an autocrine manner in the
induction of human immunodeficiency virus expression. Proc Natl Acad Sci U S A
87(2), 782-5.
Poli, G., Kinter, A. L., and Fauci, A. S. (1994). Interleukin 1 induces expression of the human
immunodeficiency virus alone and in synergy with interleukin 6 in chronically
218
infected U1 cells: inhibition of inductive effects by the interleukin 1 receptor
antagonist. Proc Natl Acad Sci U S A 91(1), 108-12.
Poli, G., Vicenzi, E., Ghezzi, S., and Lazzarin, A. (1995). Cytokines in the acquired
immunodeficiency syndrome and other infectious diseases. Int J Clin Lab Res 25(3),
128-34.
Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Van Huffel, C., Du, X., Birdwell, D., Alejos,
E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., and
Beutler, B. (1998). Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice:
mutations in Tlr4 gene. Science 282(5396), 2085-8.
Polyak, S., Chen, H., Hirsch, D., George, I., Hershberg, R., and Sperber, K. (1997). Impaired
class II expression and antigen uptake in monocytic cells after HIV-1 infection. J
Immunol 159(5), 2177-88.
Pomerantz, R. J. (2002). Eliminating HIV-1 reservoirs. Curr Opin Investig Drugs 3(8), 11337.
Popik, W., and Pitha, P. M. (2000). Exploitation of cellular signaling by HIV-1: unwelcome
guests with master keys that signal their entry. Virology 276(1), 1-6.
Popov, S., Rexach, M., Zybarth, G., Reiling, N., Lee, M. A., Ratner, L., Lane, C. M., Moore,
M. S., Blobel, G., and Bukrinsky, M. (1998). Viral protein R regulates nuclear import
of the HIV-1 pre-integration complex. Embo J 17(4), 909-17.
Popovic, M., Sarngadharan, M. G., Read, E., and Gallo, R. C. (1984). Detection, isolation,
and continuous production of cytopathic retroviruses (HTLV-III) from patients with
AIDS and pre-AIDS. Science 224(4648), 497-500.
Pouyssegur, J., Volmat, V., and Lenormand, P. (2002). Fidelity and spatio-temporal control in
MAP kinase (ERKs) signalling. Biochem Pharmacol 64(5-6), 755-63.
Prabakaran, P., Dimitrov, A. S., Fouts, T. R., and Dimitrov, D. S. (2007). Structure and
function of the HIV envelope glycoprotein as entry mediator, vaccine immunogen,
and target for inhibitors. Adv Pharmacol 55, 33-97.
Price, D. H. (2000). P-TEFb, a cyclin-dependent kinase controlling elongation by RNA
polymerase II. Mol Cell Biol 20(8), 2629-34.
Pullen, K. A., Ishimoto, L. K., and Champoux, J. J. (1992). Incomplete removal of the RNA
primer for minus-strand DNA synthesis by human immunodeficiency virus type 1
reverse transcriptase. J Virol 66(1), 367-73.
Putney, J. W., Jr. (2004). The enigmatic TRPCs: multifunctional cation channels. Trends Cell
Biol 14(6), 282-6.
Quaranta, M. G., Mattioli, B., Spadaro, F., Straface, E., Giordani, L., Ramoni, C., Malorni,
W., and Viora, M. (2003). HIV-1 Nef triggers Vav-mediated signaling pathway
leading to functional and morphological differentiation of dendritic cells. Faseb J
17(14), 2025-36.
Quinn, T. C. (1989). The epidemiology of the acquired immune deficiency syndrome and the
immunological responses to the human immunodeficiency virus. Curr Opin Immunol
1(3), 502-12.
Raha, T., Cheng, S. W., and Green, M. R. (2005). HIV-1 Tat stimulates transcription complex
assembly through recruitment of TBP in the absence of TAFs. PLoS Biol 3(2), e44.
Ramakrishnan, P., Wang, W., and Wallach, D. (2004). Receptor-specific signaling for both
the alternative and the canonical NF-kappaB activation pathways by NF-kappaBinducing kinase. Immunity 21(4), 477-89.
Ranga, U., Shankarappa, R., Siddappa, N. B., Ramakrishna, L., Nagendran, R., Mahalingam,
M., Mahadevan, A., Jayasuryan, N., Satishchandra, P., Shankar, S. K., and Prasad, V.
R. (2004). Tat protein of human immunodeficiency virus type 1 subtype C strains is a
defective chemokine. J Virol 78(5), 2586-90.
219
Rao, K. M. (2001). MAP kinase activation in macrophages. J Leukoc Biol 69(1), 3-10.
Rappaport, J., Joseph, J., Croul, S., Alexander, G., Del Valle, L., Amini, S., and Khalili, K.
(1999). Molecular pathway involved in HIV-1-induced CNS pathology: role of viral
regulatory protein, Tat. J Leukoc Biol 65(4), 458-65.
Raulin, J. (2002). Human immunodeficiency virus and host cell lipids. Interesting pathways in
research for a new HIV therapy. Prog Lipid Res 41(1), 27-65.
Rautonen, N., Rautonen, J., Martin, N. L., and Wara, D. W. (1994). HIV-1 Tat induces
cytokine synthesis by uninfected mononuclear cells. Aids 8(10), 1504-6.
Reece, J. C., Handley, A. J., Anstee, E. J., Morrison, W. A., Crowe, S. M., and Cameron, P.
U. (1998). HIV-1 selection by epidermal dendritic cells during transmission across
human skin. J Exp Med 187(10), 1623-31.
Rennecke, J., Johannes, F. J., Richter, K. H., Kittstein, W., Marks, F., and Gschwendt, M.
(1996). Immunological demonstration of protein kinase C mu in murine tissues and
various cell lines. Differential recognition of phosphorylated forms and lack of downregulation upon 12-O-tetradecanoylphorphol-13-acetate treatment of cells. Eur J
Biochem 242(2), 428-32.
Rincon, M., Anguita, J., Nakamura, T., Fikrig, E., and Flavell, R. A. (1997). Interleukin (IL)6 directs the differentiation of IL-4-producing CD4+ T cells. J Exp Med 185(3), 461-9.
Robertson, D. L., Anderson, J. P., Bradac, J. A., Carr, J. K., Foley, B., Funkhouser, R. K.,
Gao, F., Hahn, B. H., Kalish, M. L., Kuiken, C., Learn, G. H., Leitner, T., McCutchan,
F., Osmanov, S., Peeters, M., Pieniazek, D., Salminen, M., Sharp, P. M., Wolinsky, S.,
and Korber, B. (2000). HIV-1 nomenclature proposal. Science 288(5463), 55-6.
Rode, H. J., Janssen, W., Rosen-Wolff, A., Bugert, J. J., Thein, P., Becker, Y., and Darai, G.
(1993). The genome of equine herpesvirus type 2 harbors an interleukin 10 (IL10)-like
gene. Virus Genes 7(1), 111-6.
Romagnani, S., Maggi, E., and Del Prete, G. (1994). HIV can induce a TH1 to TH0 shift, and
preferentially replicates in CD4+ T-cell clones producing TH2-type cytokines. Res
Immunol 145(8-9), 611-7; discussion 617-8.
Ron, D., Jiang, Z., Yao, L., Vagts, A., Diamond, I., and Gordon, A. (1999). Coordinated
movement of RACK1 with activated betaIIPKC. J Biol Chem 274(38), 27039-46.
Ron, D., and Kazanietz, M. G. (1999). New insights into the regulation of protein kinase C
and novel phorbol ester receptors. Faseb J 13(13), 1658-76.
Roof, P., Ricci, M., Genin, P., Montano, M. A., Essex, M., Wainberg, M. A., Gatignol, A.,
and Hiscott, J. (2002). Differential regulation of HIV-1 clade-specific B, C, and E long
terminal repeats by NF-kappaB and the Tat transactivator. Virology 296(1), 77-83.
Roques, P., Robertson, D. L., Souquiere, S., Apetrei, C., Nerrienet, E., Barre-Sinoussi, F.,
Muller-Trutwin, M., and Simon, F. (2004). Phylogenetic characteristics of three new
HIV-1 N strains and implications for the origin of group N. Aids 18(10), 1371-81.
Roshal, M., Kim, B., Zhu, Y., Nghiem, P., and Planelles, V. (2003). Activation of the ATRmediated DNA damage response by the HIV-1 viral protein R. J Biol Chem 278(28),
25879-86.
Rowe, D. C., McGettrick, A. F., Latz, E., Monks, B. G., Gay, N. J., Yamamoto, M., Akira, S.,
O'Neill, L. A., Fitzgerald, K. A., and Golenbock, D. T. (2006). The myristoylation of
TRIF-related adaptor molecule is essential for Toll-like receptor 4 signal transduction.
Proc Natl Acad Sci U S A 103(16), 6299-304.
Royce, R. A., Sena, A., Cates, W., Jr., and Cohen, M. S. (1997). Sexual transmission of HIV.
N Engl J Med 336(15), 1072-8.
Rubartelli, A., Poggi, A., Sitia, R., and Zocchi, M. R. (1998). HIV-I Tat: a polypeptide for all
seasons. Immunol Today 19(12), 543-5.
220
Sabatier, J. M., Vives, E., Mabrouk, K., Benjouad, A., Rochat, H., Duval, A., Hue, B., and
Bahraoui, E. (1991). Evidence for neurotoxic activity of tat from human
immunodeficiency virus type 1. J Virol 65(2), 961-7.
Saccani, S., and Natoli, G. (2002). Dynamic changes in histone H3 Lys 9 methylation
occurring at tightly regulated inducible inflammatory genes. Genes Dev 16(17), 221924.
Saccani, S., Pantano, S., and Natoli, G. (2001). Two waves of nuclear factor kappaB
recruitment to target promoters. J Exp Med 193(12), 1351-9.
Saccani, S., Pantano, S., and Natoli, G. (2002). p38-Dependent marking of inflammatory
genes for increased NF-kappa B recruitment. Nat Immunol 3(1), 69-75.
Saha, R. N., and Pahan, K. (2003). Tumor necrosis factor-alpha at the crossroads of neuronal
life and death during HIV-associated dementia. J Neurochem 86(5), 1057-71.
Sakane, F., and Kanoh, H. (1997). Molecules in focus: diacylglycerol kinase. Int J Biochem
Cell Biol 29(10), 1139-43.
Sakurai, H., Chiba, H., Miyoshi, H., Sugita, T., and Toriumi, W. (1999). IkappaB kinases
phosphorylate NF-kappaB p65 subunit on serine 536 in the transactivation domain. J
Biol Chem 274(43), 30353-6.
Sallusto, F., Geginat, J., and Lanzavecchia, A. (2004). Central memory and effector memory
T cell subsets: function, generation, and maintenance. Annu Rev Immunol 22, 745-63.
Sallusto, F., Lenig, D., Mackay, C. R., and Lanzavecchia, A. (1998). Flexible programs of
chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. J
Exp Med 187(6), 875-83.
Salvador, L. M., Park, Y., Cottom, J., Maizels, E. T., Jones, J. C., Schillace, R. V., Carr, D.
W., Cheung, P., Allis, C. D., Jameson, J. L., and Hunzicker-Dunn, M. (2001). Folliclestimulating hormone stimulates protein kinase A-mediated histone H3
phosphorylation and acetylation leading to select gene activation in ovarian granulosa
cells. J Biol Chem 276(43), 40146-55.
Samaniego, F., Markham, P. D., Gendelman, R., Watanabe, Y., Kao, V., Kowalski, K.,
Sonnabend, J. A., Pintus, A., Gallo, R. C., and Ensoli, B. (1998). Vascular endothelial
growth factor and basic fibroblast growth factor present in Kaposi's sarcoma (KS) are
induced by inflammatory cytokines and synergize to promote vascular permeability
and KS lesion development. Am J Pathol 152(6), 1433-43.
San-Juan-Vergara, H., Peeples, M. E., Lockey, R. F., and Mohapatra, S. S. (2004). Protein
kinase C-alpha activity is required for respiratory syncytial virus fusion to human
bronchial epithelial cells. J Virol 78(24), 13717-26.
Sanders, S. L., Portoso, M., Mata, J., Bahler, J., Allshire, R. C., and Kouzarides, T. (2004).
Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA
damage. Cell 119(5), 603-14.
Sando, J. J., and Chertihin, O. I. (1996). Activation of protein kinase C by lysophosphatidic
acid: dependence on composition of phospholipid vesicles. Biochem J 317 ( Pt 2),
583-8.
Santiago, M. L., Rodenburg, C. M., Kamenya, S., Bibollet-Ruche, F., Gao, F., Bailes, E.,
Meleth, S., Soong, S. J., Kilby, J. M., Moldoveanu, Z., Fahey, B., Muller, M. N.,
Ayouba, A., Nerrienet, E., McClure, H. M., Heeney, J. L., Pusey, A. E., Collins, D.
A., Boesch, C., Wrangham, R. W., Goodall, J., Sharp, P. M., Shaw, G. M., and Hahn,
B. H. (2002). SIVcpz in wild chimpanzees. Science 295(5554), 465.
Santos-Rosa, H., Bannister, A. J., Dehe, P. M., Geli, V., and Kouzarides, T. (2004).
Methylation of H3 lysine 4 at euchromatin promotes Sir3p association with
heterochromatin. J Biol Chem 279(46), 47506-12.
221
Sartori, A., Ma, X., Gri, G., Showe, L., Benjamin, D., and Trinchieri, G. (1997). Interleukin12: an immunoregulatory cytokine produced by B cells and antigen-presenting cells.
Methods 11(1), 116-27.
Sassone-Corsi, P., Mizzen, C. A., Cheung, P., Crosio, C., Monaco, L., Jacquot, S., Hanauer,
A., and Allis, C. D. (1999). Requirement of Rsk-2 for epidermal growth factoractivated phosphorylation of histone H3. Science 285(5429), 886-91.
Saville, M. W., Taga, K., Foli, A., Broder, S., Tosato, G., and Yarchoan, R. (1994).
Interleukin-10 suppresses human immunodeficiency virus-1 replication in vitro in
cells of the monocyte/macrophage lineage. Blood 83(12), 3591-9.
Sawaya, B. E., Khalili, K., Mercer, W. E., Denisova, L., and Amini, S. (1998). Cooperative
actions of HIV-1 Vpr and p53 modulate viral gene transcription. J Biol Chem 273(32),
20052-7.
Schaeffer, E., Soros, V. B., and Greene, W. C. (2004). Compensatory link between fusion and
endocytosis of human immunodeficiency virus type 1 in human CD4 T lymphocytes.
J Virol 78(3), 1375-83.
Schaeffer, H. J., and Weber, M. J. (1999). Mitogen-activated protein kinases: specific
messages from ubiquitous messengers. Mol Cell Biol 19(4), 2435-44.
Schmidtmayerova, H., Sherry, B., and Bukrinsky, M. (1996). Chemokines and HIV
replication. Nature 382(6594), 767.
Schneider-Brachert, W., Tchikov, V., Neumeyer, J., Jakob, M., Winoto-Morbach, S., HeldFeindt, J., Heinrich, M., Merkel, O., Ehrenschwender, M., Adam, D., Mentlein, R.,
Kabelitz, D., and Schutze, S. (2004). Compartmentalization of TNF receptor 1
signaling: internalized TNF receptosomes as death signaling vesicles. Immunity 21(3),
415-28.
Schoenfeld, H. J., Poeschl, B., Frey, J. R., Loetscher, H., Hunziker, W., Lustig, A., and
Zulauf, M. (1991). Efficient purification of recombinant human tumor necrosis factor
beta from Escherichia coli yields biologically active protein with a trimeric structure
that binds to both tumor necrosis factor receptors. J Biol Chem 266(6), 3863-9.
Schols, D., and De Clercq, E. (1996). Human immunodeficiency virus type 1 gp120 induces
anergy in human peripheral blood lymphocytes by inducing interleukin-10 production.
J Virol 70(8), 4953-60.
Schubert, U., Ferrer-Montiel, A. V., Oblatt-Montal, M., Henklein, P., Strebel, K., and Montal,
M. (1996). Identification of an ion channel activity of the Vpu transmembrane domain
and its involvement in the regulation of virus release from HIV-1-infected cells. FEBS
Lett 398(1), 12-8.
Schulz, T. F. (1998). Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J Gen
Virol 79 ( Pt 7), 1573-91.
Schwartz, O., Marechal, V., Le Gall, S., Lemonnier, F., and Heard, J. M. (1996). Endocytosis
of major histocompatibility complex class I molecules is induced by the HIV-1 Nef
protein. Nat Med 2(3), 338-42.
Seewald, M. J., Metzger, A. U., Willbold, D., Rosch, P., and Sticht, H. (1998). Structural
model of the HIV-1 Tat(46-58)-TAR complex. J Biomol Struct Dyn 16(3), 683-92.
Self, R. L., Mulholland, P. J., Nath, A., Harris, B. R., and Prendergast, M. A. (2004). The
human immunodeficiency virus type-1 transcription factor Tat produces elevations in
intracellular Ca2+ that require function of an N-methyl-D-aspartate receptor
polyamine-sensitive site. Brain Res 995(1), 39-45.
Seth, R. B., Sun, L., Ea, C. K., and Chen, Z. J. (2005). Identification and characterization of
MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF
3. Cell 122(5), 669-82.
222
Shafer, R. W., and Schapiro, J. M. (2008). HIV-1 Drug Resistance Mutations: an Updated
Framework for the Second Decade of HAART. AIDS Rev 10(2), 67-84.
Shakhov, A. N., Kuprash, D. V., Azizov, M. M., Jongeneel, C. V., and Nedospasov, S. A.
(1990). Structural analysis of the rabbit TNF locus, containing the genes encoding
TNF-beta (lymphotoxin) and TNF-alpha (tumor necrosis factor). Gene 95(2), 215-21.
Sheehy, A. M., Gaddis, N. C., Choi, J. D., and Malim, M. H. (2002). Isolation of a human
gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature
418(6898), 646-50.
Sheehy, A. M., Gaddis, N. C., and Malim, M. H. (2003). The antiretroviral enzyme
APOBEC3G is degraded by the proteasome in response to HIV-1 Vif. Nat Med 9(11),
1404-7.
Shimazu, R., Akashi, S., Ogata, H., Nagai, Y., Fukudome, K., Miyake, K., and Kimoto, M.
(1999). MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like
receptor 4. J Exp Med 189(11), 1777-82.
Shin, H. D., Winkler, C., Stephens, J. C., Bream, J., Young, H., Goedert, J. J., O'Brien, T. R.,
Vlahov, D., Buchbinder, S., Giorgi, J., Rinaldo, C., Donfield, S., Willoughby, A.,
O'Brien, S. J., and Smith, M. W. (2000). Genetic restriction of HIV-1 pathogenesis to
AIDS by promoter alleles of IL10. Proc Natl Acad Sci U S A 97(26), 14467-72.
Sieczkarski, S. B., Brown, H. A., and Whittaker, G. R. (2003). Role of protein kinase C betaII
in influenza virus entry via late endosomes. J Virol 77(1), 460-9.
Silvera, P., Richardson, M. W., Greenhouse, J., Yalley-Ogunro, J., Shaw, N., Mirchandani, J.,
Khalili, K., Zagury, J. F., Lewis, M. G., and Rappaport, J. (2002). Outcome of simianhuman immunodeficiency virus strain 89.6p challenge following vaccination of rhesus
macaques with human immunodeficiency virus Tat protein. J Virol 76(8), 3800-9.
Silverman, N., and Maniatis, T. (2001). NF-kappaB signaling pathways in mammalian and
insect innate immunity. Genes Dev 15(18), 2321-42.
Silvestri, G., Sodora, D. L., Koup, R. A., Paiardini, M., O'Neil, S. P., McClure, H. M.,
Staprans, S. I., and Feinberg, M. B. (2003). Nonpathogenic SIV infection of sooty
mangabeys is characterized by limited bystander immunopathology despite chronic
high-level viremia. Immunity 18(3), 441-52.
Sims, J., Towne, J., and Blumberg, H. (2006). 11 IL-1 family members in inflammatory skin
disease. Ernst Schering Res Found Workshop(56), 187-91.
Sizemore, N., Lerner, N., Dombrowski, N., Sakurai, H., and Stark, G. R. (2002). Distinct
roles of the Ikappa B kinase alpha and beta subunits in liberating nuclear factor kappa
B (NF-kappa B) from Ikappa B and in phosphorylating the p65 subunit of NF-kappa
B. J Biol Chem 277(6), 3863-9.
Smahi, A., Courtois, G., Vabres, P., Yamaoka, S., Heuertz, S., Munnich, A., Israel, A., Heiss,
N. S., Klauck, S. M., Kioschis, P., Wiemann, S., Poustka, A., Esposito, T., Bardaro,
T., Gianfrancesco, F., Ciccodicola, A., D'Urso, M., Woffendin, H., Jakins, T., Donnai,
D., Stewart, H., Kenwrick, S. J., Aradhya, S., Yamagata, T., Levy, M., Lewis, R. A.,
and Nelson, D. L. (2000). Genomic rearrangement in NEMO impairs NF-kappaB
activation and is a cause of incontinentia pigmenti. The International Incontinentia
Pigmenti (IP) Consortium. Nature 405(6785), 466-72.
Smith-Franklin, B. A., Keele, B. F., Tew, J. G., Gartner, S., Szakal, A. K., Estes, J. D.,
Thacker, T. C., and Burton, G. F. (2002). Follicular dendritic cells and the persistence
of HIV infectivity: the role of antibodies and Fcgamma receptors. J Immunol 168(5),
2408-14.
Smith, B. A., Gartner, S., Liu, Y., Perelson, A. S., Stilianakis, N. I., Keele, B. F., Kerkering,
T. M., Ferreira-Gonzalez, A., Szakal, A. K., Tew, J. G., and Burton, G. F. (2001).
Persistence of infectious HIV on follicular dendritic cells. J Immunol 166(1), 690-6.
223
Smith, C. M., Leon, O., Smith, J. S., and Roth, M. J. (1998). Sequence requirements for
removal of tRNA by an isolated human immunodeficiency virus type 1 RNase H
domain. J Virol 72(8), 6805-12.
Smith, J. S., Kim, S. Y., and Roth, M. J. (1990). Analysis of long terminal repeat circle
junctions of human immunodeficiency virus type 1. J Virol 64(12), 6286-90.
Smith, K. D., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, M. A., Barrett, S. L.,
Cookson, B. T., and Aderem, A. (2003). Toll-like receptor 5 recognizes a conserved
site on flagellin required for protofilament formation and bacterial motility. Nat
Immunol 4(12), 1247-53.
Soloaga, A., Thomson, S., Wiggin, G. R., Rampersaud, N., Dyson, M. H., Hazzalin, C. A.,
Mahadevan, L. C., and Arthur, J. S. (2003). MSK2 and MSK1 mediate the mitogenand stress-induced phosphorylation of histone H3 and HMG-14. Embo J 22(11), 278897.
Song, J. S., Swann, P. G., Szallasi, Z., Blank, U., Blumberg, P. M., and Rivera, J. (1998).
Tyrosine phosphorylation-dependent and -independent associations of protein kinase
C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src
family kinase activity by protein kinase C-delta. Oncogene 16(26), 3357-68.
Sozzani, S., Ghezzi, S., Iannolo, G., Luini, W., Borsatti, A., Polentarutti, N., Sica, A., Locati,
M., Mackay, C., Wells, T. N., Biswas, P., Vicenzi, E., Poli, G., and Mantovani, A.
(1998). Interleukin 10 increases CCR5 expression and HIV infection in human
monocytes. J Exp Med 187(3), 439-44.
Spence, R. A., Kati, W. M., Anderson, K. S., and Johnson, K. A. (1995). Mechanism of
inhibition of HIV-1 reverse transcriptase by nonnucleoside inhibitors. Science
267(5200), 988-93.
Spencer, S. D., Di Marco, F., Hooley, J., Pitts-Meek, S., Bauer, M., Ryan, A. M., Sordat, B.,
Gibbs, V. C., and Aguet, M. (1998). The orphan receptor CRF2-4 is an essential
subunit of the interleukin 10 receptor. J Exp Med 187(4), 571-8.
Spriggs, D. R., Deutsch, S., and Kufe, D. W. (1992). Genomic structure, induction, and
production of TNF-alpha. Immunol Ser 56, 3-34.
Stade, K., Ford, C. S., Guthrie, C., and Weis, K. (1997). Exportin 1 (Crm1p) is an essential
nuclear export factor. Cell 90(6), 1041-50.
Stallcup, M. R., Chen, D., Koh, S. S., Ma, H., Lee, Y. H., Li, H., Schurter, B. T., and Aswad,
D. W. (2000). Co-operation between protein-acetylating and protein-methylating coactivators in transcriptional activation. Biochem Soc Trans 28(4), 415-8.
Sterner, D. E., and Berger, S. L. (2000). Acetylation of histones and transcription-related
factors. Microbiol Mol Biol Rev 64(2), 435-59.
Stevenson, M. (2003). HIV-1 pathogenesis. Nat Med 9(7), 853-60.
Strahl, B. D., Ohba, R., Cook, R. G., and Allis, C. D. (1999). Methylation of histone H3 at
lysine 4 is highly conserved and correlates with transcriptionally active nuclei in
Tetrahymena. Proc Natl Acad Sci U S A 96(26), 14967-72.
Stricher, F., Martin, L., Barthe, P., Pogenberg, V., Mechulam, A., Menez, A., Roumestand,
C., Veas, F., Royer, C., and Vita, C. (2005). A high-throughput fluorescence
polarization assay specific to the CD4 binding site of HIV-1 glycoproteins based on a
fluorescein-labelled CD4 mimic. Biochem J 390(Pt 1), 29-39.
Stylianou, E., Aukrust, P., Kvale, D., Muller, F., and Froland, S. S. (1999). IL-10 in HIV
infection: increasing serum IL-10 levels with disease progression--down-regulatory
effect of potent anti-retroviral therapy. Clin Exp Immunol 116(1), 115-20.
Sugaya, M., Lore, K., Koup, R. A., Douek, D. C., and Blauvelt, A. (2004). HIV-infected
Langerhans cells preferentially transmit virus to proliferating autologous CD4+
224
memory T cells located within Langerhans cell-T cell clusters. J Immunol 172(4),
2219-24.
Summers, M. F., Henderson, L. E., Chance, M. R., Bess, J. W., Jr., South, T. L., Blake, P. R.,
Sagi, I., Perez-Alvarado, G., Sowder, R. C., 3rd, Hare, D. R., and et al. (1992).
Nucleocapsid zinc fingers detected in retroviruses: EXAFS studies of intact viruses
and the solution-state structure of the nucleocapsid protein from HIV-1. Protein Sci
1(5), 563-74.
Suzuki, N., Suzuki, S., Duncan, G. S., Millar, D. G., Wada, T., Mirtsos, C., Takada, H.,
Wakeham, A., Itie, A., Li, S., Penninger, J. M., Wesche, H., Ohashi, P. S., Mak, T.
W., and Yeh, W. C. (2002). Severe impairment of interleukin-1 and Toll-like receptor
signalling in mice lacking IRAK-4. Nature 416(6882), 750-6.
Tachado, S. D., Zhang, J., Zhu, J., Patel, N., and Koziel, H. (2005). HIV impairs TNF-alpha
release in response to Toll-like receptor 4 stimulation in human macrophages in vitro.
Am J Respir Cell Mol Biol 33(6), 610-21.
Taga, K., Cherney, B., and Tosato, G. (1993). IL-10 inhibits apoptotic cell death in human T
cells starved of IL-2. Int Immunol 5(12), 1599-608.
Takai, Y., Kishimoto, A., Inoue, M., and Nishizuka, Y. (1977). Studies on a cyclic nucleotideindependent protein kinase and its proenzyme in mammalian tissues. I. Purification
and characterization of an active enzyme from bovine cerebellum. J Biol Chem
252(21), 7603-9.
Takeda, K., and Akira, S. (2005). Toll-like receptors in innate immunity. Int Immunol 17(1),
1-14.
Takeda, K., Kaisho, T., and Akira, S. (2003). Toll-like receptors. Annu Rev Immunol 21, 33576.
Takehisa, J., Zekeng, L., Ido, E., Yamaguchi-Kabata, Y., Mboudjeka, I., Harada, Y., Miura,
T., Kaptu, L., and Hayami, M. (1999). Human immunodeficiency virus type 1
intergroup (M/O) recombination in cameroon. J Virol 73(8), 6810-20.
Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K., and
Akira, S. (1999). Differential roles of TLR2 and TLR4 in recognition of gramnegative and gram-positive bacterial cell wall components. Immunity 11(4), 443-51.
Takeuchi, O., Kaufmann, A., Grote, K., Kawai, T., Hoshino, K., Morr, M., Muhlradt, P. F.,
and Akira, S. (2000). Cutting edge: preferentially the R-stereoisomer of the
mycoplasmal lipopeptide macrophage-activating lipopeptide-2 activates immune cells
through a toll-like receptor 2- and MyD88-dependent signaling pathway. J Immunol
164(2), 554-7.
Takeuchi, O., Kawai, T., Muhlradt, P. F., Morr, M., Radolf, J. D., Zychlinsky, A., Takeda, K.,
and Akira, S. (2001). Discrimination of bacterial lipoproteins by Toll-like receptor 6.
Int Immunol 13(7), 933-40.
Takeuchi, O., Sato, S., Horiuchi, T., Hoshino, K., Takeda, K., Dong, Z., Modlin, R. L., and
Akira, S. (2002). Cutting edge: role of Toll-like receptor 1 in mediating immune
response to microbial lipoproteins. J Immunol 169(1), 10-4.
Talley, A. K., Dewhurst, S., Perry, S. W., Dollard, S. C., Gummuluru, S., Fine, S. M., New,
D., Epstein, L. G., Gendelman, H. E., and Gelbard, H. A. (1995). Tumor necrosis
factor alpha-induced apoptosis in human neuronal cells: protection by the antioxidant
N-acetylcysteine and the genes bcl-2 and crmA. Mol Cell Biol 15(5), 2359-66.
Tam, W. F., and Sen, R. (2001). IkappaB family members function by different mechanisms.
J Biol Chem 276(11), 7701-4.
Tan, J. C., Braun, S., Rong, H., DiGiacomo, R., Dolphin, E., Baldwin, S., Narula, S. K.,
Zavodny, P. J., and Chou, C. C. (1995). Characterization of recombinant extracellular
domain of human interleukin-10 receptor. J Biol Chem 270(21), 12906-11.
225
Tan, J. C., Indelicato, S. R., Narula, S. K., Zavodny, P. J., and Chou, C. C. (1993).
Characterization of interleukin-10 receptors on human and mouse cells. J Biol Chem
268(28), 21053-9.
Tan, Y., Rouse, J., Zhang, A., Cariati, S., Cohen, P., and Comb, M. J. (1996). FGF and stress
regulate CREB and ATF-1 via a pathway involving p38 MAP kinase and MAPKAP
kinase-2. Embo J 15(17), 4629-42.
Tanese, N., and Goff, S. P. (1988). Domain structure of the Moloney murine leukemia virus
reverse transcriptase: mutational analysis and separate expression of the DNA
polymerase and RNase H activities. Proc Natl Acad Sci U S A 85(6), 1777-81.
Tanny, J. C., and Moazed, D. (2001). Coupling of histone deacetylation to NAD breakdown
by the yeast silencing protein Sir2: Evidence for acetyl transfer from substrate to an
NAD breakdown product. Proc Natl Acad Sci U S A 98(2), 415-20.
Tanoue, T., Adachi, M., Moriguchi, T., and Nishida, E. (2000). A conserved docking motif in
MAP kinases common to substrates, activators and regulators. Nat Cell Biol 2(2), 1106.
Tarassishin, L., and Horwitz, M. S. (2001). Sites on FIP-3 (NEMO/IKKgamma) essential for
its phosphorylation and NF-kappaB modulating activity. Biochem Biophys Res
Commun 285(2), 555-60.
Tasciotti, E., Zoppe, M., and Giacca, M. (2003). Transcellular transfer of active HSV-1
thymidine kinase mediated by an 11-amino-acid peptide from HIV-1 Tat. Cancer
Gene Ther 10(1), 64-74.
Taube, R., Fujinaga, K., Wimmer, J., Barboric, M., and Peterlin, B. M. (1999). Tat
transactivation: a model for the regulation of eukaryotic transcriptional elongation.
Virology 264(2), 245-53.
Taylor, C. W., and Laude, A. J. (2002). IP3 receptors and their regulation by calmodulin and
cytosolic Ca2+. Cell Calcium 32(5-6), 321-34.
Tibbles, L. A., Ing, Y. L., Kiefer, F., Chan, J., Iscove, N., Woodgett, J. R., and Lassam, N. J.
(1996). MLK-3 activates the SAPK/JNK and p38/RK pathways via SEK1 and
MKK3/6. Embo J 15(24), 7026-35.
Tindall, B., and Cooper, D. A. (1991). Primary HIV infection: host responses and intervention
strategies. Aids 5(1), 1-14.
Toker, A., Meyer, M., Reddy, K. K., Falck, J. R., Aneja, R., Aneja, S., Parra, A., Burns, D. J.,
Ballas, L. M., and Cantley, L. C. (1994). Activation of protein kinase C family
members by the novel polyphosphoinositides PtdIns-3,4-P2 and PtdIns-3,4,5-P3. J
Biol Chem 269(51), 32358-67.
Tolcher, A. W., Reyno, L., Venner, P. M., Ernst, S. D., Moore, M., Geary, R. S., Chi, K.,
Hall, S., Walsh, W., Dorr, A., and Eisenhauer, E. (2002). A randomized phase II and
pharmacokinetic study of the antisense oligonucleotides ISIS 3521 and ISIS 5132 in
patients with hormone-refractory prostate cancer. Clin Cancer Res 8(8), 2530-5.
Topping, R., Demoitie, M. A., Shin, N. H., and Telesnitsky, A. (1998). Cis-acting elements
required for strong stop acceptor template selection during Moloney murine leukemia
virus reverse transcription. J Mol Biol 281(1), 1-15.
Torres, Y., Medrano, F. J., Rey, C., Calderon, E. J., Sanchez-Quijano, A., Lissen, E., and
Leal, M. (1998). Evidence for a role of T-helper type 2 cytokines in the acquisition of
human immunodeficiency virus syncytium-inducing phenotype. Eur J Clin Invest
28(11), 930-6.
Tournier, C., Whitmarsh, A. J., Cavanagh, J., Barrett, T., and Davis, R. J. (1999). The MKK7
gene encodes a group of c-Jun NH2-terminal kinase kinases. Mol Cell Biol 19(2),
1569-81.
226
Tremblay, M. J., Fortin, J. F., and Cantin, R. (1998). The acquisition of host-encoded proteins
by nascent HIV-1. Immunol Today 19(8), 346-51.
Trinchieri, G. (1998a). Immunobiology of interleukin-12. Immunol Res 17(1-2), 269-78.
Trinchieri, G. (1998b). Proinflammatory and immunoregulatory functions of interleukin-12.
Int Rev Immunol 16(3-4), 365-96.
Tripp, C. S., Beckerman, K. P., and Unanue, E. R. (1995). Immune complexes inhibit
antimicrobial responses through interleukin-10 production. Effects in severe combined
immunodeficient mice during Listeria infection. J Clin Invest 95(4), 1628-34.
Tsunetsugu-Yokota, Y., Morikawa, Y., Isogai, M., Kawana-Tachikawa, A., Odawara, T.,
Nakamura, T., Grassi, F., Autran, B., and Iwamoto, A. (2003). Yeast-derived human
immunodeficiency virus type 1 p55(gag) virus-like particles activate dendritic cells
(DCs) and induce perforin expression in Gag-specific CD8(+) T cells by crosspresentation of DCs. J Virol 77(19), 10250-9.
Turner, S., Tizard, R., DeMarinis, J., Pepinsky, R. B., Zullo, J., Schooley, R., and Fisher, R.
(1992). Resistance of primary isolates of human immunodeficiency virus type 1 to
neutralization by soluble CD4 is not due to lower affinity with the viral envelope
glycoprotein gp120. Proc Natl Acad Sci U S A 89(4), 1335-9.
Turville, S. G., Arthos, J., Donald, K. M., Lynch, G., Naif, H., Clark, G., Hart, D., and
Cunningham, A. L. (2001). HIV gp120 receptors on human dendritic cells. Blood
98(8), 2482-8.
Tuyt, L. M., Dokter, W. H., Birkenkamp, K., Koopmans, S. B., Lummen, C., Kruijer, W., and
Vellenga, E. (1999). Extracellular-regulated kinase 1/2, Jun N-terminal kinase, and cJun are involved in NF-kappa B-dependent IL-6 expression in human monocytes. J
Immunol 162(8), 4893-902.
Tyagi, M., Rusnati, M., Presta, M., and Giacca, M. (2001). Internalization of HIV-1 tat
requires cell surface heparan sulfate proteoglycans. J Biol Chem 276(5), 3254-61.
Ullman, K. S., Northrop, J. P., Admon, A., and Crabtree, G. R. (1993). Jun family members
are controlled by a calcium-regulated, cyclosporin A-sensitive signaling pathway in
activated T lymphocytes. Genes Dev 7(2), 188-96.
Underhill, D. M., Ozinsky, A., Hajjar, A. M., Stevens, A., Wilson, C. B., Bassetti, M., and
Aderem, A. (1999). The Toll-like receptor 2 is recruited to macrophage phagosomes
and discriminates between pathogens. Nature 401(6755), 811-5.
Valentin, A., Rosati, M., Patenaude, D. J., Hatzakis, A., Kostrikis, L. G., Lazanas, M., Wyvill,
K. M., Yarchoan, R., and Pavlakis, G. N. (2002). Persistent HIV-1 infection of natural
killer cells in patients receiving highly active antiretroviral therapy. Proc Natl Acad
Sci U S A 99(10), 7015-20.
Vendeville, A., Rayne, F., Bettache, N., Montcourrier, P., and Beaumelle, B. (2004). HIV-1
uses coated pits to enter T-cells before translocating from acidified endosomes and
eliciting biological responses. Mol Biol Cell.
Vene, R., Benelli, R., Noonan, D. M., and Albini, A. (2000). HIV-Tat dependent chemotaxis
and invasion, key aspects of tat mediated pathogenesis. Clin Exp Metastasis 18(7),
533-8.
Verani, A., Gras, G., and Pancino, G. (2005). Macrophages and HIV-1: dangerous liaisons.
Mol Immunol 42(2), 195-212.
VerPlank, L., Bouamr, F., LaGrassa, T. J., Agresta, B., Kikonyogo, A., Leis, J., and Carter, C.
A. (2001). Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L
domain in HIV type 1 Pr55(Gag). Proc Natl Acad Sci U S A 98(14), 7724-9.
Veschambre, P., Roisin, A., and Jalinot, P. (1997). Biochemical and functional interaction of
the human immunodeficiency virus type 1 Tat transactivator with the general
transcription factor TFIIB. J Gen Virol 78 ( Pt 9), 2235-45.
227
Viatour, P., Merville, M. P., Bours, V., and Chariot, A. (2005). Phosphorylation of NFkappaB and IkappaB proteins: implications in cancer and inflammation. Trends
Biochem Sci 30(1), 43-52.
Vieira, P., de Waal-Malefyt, R., Dang, M. N., Johnson, K. E., Kastelein, R., Fiorentino, D. F.,
deVries, J. E., Roncarolo, M. G., Mosmann, T. R., and Moore, K. W. (1991). Isolation
and expression of human cytokine synthesis inhibitory factor cDNA clones: homology
to Epstein-Barr virus open reading frame BCRFI. Proc Natl Acad Sci U S A 88(4),
1172-6.
Vilcek, J., and Lee, T. H. (1991). Tumor necrosis factor. New insights into the molecular
mechanisms of its multiple actions. J Biol Chem 266(12), 7313-6.
Visintin, A., Mazzoni, A., Spitzer, J. A., and Segal, D. M. (2001). Secreted MD-2 is a large
polymeric protein that efficiently confers lipopolysaccharide sensitivity to Toll-like
receptor 4. Proc Natl Acad Sci U S A 98(21), 12156-61.
Vitale, M., Caruso, A., De Francesco, M. A., Rodella, L., Bozzo, L., Garrafa, E., Grassi, M.,
Gobbi, G., Cacchioli, A., and Fiorentini, S. (2003). HIV-1 matrix protein p17
enhances the proliferative activity of natural killer cells and increases their ability to
secrete proinflammatory cytokines. Br J Haematol 120(2), 337-43.
Vives, E., Brodin, P., and Lebleu, B. (1997). A truncated HIV-1 Tat protein basic domain
rapidly translocates through the plasma membrane and accumulates in the cell
nucleus. J Biol Chem 272(25), 16010-7.
Vogel, J., Hinrichs, S. H., Reynolds, R. K., Luciw, P. A., and Jay, G. (1988). The HIV tat
gene induces dermal lesions resembling Kaposi's sarcoma in transgenic mice. Nature
335(6191), 606-11.
von der Weid, T., Beebe, A. M., Roopenian, D. C., and Coffman, R. L. (1996). Early
production of IL-4 and induction of Th2 responses in the lymph node originate from
an MHC class I-independent CD4+NK1.1- T cell population. J Immunol 157(10),
4421-7.
Wada, T., Takagi, T., Yamaguchi, Y., Ferdous, A., Imai, T., Hirose, S., Sugimoto, S., Yano,
K., Hartzog, G. A., Winston, F., Buratowski, S., and Handa, H. (1998). DSIF, a novel
transcription elongation factor that regulates RNA polymerase II processivity, is
composed of human Spt4 and Spt5 homologs. Genes Dev 12(3), 343-56.
Wajant, H., Pfizenmaier, K., and Scheurich, P. (2003). Tumor necrosis factor signaling. Cell
Death Differ 10(1), 45-65.
Waldmann, T. A. (2000). T-cell receptors for cytokines: targets for immunotherapy of
leukemia/lymphoma. Ann Oncol 11 Suppl 1, 101-6.
Walker, C. M., Moody, D. J., Stites, D. P., and Levy, J. A. (1986). CD8+ lymphocytes can
control HIV infection in vitro by suppressing virus replication. Science 234(4783),
1563-6.
Wang, D., Westerheide, S. D., Hanson, J. L., and Baldwin, A. S., Jr. (2000). Tumor necrosis
factor alpha-induced phosphorylation of RelA/p65 on Ser529 is controlled by casein
kinase II. J Biol Chem 275(42), 32592-7.
Wang, F. X., Xu, Y., Sullivan, J., Souder, E., Argyris, E. G., Acheampong, E. A., Fisher, J.,
Sierra, M., Thomson, M. M., Najera, R., Frank, I., Kulkosky, J., Pomerantz, R. J., and
Nunnari, G. (2005). IL-7 is a potent and proviral strain-specific inducer of latent HIV1 cellular reservoirs of infected individuals on virally suppressive HAART. J Clin
Invest 115(1), 128-37.
Wang, J., Crawford, K., Yuan, M., Wang, H., Gorry, P. R., and Gabuzda, D. (2002a).
Regulation of CC chemokine receptor 5 and CD4 expression and human
immunodeficiency virus type 1 replication in human macrophages and microglia by T
helper type 2 cytokines. J Infect Dis 185(7), 885-97.
228
Wang, J., Harada, A., Matsushita, S., Matsumi, S., Zhang, Y., Shioda, T., Nagai, Y., and
Matsushima, K. (1998). IL-4 and a glucocorticoid up-regulate CXCR4 expression on
human CD4+ T lymphocytes and enhance HIV-1 replication. J Leukoc Biol 64(5),
642-9.
Wang, L., Mukherjee, S., Jia, F., Narayan, O., and Zhao, L. J. (1995). Interaction of virion
protein Vpr of human immunodeficiency virus type 1 with cellular transcription factor
Sp1 and trans-activation of viral long terminal repeat. J Biol Chem 270(43), 25564-9.
Wang, M. C., Dolphin, A., and Kitmitto, A. (2004). L-type voltage-gated calcium channels:
understanding function through structure. FEBS Lett 564(3), 245-50.
Wang, W. L., Yeh, S. F., Chang, Y. I., Hsiao, S. F., Lian, W. N., Lin, C. H., Huang, C. Y.,
and Lin, W. J. (2003). PICK1, an anchoring protein that specifically targets protein
kinase Calpha to mitochondria selectively upon serum stimulation in NIH 3T3 cells. J
Biol Chem 278(39), 37705-12.
Wang, Y., Underwood, J., Vaughan, R., Harmer, A., Doyle, C., and Lehner, T. (2002b). Alloimmunization elicits CCR5 antibodies, SDF-1 chemokines, and CD8-suppressor
factors that inhibit transmission of R5 and X4 HIV-1 in women. Clin Exp Immunol
129(3), 493-501.
Waskiewicz, A. J., Flynn, A., Proud, C. G., and Cooper, J. A. (1997). Mitogen-activated
protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. Embo J 16(8),
1909-20.
Watson, K., Gooderham, N. J., Davies, D. S., and Edwards, R. J. (1999). Interaction of the
transactivating protein HIV-1 tat with sulphated polysaccharides. Biochem Pharmacol
57(7), 775-83.
Watts, A. D., Hunt, N. H., Hambly, B. D., and Chaudhri, G. (1997). Separation of tumor
necrosis factor alpha isoforms by two-dimensional polyacrylamide gel electrophoresis.
Electrophoresis 18(7), 1086-91.
Wei, P., Garber, M. E., Fang, S. M., Fischer, W. H., and Jones, K. A. (1998). A novel CDK9associated C-type cyclin interacts directly with HIV-1 Tat and mediates its highaffinity, loop-specific binding to TAR RNA. Cell 92(4), 451-62.
Wei, Y., Yu, L., Bowen, J., Gorovsky, M. A., and Allis, C. D. (1999). Phosphorylation of
histone H3 is required for proper chromosome condensation and segregation. Cell
97(1), 99-109.
Weiden, M., Tanaka, N., Qiao, Y., Zhao, B. Y., Honda, Y., Nakata, K., Canova, A., Levy, D.
E., Rom, W. N., and Pine, R. (2000). Differentiation of monocytes to macrophages
switches the Mycobacterium tuberculosis effect on HIV-1 replication from stimulation
to inhibition: modulation of interferon response and CCAAT/enhancer binding protein
beta expression. J Immunol 165(4), 2028-39.
Weinmann, A. S., Mitchell, D. M., Sanjabi, S., Bradley, M. N., Hoffmann, A., Liou, H. C.,
and Smale, S. T. (2001). Nucleosome remodeling at the IL-12 p40 promoter is a TLRdependent, Rel-independent event. Nat Immunol 2(1), 51-7.
Weiss, R. A., and Wrangham, R. W. (1999). From Pan to pandemic. Nature 397(6718), 3856.
Weissenhorn, W., Dessen, A., Harrison, S. C., Skehel, J. J., and Wiley, D. C. (1997). Atomic
structure of the ectodomain from HIV-1 gp41. Nature 387(6631), 426-30.
Weissman, D., Poli, G., and Fauci, A. S. (1994). Interleukin 10 blocks HIV replication in
macrophages by inhibiting the autocrine loop of tumor necrosis factor alpha and
interleukin 6 induction of virus. AIDS Res Hum Retroviruses 10(10), 1199-206.
Weissman, D., Poli, G., and Fauci, A. S. (1995). IL-10 synergizes with multiple cytokines in
enhancing HIV production in cells of monocytic lineage. J Acquir Immune Defic
Syndr Hum Retrovirol 9(5), 442-9.
229
Werts, C., Tapping, R. I., Mathison, J. C., Chuang, T. H., Kravchenko, V., Saint Girons, I.,
Haake, D. A., Godowski, P. J., Hayashi, F., Ozinsky, A., Underhill, D. M.,
Kirschning, C. J., Wagner, H., Aderem, A., Tobias, P. S., and Ulevitch, R. J. (2001).
Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism.
Nat Immunol 2(4), 346-52.
Westendorp, M. O., Frank, R., Ochsenbauer, C., Stricker, K., Dhein, J., Walczak, H., Debatin,
K. M., and Krammer, P. H. (1995a). Sensitization of T cells to CD95-mediated
apoptosis by HIV-1 Tat and gp120. Nature 375, 497-500.
Westendorp, M. O., Shatrov, V. A., Schulze-Osthoff, K., Frank, R., Kraft, M., Los, M.,
Krammer, P. H., Droge, W., and Lehmann, V. (1995b). HIV-1 Tat potentiates TNFinduced NF-kappa B activation and cytotoxicity by altering the cellular redox state.
Embo J 14(3), 546-54.
Weston, C. R., and Davis, R. J. (2002). The JNK signal transduction pathway. Curr Opin
Genet Dev 12(1), 14-21.
Wetsel, W. C., Khan, W. A., Merchenthaler, I., Rivera, H., Halpern, A. E., Phung, H. M.,
Negro-Vilar, A., and Hannun, Y. A. (1992). Tissue and cellular distribution of the
extended family of protein kinase C isoenzymes. J Cell Biol 117(1), 121-33.
Wetzler, L. M. (2003). The role of Toll-like receptor 2 in microbial disease and immunity.
Vaccine 21 Suppl 2, S55-60.
Whitcomb, J. M., Kumar, R., and Hughes, S. H. (1990). Sequence of the circle junction of
human immunodeficiency virus type 1: implications for reverse transcription and
integration. J Virol 64(10), 4903-6.
Whitmarsh, A. J., Cavanagh, J., Tournier, C., Yasuda, J., and Davis, R. J. (1998). A
mammalian scaffold complex that selectively mediates MAP kinase activation.
Science 281(5383), 1671-4.
Wilk, T., Gross, I., Gowen, B. E., Rutten, T., de Haas, F., Welker, R., Krausslich, H. G.,
Boulanger, P., and Fuller, S. D. (2001). Organization of immature human
immunodeficiency virus type 1. J Virol 75(2), 759-71.
Willey, R. L., Maldarelli, F., Martin, M. A., and Strebel, K. (1992a). Human
immunodeficiency virus type 1 Vpu protein induces rapid degradation of CD4. J Virol
66(12), 7193-200.
Willey, R. L., Maldarelli, F., Martin, M. A., and Strebel, K. (1992b). Human
immunodeficiency virus type 1 Vpu protein regulates the formation of intracellular
gp160-CD4 complexes. J Virol 66(1), 226-34.
Windsor, W. T., Syto, R., Tsarbopoulos, A., Zhang, R., Durkin, J., Baldwin, S., Paliwal, S.,
Mui, P. W., Pramanik, B., Trotta, P. P., and et al. (1993). Disulfide bond assignments
and secondary structure analysis of human and murine interleukin 10. Biochemistry
32(34), 8807-15.
Woronicz, J. D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D. V. (1997). IkappaB kinasebeta: NF-kappaB activation and complex formation with IkappaB kinase-alpha and
NIK. Science 278(5339), 866-9.
Wright, S. C., Jewett, A., Mitsuyasu, R., and Bonavida, B. (1988). Spontaneous cytotoxicity
and tumor necrosis factor production by peripheral blood monocytes from AIDS
patients. J Immunol 141(1), 99-104.
Wu, L., and KewalRamani, V. N. (2006). Dendritic-cell interactions with HIV: infection and
viral dissemination. Nat Rev Immunol 6(11), 859-68.
Wu, Y., and Marsh, J. W. (2001). Selective transcription and modulation of resting T cell
activity by preintegrated HIV DNA. Science 293(5534), 1503-6.
230
Wyllie, D. H., Kiss-Toth, E., Visintin, A., Smith, S. C., Boussouf, S., Segal, D. M., Duff, G.
W., and Dower, S. K. (2000). Evidence for an accessory protein function for Toll-like
receptor 1 in anti-bacterial responses. J Immunol 165(12), 7125-32.
Xiao, G., Harhaj, E. W., and Sun, S. C. (2001). NF-kappaB-inducing kinase regulates the
processing of NF-kappaB2 p100. Mol Cell 7(2), 401-9.
Xiao, H., Neuveut, C., Tiffany, H. L., Benkirane, M., Rich, E. A., Murphy, P. M., and Jeang,
K. T. (2000). Selective CXCR4 antagonism by Tat: implications for in vivo expansion
of coreceptor use by HIV-1. Proc Natl Acad Sci U S A 97(21), 11466-71.
Xie, M. H., Aggarwal, S., Ho, W. H., Foster, J., Zhang, Z., Stinson, J., Wood, W. I., Goddard,
A. D., and Gurney, A. L. (2000). Interleukin (IL)-22, a novel human cytokine that
signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol
Chem 275(40), 31335-9.
Xu, L. G., Wang, Y. Y., Han, K. J., Li, L. Y., Zhai, Z., and Shu, H. B. (2005). VISA is an
adapter protein required for virus-triggered IFN-beta signaling. Mol Cell 19(6), 72740.
Yamaguchi, Y., Takagi, T., Wada, T., Yano, K., Furuya, A., Sugimoto, S., Hasegawa, J., and
Handa, H. (1999). NELF, a multisubunit complex containing RD, cooperates with
DSIF to repress RNA polymerase II elongation. Cell 97(1), 41-51.
Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O.,
Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003a). Role of adaptor TRIF in
the MyD88-independent toll-like receptor signaling pathway. Science 301(5633), 6403.
Yamamoto, M., Sato, S., Hemmi, H., Uematsu, S., Hoshino, K., Kaisho, T., Takeuchi, O.,
Takeda, K., and Akira, S. (2003b). TRAM is specifically involved in the Toll-like
receptor 4-mediated MyD88-independent signaling pathway. Nat Immunol 4(11),
1144-50.
Yamamoto, Y., Verma, U. N., Prajapati, S., Kwak, Y. T., and Gaynor, R. B. (2003c). Histone
H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression.
Nature 423(6940), 655-9.
Yang, X., Chen, Y., and Gabuzda, D. (1999). ERK MAP kinase links cytokine signals to
activation of latent HIV-1 infection by stimulating a cooperative interaction of AP-1
and NF-kappaB. J Biol Chem 274(39), 27981-8.
Yang, X., and Gabuzda, D. (1999). Regulation of human immunodeficiency virus type 1
infectivity by the ERK mitogen-activated protein kinase signaling pathway. J Virol
73(4), 3460-6.
Yaron, A., Hatzubai, A., Davis, M., Lavon, I., Amit, S., Manning, A. M., Andersen, J. S.,
Mann, M., Mercurio, F., and Ben-Neriah, Y. (1998). Identification of the receptor
component of the IkappaBalpha-ubiquitin ligase. Nature 396(6711), 590-4.
Yarovinsky, F., Zhang, D., Andersen, J. F., Bannenberg, G. L., Serhan, C. N., Hayden, M. S.,
Hieny, S., Sutterwala, F. S., Flavell, R. A., Ghosh, S., and Sher, A. (2005). TLR11
activation of dendritic cells by a protozoan profilin-like protein. Science 308(5728),
1626-9.
Yasuda, J., Whitmarsh, A. J., Cavanagh, J., Sharma, M., and Davis, R. J. (1999). The JIP
group of mitogen-activated protein kinase scaffold proteins. Mol Cell Biol 19(10),
7245-54.
Yedavalli, V. S., Shih, H. M., Chiang, Y. P., Lu, C. Y., Chang, L. Y., Chen, M. Y., Chuang,
C. Y., Dayton, A. I., Jeang, K. T., and Huang, L. M. (2005). Human
immunodeficiency virus type 1 Vpr interacts with antiapoptotic mitochondrial protein
HAX-1. J Virol 79(21), 13735-46.
231
Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira,
K., Akira, S., and Fujita, T. (2004). The RNA helicase RIG-I has an essential function
in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5(7), 730-7.
Yu, X., Yu, Y., Liu, B., Luo, K., Kong, W., Mao, P., and Yu, X. F. (2003). Induction of
APOBEC3G ubiquitination and degradation by an HIV-1 Vif-Cul5-SCF complex.
Science 302(5647), 1056-60.
Zang, Q., Lu, Z., Curto, M., Barile, N., Shalloway, D., and Foster, D. A. (1997). Association
between v-Src and protein kinase C delta in v-Src-transformed fibroblasts. J Biol
Chem 272(20), 13275-80.
Zauli, G., Gibellini, D., Caputo, A., Bassini, A., Negrini, M., Monne, M., Mazzoni, M., and
Capitani, S. (1995). The human immunodeficiency virus type-1 Tat protein
upregulates Bcl-2 gene expression in Jurkat T-cell lines and primary peripheral blood
mononuclear cells. Blood 86(10), 3823-34.
Zennou, V., Petit, C., Guetard, D., Nerhbass, U., Montagnier, L., and Charneau, P. (2000).
HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101(2), 173-85.
Zhang, D., Zhang, G., Hayden, M. S., Greenblatt, M. B., Bussey, C., Flavell, R. A., and
Ghosh, S. (2004). A toll-like receptor that prevents infection by uropathogenic
bacteria. Science 303(5663), 1522-6.
Zhang, S., Han, J., Sells, M. A., Chernoff, J., Knaus, U. G., Ulevitch, R. J., and Bokoch, G.
M. (1995). Rho family GTPases regulate p38 mitogen-activated protein kinase
through the downstream mediator Pak1. J Biol Chem 270(41), 23934-6.
Zhong, H., May, M. J., Jimi, E., and Ghosh, S. (2002). The phosphorylation status of nuclear
NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol Cell 9(3),
625-36.
Zhong, H., Voll, R. E., and Ghosh, S. (1998). Phosphorylation of NF-kappa B p65 by PKA
stimulates transcriptional activity by promoting a novel bivalent interaction with the
coactivator CBP/p300. Mol Cell 1(5), 661-71.
Zhou, J. H., Broussard, S. R., Strle, K., Freund, G. G., Johnson, R. W., Dantzer, R., and
Kelley, K. W. (2001). IL-10 inhibits apoptosis of promyeloid cells by activating
insulin receptor substrate-2 and phosphatidylinositol 3'-kinase. J Immunol 167(8),
4436-42.
Zhou, M., Deng, L., Kashanchi, F., Brady, J. N., Shatkin, A. J., and Kumar, A. (2003). The
Tat/TAR-dependent phosphorylation of RNA polymerase II C-terminal domain
stimulates cotranscriptional capping of HIV-1 mRNA. Proc Natl Acad Sci U S A
100(22), 12666-71.
Zhou, S., Halle, A., Kurt-Jones, E. A., Cerny, A. M., Porpiglia, E., Rogers, M., Golenbock, D.
T., and Finberg, R. W. (2008). Lymphocytic Choriomeningitis Virus (LCMV)
infection of CNS glial cells results in TLR2-MyD88/Mal-dependent inflammatory
responses. J Neuroimmunol 194(1-2), 70-82.
Zhou, W., Parent, L. J., Wills, J. W., and Resh, M. D. (1994). Identification of a membranebinding domain within the amino-terminal region of human immunodeficiency virus
type 1 Gag protein which interacts with acidic phospholipids. J Virol 68(4), 2556-69.
Ziegler, A., and Seelig, J. (2004). Interaction of the protein transduction domain of HIV-1
TAT with heparan sulfate: binding mechanism and thermodynamic parameters.
Biophys J 86(1 Pt 1), 254-63.
Zimmerman, C., Klein, K. C., Kiser, P. K., Singh, A. R., Firestein, B. L., Riba, S. C., and
Lingappa, J. R. (2002). Identification of a host protein essential for assembly of
immature HIV-1 capsids. Nature 415(6867), 88-92.
232
Zocchi, M. R., Poggi, A., and Rubartelli, A. (1997). The RGD-containing domain of
exogenous HIV-1 Tat inhibits the engulfment of apoptotic bodies by dendritic cells.
Aids 11(10), 1227-35.
Zocchi, M. R., Rubartelli, A., Morgavi, P., and Poggi, A. (1998). HIV-1 Tat inhibits human
natural killer cell function by blocking L-type calcium channels. J Immunol 161(6),
2938-43.
233
Références des figures
Figure
Titre
Réference
1
Histoire du VIH
Schéma
2
Origine simienne du VIH
(Stebbing, Gazzard, and Douek, 2004)
3
Exemples de rétrovirus
Filed’s Virology, 2007
4
Structure du VIH
(Freed, 1998) ; Kuby, Janis. 2003
5
Structure des glycoprotéines d’enveloppe
(Prabakaran et al., 2007)
6
La transcriptase inverse
Filed’s Virology, 2007
7
Structure de la protéine Tat
Schéma
8
Rôle de la protéine Vif
(Strebel, 2007)
9
Rôle de la protéine Vpr
(Zhao, Elder, and Bukrinsky, 2007)
10
Rôle de la protéine Vpu
(Zhao, Elder, and Bukrinsky, 2007)
11
Structure du génome viral
Filed’s Virology, 2007 ; Kuby, Janis. 2003
12
Cycle de réplication du VIH-1
(Rambaut et al., 2004)
13
Récepteurs du VIH
Bukrinsky, M.et al., 2001. Encyclopedia of
14
Etapes de fusion entre VIH-1 et cellule cible
life.
15
Etapes de transcription inverse
(Chan and Kim, 1998)
16
Transport intracellulaire du VIH
Schéma
17
Intégration du génome viral
(Arhel et al., 2007)
18
Structure du LTR (Long Terminal Repeat)
Filed’s Virology, 2007
19
Transcription du génome viral
20
Transcription du génome viral médié par Tat
(Peterlin and Trono, 2003)
21
Rôle de la protéine Rev dans l’export
(Gatignol, 2007)
22
Traduction des protéines virales
Filed’s Virology, 2007
23
Bourgeonnement des virions
(Peterlin and Trono, 2003)
24
Maturation de la particule virale
Filed’s Virology, 2007
25
Profile sérologique au cours de l’infection
Henderson, L. et Arthur L.
26
Maladies opportunistes (Infections)
Filed’s Virology, 2007
27
Maladies opportunistes (Tumeurs)
ABC of AIDS, 2001
28
Etapes d’inhibition du cycle viral
ABC of AIDS, 2001
29
Régulation de l’équilibre TH1/TH2
Filed’s Virology, 2007
30
Signalisation TNF-α
Kuby, Janis. 2003
31
IL-10 et réponse immunitaire
Saha, R.N., 2007. J. Neurochem.
32
Domaine de modification de la protéine Tat
Kryworuchko, W., 2006. Med. Intelligence
234
33
Multiples fonctions de la protéine Tat
unit
34
Internalisation de la protéine Tat
(Gatignol, 2007)
35
Effets de la protéine Tat exogène via les CCL
(Peruzzi, 2006)
36
Structure des dimères Toll-like receptors
(Vendeville et al., 2004)
37
Localisation et ligands des TLR
(Rubartelli et al., 1998)
38
Signalisation TLR MyD88-dépendante
(Beutler et al., 2006)
39
Les récepteurs à l’IP3
Kaisho, T. et al., 2005. Encyclopedia of life
2+
40
Mobilisation du Ca intracellulaire
www.Invivogen.com
41
Les isoformes des PKC
Signal transduction, 2002
42
Activation des PKC par phosphorylation
Signal transduction, 2002
43
Activation des PKC par le DAG
Signal transduction, 2002
44
Famille des MAP kinases et leurs substrats
Signal transduction, 2002
45
Activation des MAP kinases
Signal transduction, 2002
46
Famille NF-kB
Tableau récapitulatif
47
Les protéines IKK
(Dong, Davis, and Flavell, 2002)
48
Activation des protéines IKK
(Li and Verma, 2002)
49
Famille des protéines IkB
(Hacker and Karin, 2006)
50
Processus d’ubiquitinylation
(Hacker and Karin, 2006)
51
Dégradation préférentielle via le protéasome
(Li and Verma, 2002)
52
Les trois voies d’activationde NF-kB
(Ciechanover and Schwartz, 1998)
53
Modulation de l’activité de p65
Zhijian, J.C., 2005. Nature cell biology
54
Structure de la chromatine
(Viatour et al., 2005)
55
Code des histones
(Viatour et al., 2005)
(Felsenfeld and Groudine, 2003)
(Lacoste and Cote, 2003)
235
Arhel, N. J., Souquere-Besse, S., Munier, S., Souque, P., Guadagnini, S., Rutherford, S.,
Prevost, M. C., Allen, T. D., and Charneau, P. (2007). HIV-1 DNA Flap formation
promotes uncoating of the pre-integration complex at the nuclear pore. Embo J 26(12),
3025-37.
Beutler, B., Jiang, Z., Georgel, P., Crozat, K., Croker, B., Rutschmann, S., Du, X., and Hoebe,
K. (2006). Genetic analysis of host resistance: Toll-like receptor signaling and
immunity at large. Annu Rev Immunol 24, 353-89.
Chan, D. C., and Kim, P. S. (1998). HIV entry and its inhibition. Cell 93(5), 681-4.
Ciechanover, A., and Schwartz, A. L. (1998). The ubiquitin-proteasome pathway: the
complexity and myriad functions of proteins death. Proc Natl Acad Sci U S A 95(6),
2727-30.
Dong, C., Davis, R. J., and Flavell, R. A. (2002). MAP kinases in the immune response. Annu
Rev Immunol 20, 55-72.
Felsenfeld, G., and Groudine, M. (2003). Controlling the double helix. Nature 421(6921),
448-53.
Freed, E. O. (1998). HIV-1 gag proteins: diverse functions in the virus life cycle. Virology
251(1), 1-15.
Gatignol, A. (2007). Transcription of HIV: Tat and cellular chromatin. Adv Pharmacol 55,
137-59.
Hacker, H., and Karin, M. (2006). Regulation and function of IKK and IKK-related kinases.
Sci STKE 2006(357), re13.
Lacoste, N., and Cote, J. (2003). [The epigenetic code of histones]. Med Sci (Paris) 19(10),
955-9.
Li, Q., and Verma, I. M. (2002). NF-kappaB regulation in the immune system. Nat Rev
Immunol 2(10), 725-34.
Peruzzi, F. (2006). The multiple functions of HIV-1 Tat: proliferation versus apoptosis. Front
Biosci 11, 708-17.
Peterlin, B. M., and Trono, D. (2003). Hide, shield and strike back: how HIV-infected cells
avoid immune eradication. Nat Rev Immunol 3(2), 97-107.
Prabakaran, P., Dimitrov, A. S., Fouts, T. R., and Dimitrov, D. S. (2007). Structure and
function of the HIV envelope glycoprotein as entry mediator, vaccine immunogen, and
target for inhibitors. Adv Pharmacol 55, 33-97.
Rambaut, A., Posada, D., Crandall, K. A., and Holmes, E. C. (2004). The causes and
consequences of HIV evolution. Nat Rev Genet 5(1), 52-61.
Rubartelli, A., Poggi, A., Sitia, R., and Zocchi, M. R. (1998). HIV-I Tat: a polypeptide for all
seasons. Immunol Today 19(12), 543-5.
Stebbing, J., Gazzard, B., and Douek, D. C. (2004). Where does HIV live? N Engl J Med
350(18), 1872-80.
Strebel, K. (2007). HIV accessory genes Vif and Vpu. Adv Pharmacol 55, 199-232.
Vendeville, A., Rayne, F., Bonhoure, A., Bettache, N., Montcourrier, P., and Beaumelle, B.
(2004). HIV-1 Tat enters T-cells using coated pits before translocating from acidified
endosomes and eliciting biological responses. Mol Biol Cell.
Viatour, P., Merville, M. P., Bours, V., and Chariot, A. (2005). Phosphorylation of NFkappaB and IkappaB proteins: implications in cancer and inflammation. Trends
Biochem Sci 30(1), 43-52.
Zhao, R. Y., Elder, R. T., and Bukrinsky, M. (2007). Interactions of HIV-1 viral protein R
with host cell proteins. Adv Pharmacol 55, 233-60.
236